Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
Aim: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1) in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR cell lines. Methods: HL60 cell...
Saved in:
Date: | 2006 |
---|---|
Main Authors: | , , |
Format: | Article |
Language: | English |
Published: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2006
|
Series: | Experimental Oncology |
Subjects: | |
Online Access: | http://dspace.nbuv.gov.ua/handle/123456789/137564 |
Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
Journal Title: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
Cite this: | Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine / U. Gunduz, Y. Baran, A.U. Uralsup // Experimental Oncology. — 2006. — Т. 28, № 2. — С. 163-165. — Бібліогр.: 16 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraineid |
irk-123456789-137564 |
---|---|
record_format |
dspace |
spelling |
irk-123456789-1375642018-06-18T03:03:57Z Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine Gunduz, U. Baran, Y. Uralsup, A.U. Short communications Aim: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1) in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR cell lines. Methods: HL60 cells (human acute myeloid leukemia cell line) were cultured on medium with 1–50 nM of VCR for 4–6 weeks, and VCR resistant cells (HL60/VCR) were selected. The viability of cells was assessed by MTT assay and the expression of MDR1 gene was detected by RT-PCR. Results: No expression of MDR1 gene was revealed in HL60 cells, but MDR1 started to be expressed after incubation of cells with 2 nM of VCR and its expression level elevates with increase of agent concentration. MTT test has shown that HL-60/VCR cells were 75-fold more resistant to VCR and 42-fold higher resistant to cytosine arabinoside (Ara-C) compared to sensitive HL60 cells. Conclusion: Aquired resistance to VCR and cross-resistance to Ara-C correlates with MDR1 gene expression in vitro. Целью работы было исследование участия Р-гликопротеина (Р-gp), продукта гена-1 множественной лекарственной устойчивости (MDR1) в устойчивости клеток лейкемии человека к винкристину (ВКР) и перекрестной резистентности к цитозинарабинозиду (Аrа-C). Методы: клетки острой миелоидной лейкемии линии HL60 культивировали в среде с 1–50 и ВКР в течение 4–6 нед, после чего были отселектированы ВКР-резистентные клетки (HL60/ВКР). Влияние препаратов на жизнеспособность клеток изучали при помощи МТТ-метода, экспресию гена MDR — методом полимеразной цепной реакции обратной транскрипции. Результаты: в клетках линии HL60 экспрессия гена MDR не была выявлена, но была зарегистрирована после инкубации клеток с 2 нM ВКР, причем ее уровень возрастал по мере повышения концентрации ВКР в среде инкубации. Показано, что устойчивость клеток линии HL-60/ВКР к ВКР и Аrа-C в 75 и в 42 раза выше, соотвественно, чем таковая клеток линии HL60. Выводы: приобретенная устойчивость к ВКР и перекрестная устойчивость к Аrа-C коррелирует с уровнем экспрессии гена MDR . 2006 Article Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine / U. Gunduz, Y. Baran, A.U. Uralsup // Experimental Oncology. — 2006. — Т. 28, № 2. — С. 163-165. — Бібліогр.: 16 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/137564 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
collection |
DSpace DC |
language |
English |
topic |
Short communications Short communications |
spellingShingle |
Short communications Short communications Gunduz, U. Baran, Y. Uralsup, A.U. Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine Experimental Oncology |
description |
Aim: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1) in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR cell lines. Methods: HL60 cells (human acute myeloid leukemia cell line) were cultured on medium with 1–50 nM of VCR for 4–6 weeks, and VCR resistant cells (HL60/VCR) were selected. The viability of cells was assessed by MTT assay and the expression of MDR1 gene was detected by RT-PCR. Results: No expression of MDR1 gene was revealed in HL60 cells, but MDR1 started to be expressed after incubation of cells with 2 nM of VCR and its expression level elevates with increase of agent concentration. MTT test has shown that HL-60/VCR cells were 75-fold more resistant to VCR and 42-fold higher resistant to cytosine arabinoside (Ara-C) compared to sensitive HL60 cells. Conclusion: Aquired resistance to VCR and cross-resistance to Ara-C correlates with MDR1 gene expression in vitro. |
format |
Article |
author |
Gunduz, U. Baran, Y. Uralsup, A.U. |
author_facet |
Gunduz, U. Baran, Y. Uralsup, A.U. |
author_sort |
Gunduz, U. |
title |
Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine |
title_short |
Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine |
title_full |
Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine |
title_fullStr |
Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine |
title_full_unstemmed |
Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine |
title_sort |
cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine |
publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
publishDate |
2006 |
topic_facet |
Short communications |
url |
http://dspace.nbuv.gov.ua/handle/123456789/137564 |
citation_txt |
Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine / U. Gunduz, Y. Baran, A.U. Uralsup // Experimental Oncology. — 2006. — Т. 28, № 2. — С. 163-165. — Бібліогр.: 16 назв. — англ. |
series |
Experimental Oncology |
work_keys_str_mv |
AT gunduzu crossresistancetocytosinearabinosideinhumanacutemyeloidleukemiacellsselectedforresistancetovincristine AT barany crossresistancetocytosinearabinosideinhumanacutemyeloidleukemiacellsselectedforresistancetovincristine AT uralsupau crossresistancetocytosinearabinosideinhumanacutemyeloidleukemiacellsselectedforresistancetovincristine |
first_indexed |
2025-07-10T02:35:22Z |
last_indexed |
2025-07-10T02:35:22Z |
_version_ |
1837225661454876672 |
fulltext |
Experimental Oncology ���� ��������� ���� ���ne�� ������� ��������� ���� ���ne�� �����ne�� ����� ��� ���
Cell�lar dr�g resistance�� either acq�ired or intrin
sic�� remains a major ca�se of fail�re in chemotherapy
of hematological malignancies and solid t�mors. Cells
exposed to toxic compo�nds can develop resistance
by a n�mber of mechanisms incl�ding increased excre
tion�� decreased �ptake�� increased detoxification or
alteration of target proteins [�]. Several of these path
ways can lead to m�ltidr�g resistance �MDR��. In this
case�� cells are resistant to several commonly �sed
dr�gs in addition to initially applied compo�nd [�]. The
ATPbinding cassette �ABC�� genes play the leading
role in the development of MDR. These genes repre
sent the largest family of transmembrane proteins that
bind ATP and �se the energy to drive the transport of
vario�s molec�les across cell membrane [��4].
One known mechanism�� contrib�ted to this phenome
non�� involves expression of Pglycoprotein �Pgp��. Pgp
is incl�ded in large s�per family of transport proteins��
termed ATP Binding Cassette �ABC�� [�]. MDR1 gene��
located on chromosome 7�� encodes a �7� kDa glycopro
tein. Pgp possesses wide s�bstrate specificity for str�c
t�rally different dr�gs and�� conseq�ently�� mediates dr�g
resistance to variety of dr�gs�� incl�ding vinca alkaloids��
anthracyclines�� epipodophyllotoxins�� taxols�� actinomycin
D�� cardiac glycosides�� imm�nos�ppressive agents�� gl�
cocorticoids�� antiHIV protease inhibitors [�]..
All the s�bstrates of Pgp are large hydrophobic and
amphipathic molec�les�� altho�gh they have no str�c
t�ral similarity. These molec�les are able to intercalate
into the membrane and enter the cytosol by passive
diff�sion. It is no longer believed that Pgp is a classi
cal p�mp�� which binds s�bstrates from the extracell�lar
fl�id and then transports these over the membrane.
Hydrophobic compo�nds that are s�bstrates for Pgp
do not f�lly penetrate into the cytoplasm of cells that
express Pgp. Interaction of s�bstrate with Pgp has
been shown to take place within the membrane.
Since a wide spectr�m of dr�gs is affected by MDR1
gene�� it is an attractive candidate to st�dy the phenome
non of dr�g resistance [4]. MDR1 gene overexpression
in hematological malignancies �ac�te myelogeno�s
le�kemia�� m�ltiple myeloma�� malignant lymphomas�� at
the time of diagnosis points on its clinical importance as
prognostic factor [��� 7]. In vitro research provides signifi
cant opport�nities to st�dy the mechanisms of m�ltidr�g
resistance. Resistant cell lines co�ld be established by
grad�al increase of concentration of cytotoxic agent [�].
In present st�dy h�man ac�te myeloid le�kemia
cell line resistant to vincristine �HL��/VCR�� was estab
lished by grad�al �from passage to passage�� increase
of VCR concentration�� and then crossresistance to
AraC in established resistant line was detected.
Chemicals. RPMI ��4��� fetal calf ser�m�� penicil
lin�� streptomycin ��� mg/ml���� Lgl�tamine and trypan
bl�e sol�tions were obtained from Biological Ind�stries
�Israel��. Trizol reagent was obtained from Life Technolo
gies �Israel��. Moloney M�rine Le�kemia ReverseTrans
criptase�� Taq DNA polymerase�� RNAse inhibitor�� and
DNA size marker ��������� bp�� were obtained from
Fermentas �USA��. The set of deoxyn�cleotide �dNTP����
isopropanol�� agarose and MTT were from Sigma �USA��.
