Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine

Aim: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1) in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR cell lines. Methods: HL60 cell...

Full description

Saved in:
Bibliographic Details
Date:2006
Main Authors: Gunduz, U., Baran, Y., Uralsup, A.U.
Format: Article
Language:English
Published: Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України 2006
Series:Experimental Oncology
Subjects:
Online Access:http://dspace.nbuv.gov.ua/handle/123456789/137564
Tags: Add Tag
No Tags, Be the first to tag this record!
Journal Title:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Cite this:Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine / U. Gunduz, Y. Baran, A.U. Uralsup // Experimental Oncology. — 2006. — Т. 28, № 2. — С. 163-165. — Бібліогр.: 16 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
id irk-123456789-137564
record_format dspace
spelling irk-123456789-1375642018-06-18T03:03:57Z Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine Gunduz, U. Baran, Y. Uralsup, A.U. Short communications Aim: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1) in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR cell lines. Methods: HL60 cells (human acute myeloid leukemia cell line) were cultured on medium with 1–50 nM of VCR for 4–6 weeks, and VCR resistant cells (HL60/VCR) were selected. The viability of cells was assessed by MTT assay and the expression of MDR1 gene was detected by RT-PCR. Results: No expression of MDR1 gene was revealed in HL60 cells, but MDR1 started to be expressed after incubation of cells with 2 nM of VCR and its expression level elevates with increase of agent concentration. MTT test has shown that HL-60/VCR cells were 75-fold more resistant to VCR and 42-fold higher resistant to cytosine arabinoside (Ara-C) compared to sensitive HL60 cells. Conclusion: Aquired resistance to VCR and cross-resistance to Ara-C correlates with MDR1 gene expression in vitro. Целью работы было исследование участия Р-гликопротеина (Р-gp), продукта гена-1 множе­ственной лекарственной устойчивости (MDR1) в устойчивости клеток лейкемии человека к винкристину (ВКР) и перекрестной резистентности к цитозинарабинозиду (Аrа-C). Методы: клетки острой миелоидной лейкемии линии HL60 культивировали в среде с 1–50 и ВКР в течение 4–6 нед, после чего были отселектированы ВКР-резистентные клетки (HL60/ВКР). Влияние препаратов на жизнеспособность клеток изучали при помощи МТТ-метода, экспресию гена MDR — методом полимеразной цепной реакции обратной транскрипции. Результаты: в клетках линии HL60 экспрессия гена MDR не была выявлена, но была зарегистрирована после инкубации клеток с 2 нM ВКР, причем ее уровень возрастал по мере повышения концентрации ВКР в среде инкубации. Показано, что устойчивость клеток линии HL-60/ВКР к ВКР и Аrа-C в 75 и в 42 раза выше, соотвественно, чем таковая клеток линии HL60. Выводы: приобретенная устойчивость к ВКР и перекрестная устойчивость к Аrа-C коррелирует с уровнем экспрессии гена MDR . 2006 Article Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine / U. Gunduz, Y. Baran, A.U. Uralsup // Experimental Oncology. — 2006. — Т. 28, № 2. — С. 163-165. — Бібліогр.: 16 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/137564 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection DSpace DC
language English
topic Short communications
Short communications
spellingShingle Short communications
Short communications
Gunduz, U.
Baran, Y.
Uralsup, A.U.
Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
Experimental Oncology
description Aim: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1) in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR cell lines. Methods: HL60 cells (human acute myeloid leukemia cell line) were cultured on medium with 1–50 nM of VCR for 4–6 weeks, and VCR resistant cells (HL60/VCR) were selected. The viability of cells was assessed by MTT assay and the expression of MDR1 gene was detected by RT-PCR. Results: No expression of MDR1 gene was revealed in HL60 cells, but MDR1 started to be expressed after incubation of cells with 2 nM of VCR and its expression level elevates with increase of agent concentration. MTT test has shown that HL-60/VCR cells were 75-fold more resistant to VCR and 42-fold higher resistant to cytosine arabinoside (Ara-C) compared to sensitive HL60 cells. Conclusion: Aquired resistance to VCR and cross-resistance to Ara-C correlates with MDR1 gene expression in vitro.
format Article
author Gunduz, U.
Baran, Y.
Uralsup, A.U.
author_facet Gunduz, U.
Baran, Y.
Uralsup, A.U.
author_sort Gunduz, U.
title Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
title_short Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
title_full Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
title_fullStr Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
title_full_unstemmed Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
title_sort cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine
publisher Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
publishDate 2006
topic_facet Short communications
url http://dspace.nbuv.gov.ua/handle/123456789/137564
citation_txt Cross-resistance to cytosine arabinoside in human acute myeloid leukemia cells selected for resistance to vincristine / U. Gunduz, Y. Baran, A.U. Uralsup // Experimental Oncology. — 2006. — Т. 28, № 2. — С. 163-165. — Бібліогр.: 16 назв. — англ.
series Experimental Oncology
work_keys_str_mv AT gunduzu crossresistancetocytosinearabinosideinhumanacutemyeloidleukemiacellsselectedforresistancetovincristine
AT barany crossresistancetocytosinearabinosideinhumanacutemyeloidleukemiacellsselectedforresistancetovincristine
AT uralsupau crossresistancetocytosinearabinosideinhumanacutemyeloidleukemiacellsselectedforresistancetovincristine
first_indexed 2025-07-10T02:35:22Z
last_indexed 2025-07-10T02:35:22Z
_version_ 1837225661454876672
fulltext Experimental Oncology ���� ��������� ���� ���ne�� ������� ��������� ���� ���ne�� �����ne�� ����� ��� ��� Cell�lar dr�g resistance�� either acq�ired or intrin­ sic�� remains a major ca�se of fail�re in chemotherapy of hematological malignancies and solid t�mors. Cells exposed to toxic compo�nds can develop resistance by a n�mber of mechanisms incl�ding increased excre­ tion�� decreased �ptake�� increased detoxification or alteration of target proteins [�]. Several of these path­ ways can lead to m�ltidr�g resistance �MDR��. In this case�� cells are resistant to several commonly �sed dr�gs in addition to initially applied compo�nd [�]. The ATP­binding cassette �ABC�� genes play the leading role in the development of MDR. These genes repre­ sent the largest family of transmembrane proteins that bind ATP and �se the energy to drive the transport of vario�s molec�les across cell membrane [��4]. One known mechanism�� contrib�ted to this phenome­ non�� involves expression of P­glycoprotein �P­gp��. P­gp is incl�ded in large s�per family of transport proteins�� termed ATP Binding Cassette �ABC�� [�]. MDR1 gene�� located on chromosome 7�� encodes a �7� kDa glycopro­ tein. P­gp possesses wide s�bstrate specificity for str�c­ t�rally different dr�gs and�� conseq�ently�� mediates dr�g resistance to variety of dr�gs�� incl�ding vinca alkaloids�� anthracyclines�� epipodophyllotoxins�� taxols�� actinomycin D�� cardiac glycosides�� imm�nos�ppressive agents�� gl�­ cocorticoids�� anti­HIV protease inhibitors [�].. All the s�bstrates of P­gp are large hydrophobic and amphipathic molec�les�� altho�gh they have no str�c­ t�ral similarity. These molec�les are able to intercalate into the membrane and enter the cytosol by passive diff�sion. It is no longer believed that P­gp is a classi­ cal p�mp�� which binds s�bstrates from the extracell�lar fl�id and then transports these over the membrane. Hydrophobic compo�nds that are s�bstrates for P­gp do not f�lly penetrate into the cytoplasm of cells that express P­gp. Interaction of s�bstrate with P­gp has been shown to take place within the membrane. Since a wide spectr�m of dr�gs is affected by MDR1 gene�� it is an attractive candidate to st�dy the phenome­ non of dr�g resistance [4]. MDR1 gene overexpression in hematological malignancies �ac�te myelogeno�s le�kemia�� m�ltiple myeloma�� malignant lymphomas�� at the time of diagnosis points on its clinical importance as prognostic factor [��� 7]. In vitro research provides signifi­ cant opport�nities to st�dy the mechanisms of m�ltidr�g resistance. Resistant cell lines