PBS was obtained from Oxoid �England��. Diethylepyro
carbonate �DEPC�� was obtained from Applichem �Ger
many��. Formaldehyde ��7%�� was obtained from Merck
�Germany��. PCR primers and OligodT were obtained
from Integrated DNA Technologies �USA��. Chloroform
CROSS-RESISTANCE TO CYTOSINE ARABINOSIDE IN HUMAN
ACUTE MYELOID LEUKEMIA CELLS SELECTED FOR RESISTANCE
TO VINCRISTINE
Y. ����������1, *, U. Gu�duz1, �.U. U����.U. U���2, 3
1Department of Biological Sciences, Middle East Technical University, Ankara, Turkey
2Department of Hematology, Gulhane Military Medical Academy, Ankara, Turkey
3Medical Research Center, Gulhane Military Medical Academy, Ankara, Turkey
�im: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1)
in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR
cell lines. Methods: HL60 cells (human acute myeloid leukemia cell line) were cultured on medium with 1–50 nM of VCR for 4–6 weeks,
and VCR resistant cells (HL60/VCR) were selected. The viability of cells was assessed by MTT assay and the expression of MDR1 gene
was detected by RT-PCR. Resu�ts: No expression of MDR1 gene was revealed in HL60 cells, but MDR1 started to be expressed after
incubation of cells with 2 nM of VCR and its expression level elevates with increase of agent concentration. MTT test has shown that
HL-60/VCR cells were 75-fold more resistant to VCR and 42-fold higher resistant to cytosine arabinoside (Ara-C) compared to sensitive
HL60 cells. Co�c�usio�: Aquired resistance to VCR and cross-resistance to Ara-C correlates with MDR1 gene expression i� vit�o.
Key Wo�ds: multidrug resistance, P-glycoprotein, HL60, vincristine, cytosine arabinoside.
Received: April 5, 2006.
*Correspondence: Fax: +90-312-210-7976
E-mail: ybaran@metu.edu.tr
Abbreviations used: ABC — ATP binding cassette; AML — acute
myeloid leukemia; Ara-C — cytosine arabinoside; DEP-C – diethyle-
pyrocarbonate; HL60/VCR – vincristine-resistant HL60 cells; (IC)50 —
concentration of agent that inhibits cell growth by 50%; MDR1 –
gene 1 of multidrug resistance; MTT — 3-(4, 5-dimethylthiazol-2-yl)-
2-5-diphenyltetrazolium bromide; P-gp — P-glycoprotein; RT-PCR —
reverse transcriptase-polymerase chain reaction; VCR — vincristinе.
Exp Oncol ����
���� ��� �������
��4 Experimental Oncology ���� ��������� ���� ���ne��
was obtained from Lab Scan Analytical Sciences �Ire
land��. VCR and AraC were kindly provided by G�lhane
Military Medical School �Ankara�� T�rkey��.
Cell culture. H�man ac�te myeloid le�kemia HL��
cells were kindly provided by G�lhane Military Medical
School �T�rkey��. HL�� cells were maintained in RPMI ��4�
growth medi�m�� containing ��% fetal calf ser�m �FCS�� and
�% penicillinstreptomycin sol�tion�� at �7 oC in �% CO�.
Generation of resistant sublines. HL�� cells
were exposed to grad�ally increasing concentration of
VCR�� starting from � nM and �p to �� nM�� and resistant
cells were selected�� passaged and exposed to higher
concentration of VCR. In this way�� s�bpop�lations of
cells with different degree of VCR resistance were
generated. The level of resistance was defined by the
VCR concentration at which the growth rate of cells
was comparable to �ntreated parental cells.
Measurement of cell growth by 3-(4, 5-Dimethyl-
thiazol-2-yl)-2-5 diphenyltetrazolium-bromide (MTT)
assay. The concentrations of VCR and AraC�� which in
hibited cell growth by ��% �IC���� were eval�ated �sing
MTTassay [9]. HL�� cells �� × ��4 cells/well�� were plated
into 9�well plates�� containing ��� µl of c�lt�re medi�m
in the absence or presence of different concentrations of
VCR and AraC at �7 oC in �% CO� for 4� h. Then they were
treated with � µl of MTT �� mg/ml�� for 4 h. The s�perna
tants in the wells were discarded and dark bl�e crystals
were dissolved with the addition of acidified isopropanol
��.�4 N HCl in isopropanol��. Plates were examined with
microplate reader at �7� nm�� and IC�� concentrations of
compo�nd were determined from cell s�rvival plots [9].[9]. For
each concentration of dr�g�� � wells were co�nted.
RNA isolation. Total RNA was isolated from � x ��� HL��
and HL��/VCR cells�� �sing Trizol reagent �with g�anidi�m
thiocyanate�� phenol and sodi�m citrate�� �Life Technolo
gies�� Israel��. Q�antification of RNA was performed�� �sing
UV spectrophotometer the wave length of ��� nm.
Reverse transcription-polymerase chain reac-polymerase chain reac-
tion (RT-PCR). RTPCR was carried o�t for �� min at
4� °C in a total vol�me of �� µl�� containing �� �nits of
ribon�clease inhibitor�� �.� µg oligodT�� �.� mM of each
dNTP�� ��� �nits of reverse transcriptase�� and � µg of
total cell�lar RNA. When mRNA template was created��
PCR analysis was performed.
For eval�ation of MDR1 gene expression�� forward
primer ��´TACAGTGGAATTGGTGCTGGG�´�� and re
verse primer ��´TACAGTGGAATTGGTGCTGGG�´�� were
�sed. The reaction mix with two primers was amplified
d�ring �� cycles �94 °C�� �� s; �� °C�� 4� s; 7� °C�� � min����
�sing Taq DNA polymerase.
The mRNA of β�microglob�lin was �sed as internal
positive control. For eval�ation of β�microglob�lin gene
expression�� forward primer ��´CTTACTGAAGAATG
GAGAGAGA�´�� and reverse primer ��´CTTACATGTCTC
TATCCCACTT�´�� were �sed [��]. The reaction mix was am
plified d�ring �� cycles �94 °C�� �� s; �� °C�� 4� s; 7� °C�� � min����
�sing Taq DNA polymerase. MDR� and β�microglob�lin
band intensities were meas�red densitometrically.
Expression of MDR1. The intactness of total RNA
was confirmed by two sharp bands of ��S rRNA and ��S
rRNA�� separated in denat�ring agarose gels and vis�alized
by ethidi�m bromide �EtBr�� staining �nder UV light. The
target MDR1 gene and the reference β�microglob�lin
gene were amplified by PCR. PCR prod�ct of MDR1
gene responds to ��� bp fragment�� while the prod�cts of
β�microglob�lin gene to ��� bp fragment. The level of
target gene expression is reflected in the ratio between
intensities of two res�lting PCR prod�ct bands on gel.
In this st�dy�� we tried to determine the differences in ex
pression levels of MDR1 gene in HL�� and HL��/VCR cells.
β�microglob�lin was �sed as an internal control since its
expression does not change �pon expos�re to VCR [��].
Increase of VCR concentrations res�lted in increased
expression of MDR1 gene �Fig. ���. Fig. � shows that there
was no expression of MDR1 gene in control cells and
HL�� cells�� treated with � nM of VCR. However�� HL�� cells
expressed MDR1 gene at the doses of VCR > � nM �see
Fig. ���. The res�lts strongly s�ggest that HL�� cells can
s�rvive at higher concentrations of VCR and this resistance
can be explained by overexpression of MDR1 gene.
Fig. 1. RTPCR analysis of expression of MDR1 gene in parental
�Lane ��� and VCRresistant HL�� cells �lanes ��� 4 — � nM and
�� nM VCR�� respectively��. Lane � — DNA ladder; lanes ��7 —
beta microglob�lin levels were �sed as internal positive control
Several dr�g resistance mechanisms�� in partic�lar with
the involvement of Pgp�� were identified [��� ���� ��].
Cell cytotoxicity assay. For each dr�g�� IC�� val�es
were determined by MTT assay �Fig. ��� ���. For VCR�� IC��
val�es for parental and VCRresistant HL�� cells were
4 nM and ��� nM respectively �see Fig. ����� whilst for
AraC — ����� nM and � nM respectively �see Fig. ���. The
res�lts indicated that the cells�� selected by VCR resistance��
also were resistant to AraC. HL��/VCR cells�� which
were more then 7�fold resistant to VCR�� also showed
4�fold increased resistance to AraC. These data are in
agreement with the res�lts of other a�thors [�����]. For
example�� KF�9 cell line resistant to adriamycin and VCR��
showed crossresistance to AraC [�4]. In another st�dy
it was shown that P��� cell line resistant to VCR also pos
sessed crossresistance to AraC [��].