co�ld be established by grad�al increase of concentration of cytotoxic agent [�]. In present st�dy h�man ac�te myeloid le�kemia cell line resistant to vincristine �HL��/VCR�� was estab­ lished by grad�al �from passage to passage�� increase of VCR concentration�� and then cross­resistance to Ara­C in established resistant line was detected. Chemicals. RPMI ��4��� fetal calf ser�m�� penicil­ lin�� streptomycin ��� mg/ml���� L­gl�tamine and trypan bl�e sol�tions were obtained from Biological Ind�stries �Israel��. Trizol reagent was obtained from Life Technolo­ gies �Israel��. Moloney M�rine Le�kemia Reverse­Trans­ criptase�� Taq DNA polymerase�� RNAse inhibitor�� and DNA size marker ��������� bp�� were obtained from Fermentas �USA��. The set of deoxyn�cleotide �dNTP���� isopropanol�� agarose and MTT were from Sigma �USA��. PBS was obtained from Oxoid �England��. Diethylepyro­ carbonate �DEP­C�� was obtained from Applichem �Ger­ many��. Formaldehyde ��7%�� was obtained from Merck �Germany��. PCR primers and Oligo­dT were obtained from Integrated DNA Technologies �USA��. Chloroform CROSS-RESISTANCE TO CYTOSINE ARABINOSIDE IN HUMAN ACUTE MYELOID LEUKEMIA CELLS SELECTED FOR RESISTANCE TO VINCRISTINE Y. ����������1, *, U. Gu�duz1, �.U. U����.U. U���2, 3 1Department of Biological Sciences, Middle East Technical University, Ankara, Turkey 2Department of Hematology, Gulhane Military Medical Academy, Ankara, Turkey 3Medical Research Center, Gulhane Military Medical Academy, Ankara, Turkey �im: The goals of the study were to reveal the involvement of P-glycoprotein (P-gp), the product of multidrug resistance 1 gene (MDR1) in cellular resistance to vincristine (VCR) and investigate cross-resistance against cytosine arabinoside (Ara-C) in HL60 and HL60/VCR cell lines. Methods: HL60 cells (human acute myeloid leukemia cell line) were cultured on medium with 1–50 nM of VCR for 4–6 weeks, and VCR resistant cells (HL60/VCR) were selected. The viability of cells was assessed by MTT assay and the expression of MDR1 gene was detected by RT-PCR. Resu�ts: No expression of MDR1 gene was revealed in HL60 cells, but MDR1 started to be expressed after incubation of cells with 2 nM of VCR and its expression level elevates with increase of agent concentration. MTT test has shown that HL-60/VCR cells were 75-fold more resistant to VCR and 42-fold higher resistant to cytosine arabinoside (Ara-C) compared to sensitive HL60 cells. Co�c�usio�: Aquired resistance to VCR and cross-resistance to Ara-C correlates with MDR1 gene expression i� vit�o. Key Wo�ds: multidrug resistance, P-glycoprotein, HL60, vincristine, cytosine arabinoside. Received: April 5, 2006. *Correspondence: Fax: +90-312-210-7976 E-mail: ybaran@metu.edu.tr Abbreviations used: ABC — ATP binding cassette; AML — acute myeloid leukemia; Ara-C — cytosine arabinoside; DEP-C – diethyle- pyrocarbonate; HL60/VCR – vincristine-resistant HL60 cells; (IC)50 — concentration of agent that inhibits cell growth by 50%; MDR1 – gene 1 of multidrug resistance; MTT — 3-(4, 5-dimethylthiazol-2-yl)- 2-5-diphenyltetrazolium bromide; P-gp — P-glycoprotein; RT-PCR — reverse transcriptase-polymerase chain reaction; VCR — vincristinе. Exp Oncol ���� ���� ��� ������� ��4 Experimental Oncology ���� ��������� ���� ���ne�� was obtained from Lab Scan Analytical Sciences �Ire­ land��. VCR and Ara­C were kindly provided by G�lhane Military Medical School �Ankara�� T�rkey��. Cell culture. H�man ac�te myeloid le�kemia HL�� cells were kindly provided by G�lhane Military Medical School �T�rkey��. HL�� cells were maintained in RPMI ��4� growth medi�m�� containing ��% fetal calf ser�m �FCS�� and �% penicillin­streptomycin sol�tion�� at �7 oC in �% CO�. Generation of resistant sublines. HL�� cells were exposed to grad�ally increasing concentration of VCR�� starting from � nM and �p to �� nM�� and resistant cells were selected�� passaged and exposed to higher concentration of