Therape�tic strategies aiming to overcome
MDR1 gene overexpression may be �sef�l in enhance
ment cytotoxic effects of VCR. In this setting�� resistance
to VCR can be reversed�� at least in vitro�� by variety of
resistance modifying agents called MDR reversal mod�
lators or chemosensitizers [��]. MDR mod�lators often
reverse m�ltidr�g resistance by competing for the trans
port system responsible for MDR. Apart from reversal
mod�lators�� the antisense oligomers targeted MDR�
mRNA may also res�lt in decrease and even loss of re
sistance�� as there will be no Pgp synthesis.
In concl�sion�� we have shown that HL�� cells��
adapted to higher concentrations of VCR�� express
MDR1 gene at higher levels�� and also aq�ire cross
resistance to AraC.
Experimental Oncology ���� ��������� ���� ���ne�� ������� ��������� ���� ���ne�� �����ne�� ����� ��� ���
Fig. 2. Effect of VCR on viability of HL�� �triangles�� and HL��/
VCR �circles�� cells. IC�� concentration of VCR was determined
by MTT assay for each cell line in at least � independent experi
ments�� in triplicate per point
Fig. 3. Effect of AraC on viability of HL�� �triangles�� and
HL��/VCR �circles�� cells. The IC�� concentration of AraC IC��
concentration was determined by MTT assay for each cell line in
at least � independent experiments�� in triplicate per point
ACKNOwLEDgEMENT
This st�dy was s�pported by Middle East Technical
University f�nd AFP�����7������ grant and theAFP�����7������ grant and thegrant and the
project by Prime Ministry�� State Planning Organiza
tion f�nd DPT�7��K����4��4 grant. We wo�ldDPT�7��K����4��4 grant. We wo�ld grant. We wo�ld
like thanks to Bahar BARAN for her help in calc�lating
statistical analyses and preparing graphics.
REFERENCES
1. Borst P, Evers R, Kool M, Wijnholds J. A family of drug
transporters: the multidrug resistance-associated proteins.
J Natl Cancer Inst 2000; 92: 1295–302.
2. Chen CJ, Chin JE, Ueda K, Clark DP, Pastan I, Got-
tesman MM, Roninson IB. Internal duplication and homolo-
gy with bacterial transport proteins in the MDR1 gene from
multidrug resistant human cells. Cell 1986; 47: 381–9.
3. Christina L, Linn H, Malin B, Kourosh L, Christer P,
Staffan E. Mechanisms of cross-resistance between nucleoside
analogues and vincristine or daunorubicin in leukemic cells.
Biochem Biophys Res Com 2004; 320: 825–32.
4. Choudhury RC, Das B, Misra S, Jagdale MB. Cytogenetic
toxicity of vincristine. J Environ Pathol Toxicol Oncol 2000;
19: 347–55.
5. Dean M, Hamon Y, Chimini G. The human ATP-bind-
ing cassette (ABC) transporter superfamily. J Lipid Res 2001;
42: 1007–17.
6. Flahaut M, Muhlethaler-Mottet A, Martinet D, Fattet S,
Bourloud KB, Auderset K, Meier R, Schmutz NB, Delattre O, Jo-
seph JM, Gross N. Molecular cytogenetic characterization of doxo-
rubicin-resistant neuroblastoma cell lines: evidence that acquired
multidrug resistance results from a unique large amplification of the
7q21 region. Genes Chrom Cancer 2006; 45: 495–508.
7. Fukuda T, Kamishima T, Kakihara T, Ohnishi Y, Suzuki T.
Characterization of newly established human myeloid leuke-
mia cell line (KF-19) and its drug resistant cell lines. Leukemia
Res 1996; 20: 931–9.
8. Gottesman MM, Fojo T, Bates SE. Multidrug resistance
in cancer: role of ATP-dependent transporters. Nat Rev Cancer
2002; 2: 48–58.
9. Hirose M, Kuroda Y. P53 may mediate the MDR1 ex-
pression via the WT1 gene in human Vincristine-resistant leu-
kemia/lymphoma cell lines. Cancer Lett 1998;Cancer Lett 1998; 29: 165–71.
10. Hirose M. Biology and modulation of multidrug resis-
tance (MDR) in hematological malignancies. Int J Hematol
2002; 76: 206–11.
11. Litman T, Druley TE, Stein WD, Bates SE. From MDR
to MXR: new understanding of multidrug resistance systems,
their properties and clinical significance. Cell Mol Life Sci
2001; 58: 931–59.