VCR. In this way�� s�bpop�lations of cells with different degree of VCR resistance were generated. The level of resistance was defined by the VCR concentration at which the growth rate of cells was comparable to �ntreated parental cells. Measurement of cell growth by 3-(4, 5-Dimethyl- thiazol-2-yl)-2-5 diphenyltetrazolium-bromide (MTT) assay. The concentrations of VCR and Ara­C�� which in­ hibited cell growth by ��% �IC���� were eval�ated �sing MTT­assay [9]. HL�� cells �� × ��4 cells/well�� were plated into 9�­well plates�� containing ��� µl of c�lt�re medi�m in the absence or presence of different concentrations of VCR and Ara­C at �7 oC in �% CO� for 4� h. Then they were treated with � µl of MTT �� mg/ml�� for 4 h. The s�perna­ tants in the wells were discarded and dark bl�e crystals were dissolved with the addition of acidified isopropanol ��.�4 N HCl in isopropanol��. Plates were examined with microplate reader at �7� nm�� and IC�� concentrations of compo�nd were determined from cell s�rvival plots [9].[9]. For each concentration of dr�g�� � wells were co�nted. RNA isolation. Total RNA was isolated from � x ��� HL�� and HL��/VCR cells�� �sing Trizol reagent �with g�anidi�m thiocyanate�� phenol and sodi�m citrate�� �Life Technolo­ gies�� Israel��. Q�antification of RNA was performed�� �sing UV spectrophotometer the wave length of ��� nm. Reverse transcription-polymerase chain reac-polymerase chain reac- tion (RT-PCR). RT­PCR was carried o�t for �� min at 4� °C in a total vol�me of �� µl�� containing �� �nits of ribon�clease inhibitor�� �.� µg oligo­dT�� �.� mM of each dNTP�� ��� �nits of reverse transcriptase�� and � µg of total cell�lar RNA. When mRNA template was created�� PCR analysis was performed. For eval�ation of MDR1 gene expression�� forward primer ��´TACAGTGGAATTGGTGCTGGG�´�� and re­ verse primer ��´TACAGTGGAATTGGTGCTGGG�´�� were �sed. The reaction mix with two primers was amplified d�ring �� cycles �94 °C�� �� s; �� °C�� 4� s; 7� °C�� � min���� �sing Taq DNA polymerase. The mRNA of β�­microglob�lin was �sed as internal positive control. For eval�ation of β�­microglob�lin gene expression�� forward primer ��´CTTACTGAAGAATG­ GAGAGAGA�´�� and reverse primer ��´CTTACATGTCTC­ TATCCCACTT�´�� were �sed [��]. The reaction mix was am­ plified d�ring �� cycles �94 °C�� �� s; �� °C�� 4� s; 7� °C�� � min���� �sing Taq DNA polymerase. MDR� and β�­microglob�lin band intensities were meas�red densitometrically. Expression of MDR1. The intactness of total RNA was confirmed by two sharp bands of ��S rRNA and ��S rRNA�� separated in denat�ring agarose gels and vis�alized by ethidi�m bromide �EtBr�� staining �nder UV light. The target MDR1 gene and the reference β�­microglob�lin gene were amplified by PCR. PCR prod�ct of MDR1 gene responds to ��� bp fragment�� while the prod�cts of β�­microglob�lin gene to ��� bp fragment. The level of target gene expression is reflected in the ratio between intensities of two res�lting PCR prod�ct bands on gel. In this st�dy�� we tried to determine the differences in ex­ pression levels of MDR1 gene in HL�� and HL��/VCR cells. β�­microglob�lin was �sed as an internal control since its expression does not change �pon expos�re to VCR [��]. Increase of VCR concentrations res�lted in increased expression of MDR1 gene �Fig. ���. Fig. � shows that there was no expression of MDR1 gene in control cells and HL�� cells�� treated with � nM of VCR. However�� HL�� cells expressed MDR1 gene at the doses of VCR > � nM �see Fig. ���. The res�lts strongly s�ggest that HL�� cells can s�rvive at higher concentrations of VCR and this resistance can be explained by overexpression of MDR1 gene. Fig. 1. RT­PCR analysis of expression of MDR1 gene in parental �Lane ��� and VCR­resistant HL�� cells �lanes ��� 4 — � nM and �� nM VCR�� respectively��. Lane � — DNA ladder; lanes ��7 — beta microglob�lin levels were �sed as internal positive control Several dr�g resistance