12. Lopes EC, Scolnik M, Alvarez E, Silvia SE. Modula-Modula-
tor activity of PSC 833 and cyclosporine-A in vincristine and
doxorubicin-selected multidrug resistant murine leukemic
cells. Leukemia Res 2001; 25: 85–93.
13. Martin-Aragon S, Mukherjee SK, Taylor BJ, Ivy SP,
Fu CH, Ardi VC, Avramis VI. Cytosine arabinoside (Ara-C) resis-
tance confers cross-resistance or collateral sensitivity to other classes
of anti-leukemic drugs. Anticancer Res 2000; 20: 139–50.
14. Sonneveld O. Multidrug resistance in haematological
malignancies. J Intern Med 2000; 247: 521–34.
15. Sparreboom A, Nooter K. Does P-glycoprotein play a role in
anticancer drug pharmacokinetics? Drug Resist 2000; 3: 357–63.
16. Stavrovskaya AA. Multidrug resistance caused by the
activity of cellular transporters: some new data and future
prospectives. Biol Membr 2003; 20: 196–205.
Copyright © Experimental Oncology, 2006
ПЕРЕКРЕСТНАЯ УСТОЙЧИВОСТЬ К ЦИТОЗИНАРАБИНОЗИДУ
КЛЕТОК ЛИНИИ HL60, УСТОЙЧИВЫХ К ВИНКРИСТИНУ
Целью работы было исследование участия Р-гликопротеина (Р-gp), продукта гена-1 множественной лекарственной устойчивости
(MDR1) в устойчивости клеток лейкемии человека к винкристину (��Р) и перекрестной ре�истентности к �ито�инарабино�идуMDR1) в устойчивости клеток лейкемии человека к винкристину (��Р) и перекрестной ре�истентности к �ито�инарабино�иду1) в устойчивости клеток лейкемии человека к винкристину (��Р) и перекрестной ре�истентности к �ито�инарабино�иду
(Аrа-C). Методы: клетки острой миелоидной лейкемии линии HL60 кул�тивировали в среде с 1–50 нM ��Р в течение 4–6 нед,HL60 кул�тивировали в среде с 1–50 нM ��Р в течение 4–6 нед,60 кул�тивировали в среде с 1–50 нM ��Р в течение 4–6 нед,M ��Р в течение 4–6 нед, ��Р в течение 4–6 нед,
после чего были отселектированы ��Р-ре�истентные клетки (HL60/��Р). �лияние препаратов на жи�неспособност� клетокHL60/��Р). �лияние препаратов на жи�неспособност� клеток60/��Р). �лияние препаратов на жи�неспособност� клеток
и�учали при помощи МТТ-метода, экспресию гена MDR11 — методом полимера�ной �епной реак�ии обратной транскрип�ии.
Результаты: в клетках линии HL60экспрессиягенаHL60экспрессиягена60 экспрессия гена MDR11 не была выявлена, но была �арегистрирована после инкуба�ии клеток
с 2 нM ��Р, причем ее уровен� во�растал по мере повы�ения кон�ентра�ии ��Р в среде инкуба�ии. �ока�ано, что устойчи-M ��Р, причем ее уровен� во�растал по мере повы�ения кон�ентра�ии ��Р в среде инкуба�ии. �ока�ано, что устойчи- ��Р, причем ее уровен� во�растал по мере повы�ения кон�ентра�ии ��Р в среде инкуба�ии. �ока�ано, что устойчи-
вост� клеток линии HL-60/��Р к ��Р и Аrа-C в 75 и в 42 ра�а вы�е, соотвественно, чем таковая клеток линии HL60.HL-60/��Р к ��Р и Аrа-C в 75 и в 42 ра�а вы�е, соотвественно, чем таковая клеток линии HL60.-60/��Р к ��Р и Аrа-C в 75 и в 42 ра�а вы�е, соотвественно, чем таковая клеток линии HL60.HL60.60. Выводы:
приобретенная устойчивост� к ��Р и перекрестная устойчивост� к Аrа-C коррелирует с уровнем экспрессии гена MDR11.
Ключевые слова: множественная устойчивост� к препаратам, P-гликопротеин, HL60, винкристин, �ито�инарабино�ид.P-гликопротеин, HL60, винкристин, �ито�инарабино�ид.-гликопротеин, HL60, винкристин, �ито�инарабино�ид.HL60, винкристин, �ито�инарабино�ид.60, винкристин, �ито�инарабино�ид.
|