mechanisms�� in partic�lar with the involvement of P­gp�� were identified [��� ���� ��]. Cell cytotoxicity assay. For each dr�g�� IC�� val�es were determined by MTT assay �Fig. ��� ���. For VCR�� IC�� val�es for parental and VCR­resistant HL�� cells were 4 nM and ��� nM respectively �see Fig. ����� whilst for Ara­C — ����� nM and � nM respectively �see Fig. ���. The res�lts indicated that the cells�� selected by VCR resistance�� also were resistant to Ara­C. HL­��/VCR cells�� which were more then 7�­fold resistant to VCR�� also showed 4�­fold increased resistance to Ara­C. These data are in agreement with the res�lts of other a�thors [�����]. For example�� KF­�9 cell line resistant to adriamycin and VCR�� showed cross­resistance to Ara­C [�4]. In another st�dy it was shown that P��� cell line resistant to VCR also pos­ sessed cross­resistance to Ara­C [��]. Therape�tic strategies aiming to overcome MDR1 gene overexpression may be �sef�l in enhance­ ment cytotoxic effects of VCR. In this setting�� resistance to VCR can be reversed�� at least in vitro�� by variety of resistance modifying agents called MDR reversal mod�­ lators or chemosensitizers [��]. MDR mod�lators often reverse m�ltidr�g resistance by competing for the trans­ port system responsible for MDR. Apart from reversal mod�lators�� the antisense oligomers targeted MDR� mRNA may also res�lt in decrease and even loss of re­ sistance�� as there will be no P­gp synthesis. In concl�sion�� we have shown that HL­�� cells�� adapted to higher concentrations of VCR�� express MDR1 gene at higher levels�� and also aq�ire cross­ resistance to Ara­C. Experimental Oncology ���� ��������� ���� ���ne�� ������� ��������� ���� ���ne�� �����ne�� ����� ��� ��� Fig. 2. Effect of VCR on viability of HL�� �triangles�� and HL��/ VCR �circles�� cells. IC�� concentration of VCR was determined by MTT assay for each cell line in at least � independent experi­ ments�� in triplicate per point Fig. 3. Effect of Ara­C on viability of HL�� �triangles�� and HL��/VCR �circles�� cells. The IC�� concentration of Ara­C IC�� concentration was determined by MTT assay for each cell line in at least � independent experiments�� in triplicate per point ACKNOwLEDgEMENT This st�dy was s�pported by Middle East Technical University f�nd AFP­����­�7­��­��­�� grant and theAFP­����­�7­��­��­�� grant and thegrant and the project by Prime Ministry�� State Planning Organiza­ tion f�nd DPT­�7­��­K����4�­�4 grant. We wo�ldDPT­�7­��­K����4�­�4 grant. We wo�ld grant. We wo�ld like thanks to Bahar BARAN for her help in calc�lating statistical analyses and preparing graphics. REFERENCES 1. Borst P, Evers R, Kool M, Wijnholds J. A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst 2000; 92: 1295–302. 2. Chen CJ, Chin JE, Ueda K, Clark DP, Pastan I, Got- tesman MM, Roninson IB. Internal duplication and homolo- gy with bacterial transport proteins in the MDR1 gene from multidrug resistant human cells. Cell 1986; 47: 381–9. 3. Christina L, Linn H, Malin B, Kourosh L, Christer P, Staffan E. Mechanisms of cross-resistance between nucleoside analogues and vincristine or daunorubicin in leukemic cells. Biochem Biophys Res Com 2004; 320: 825–32. 4. Choudhury RC, Das B, Misra S, Jagdale MB. Cytogenetic toxicity of vincristine. J Environ Pathol Toxicol Oncol 2000; 19: 347–55. 5. Dean M, Hamon Y, Chimini G. The human ATP-bind- ing cassette (ABC) transporter superfamily. J Lipid Res 2001; 42: 1007–17. 6. Flahaut M, Muhlethaler-Mottet A, Martinet D, Fattet S, Bourloud KB, Auderset K, Meier R, Schmutz NB, Delattre O, Jo- seph JM, Gross N. Molecular cytogenetic characterization of doxo- rubicin-resistant neuroblastoma cell lines: evidence that acquired multidrug resistance results from a unique large amplification of the 7q21 region. Genes Chrom Cancer 2006; 45: 495–508. 7. Fukuda T, Kamishima T, Kakihara T, Ohnishi Y, Suzuki T. Characterization of newly established human myeloid leuke- mia cell line (KF-19) and its drug resistant cell lines. Leukemia Res 1996; 20: 931–9. 8. Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2002; 2: 48–58. 9. Hirose M, Kuroda Y. P53 may mediate the MDR1 ex- pression via the WT1 gene in human Vincristine-resistant leu- kemia/lymphoma cell lines. Cancer Lett 1998;Cancer Lett 1998; 29: 165–71. 10. Hirose M. Biology and modulation of multidrug resis- tance (MDR) in hematological malignancies. Int J Hematol 2002; 76: 206–11. 11. Litman T, Druley TE, Stein WD, Bates SE. From MDR to MXR: new understanding of multidrug resistance systems, their properties and clinical significance. Cell Mol Life Sci 2001; 58: 931–59. 12. Lopes EC, Scolnik M, Alvarez E, Silvia SE. Modula-Modula- tor activity of PSC 833 and cyclosporine-A in vincristine and doxorubicin-selected multidrug resistant murine leukemic cells. Leukemia Res 2001; 25: 85–93. 13. Martin-Aragon S, Mukherjee SK, Taylor BJ, Ivy SP, Fu CH, Ardi VC, Avramis VI. Cytosine arabinoside (Ara-C) resis- tance confers cross-resistance or collateral sensitivity to other classes of anti-leukemic drugs. Anticancer Res 2000; 20: 139–50. 14. Sonneveld O. Multidrug resistance in haematological malignancies. J Intern Med 2000; 247: 521–34. 15. Sparreboom A, Nooter K. Does P-glycoprotein play a role in anticancer drug pharmacokinetics? Drug Resist 2000; 3: 357–63. 16. Stavrovskaya AA. Multidrug resistance caused by the activity of cellular transporters: some new data and future prospectives. Biol Membr 2003; 20: 196–205. Copyright © Experimental Oncology, 2006 ПЕРЕКРЕСТНАЯ УСТОЙЧИВОСТЬ К ЦИТОЗИНАРАБИНОЗИДУ КЛЕТОК ЛИНИИ HL60, УСТОЙЧИВЫХ К ВИНКРИСТИНУ Целью работы было исследование участия Р-гликопротеина (Р-gp), продукта гена-1 множественной лекарственной устойчивости (MDR1) в устойчивости клеток лейкемии человека к винкристину (��Р) и перекрестной ре�истентности к �ито�инарабино�идуMDR1) в устойчивости клеток лейкемии человека к винкристину (��Р) и перекрестной ре�истентности к �ито�инарабино�иду1) в устойчивости клеток лейкемии человека к винкристину (��Р) и перекрестной ре�истентности к �ито�инарабино�иду (Аrа-C). Методы: клетки острой миелоидной лейкемии линии HL60 кул�тивировали в среде с 1–50 нM ��Р в течение 4–6 нед,HL60 кул�тивировали в среде с 1–50 нM ��Р в течение 4–6 нед,60 кул�тивировали в среде с 1–50 нM ��Р в течение 4–6 нед,M ��Р в течение 4–6 нед, ��Р в течение 4–6 нед, после чего были отселектированы ��Р-ре�истентные клетки (HL60/��Р). �лияние препаратов на жи�неспособност� клетокHL60/��Р). �лияние препаратов на жи�неспособност� клеток60/��Р). �лияние препаратов на жи�неспособност� клеток и�учали при помощи МТТ-метода, экспресию гена MDR11 — методом полимера�ной �епной реак�ии обратной транскрип�ии. Результаты: в клетках линии HL60экспрессиягенаHL60экспрессиягена60 экспрессия гена MDR11 не была выявлена, но была �арегистрирована после инкуба�ии клеток с 2 нM ��Р, причем ее уровен� во�растал по мере повы�ения кон�ентра�ии ��Р в среде инкуба�ии. �ока�ано, что устойчи-M ��Р, причем ее уровен� во�растал по мере повы�ения кон�ентра�ии ��Р в среде инкуба�ии. �ока�ано, что устойчи- ��Р, причем ее уровен� во�растал по мере повы�ения кон�ентра�ии ��Р в среде инкуба�ии. �ока�ано, что устойчи- вост� клеток линии HL-60/��Р к ��Р и Аrа-C в 75 и в 42 ра�а вы�е, соотвественно, чем таковая клеток линии HL60.HL-60/��Р к ��Р и Аrа-C в 75 и в 42 ра�а вы�е, соотвественно, чем таковая клеток линии HL60.-60/��Р к ��Р и Аrа-C в 75 и в 42 ра�а вы�е, соотвественно, чем таковая клеток линии HL60.HL60.60. Выводы: приобретенная устойчивост� к ��Р и перекрестная устойчивост� к Аrа-C коррелирует с уровнем экспрессии гена MDR11. Ключевые слова: множественная устойчивост� к препаратам, P-гликопротеин, HL60, винкристин, �ито�инарабино�ид.P-гликопротеин, HL60, винкристин, �ито�инарабино�ид.-гликопротеин, HL60, винкристин, �ито�инарабино�ид.HL60, винкристин, �ито�инарабино�ид.60, винкристин, �ито�инарабино�ид.