Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells
Aim: Clusterin and IAPs (inhibitor of apoptosis proteins), such as survivin and XIAP, are known to be related to chemo-resistance in several cancer cells. In the current study, we investigated their expression levels in human prostate cancer cell lines, LNCaP and PC-3 which are sensitive and resista...
Збережено в:
| Дата: | 2006 |
|---|---|
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2006
|
| Назва видання: | Experimental Oncology |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/137572 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells / K. Mizutani, K. Matsumoto, N. Hasegawa, T. Deguchi, Y. Nozawa // Experimental Oncology. — 2006. — Т. 28, № 3. — С. 209-215. — Бібліогр.: 26 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-137572 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1375722018-06-18T03:05:39Z Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells Mizutani, K. Matsumoto, K. Hasegawa, N. Deguchi, T. Nozawa, Y. Original contributions Aim: Clusterin and IAPs (inhibitor of apoptosis proteins), such as survivin and XIAP, are known to be related to chemo-resistance in several cancer cells. In the current study, we investigated their expression levels in human prostate cancer cell lines, LNCaP and PC-3 which are sensitive and resistant to camptothecin (CPT), topoisomerase I inhibitor, respectively. Methods: LNCaP and PC-3 cells were cultured in the presence of CPT, cell death was evaluated using Hoechst 33342 and propidium iodide (PI) double staining. The expression of clusterin, XIAP and survivin on mRNA and protein levels was investigated by semi-quantitative RT-PCR and Western blotting, respectively. Results: Our data showed that 24 h treatment of LNCaP cells with 0.5 and 3.0 µM CPT resulted in higher number of apoptotic cells, than that in PC-3 cells. Western blot analysis revealed that the clusterin level in PC-3 cells was 5-fold higher than that in LNCaP cells. In contrast, XIAP expression level in PC-3 cells was lower than that in LNCaP cells, and survivin levels were similar in these two cell lines. Treatment with 0.5 and 3.0 µM CPT resulted in the reduced survivin and XIAP expression in both cell lines, while clusterin expression remained unchanged in LNCaP cells, but was increased in PC-3 cells. Conclusion: The results suggest that clusterin may take a greater part in CPT-resistance than survivin and XIAP in PC-3 cells. Цель: известно, что кластерин и белки-ингибиторы апоптоза семейства IAP, такие как сурвивин и XIAP, связаны с химиорезистентностью опухолевых клеток. Задача исследования — определить уровни экспрессии указанных белков в линиях опухолевых клеток предстательной железы, чувствительных (LNCaP) и устойчивых (PC-3) к действию камптотецина (CPT) — ингибитора топоизомеразы I. Методы: клетки LNCaP и PC-3 инкубировали с CPT, после чего анализировали количество погибших клеток с использованием двойного окрашивания реактивом Херста 33 342 и пропидиумиодидом. Экспрессию кластерина, XIAP и сурвивина на уровне белка и мРНК оценивали методами Вестерн-блоттинга и полуколичественного РТ-ПЦР соответственно. Результаты: установлено, что вследствие 24-часовой инкубации клеток с 0,5 и 3,0 µM CPT определяют более значительный процент гибели клеток линии LNCaP, чем таковых PC-3. Данные Вестерн блот анализа выявили, что в клетках линии PC-3 количество кластерина в 5 раз больше, а XIAP — меньше, чем в клетках линии LNCaP, в то время как экспрессия сурвивина одинакова в обеих клеточных линиях. Инкубация клеток с 0,5 и 3,0 µM CPT приводила к снижению уровня сурвивина и XIAP в обеих линиях. Экспрессия кластерина на уровне мРНК и белка не изменялась при действии CPT на клетки линии LNCaP, однако повышалась в клетках линии PC-3. Выводы: полученные данные свидетельствуют о том, что в развитии резистентности к камптотецину клеток линии PC-3 кластерин может играть более важную роль, чем сурвивин и XIAP. 2006 Article Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells / K. Mizutani, K. Matsumoto, N. Hasegawa, T. Deguchi, Y. Nozawa // Experimental Oncology. — 2006. — Т. 28, № 3. — С. 209-215. — Бібліогр.: 26 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/137572 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Original contributions Original contributions |
| spellingShingle |
Original contributions Original contributions Mizutani, K. Matsumoto, K. Hasegawa, N. Deguchi, T. Nozawa, Y. Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells Experimental Oncology |
| description |
Aim: Clusterin and IAPs (inhibitor of apoptosis proteins), such as survivin and XIAP, are known to be related to chemo-resistance in several cancer cells. In the current study, we investigated their expression levels in human prostate cancer cell lines, LNCaP and PC-3 which are sensitive and resistant to camptothecin (CPT), topoisomerase I inhibitor, respectively. Methods: LNCaP and PC-3 cells were cultured in the presence of CPT, cell death was evaluated using Hoechst 33342 and propidium iodide (PI) double staining. The expression of clusterin, XIAP and survivin on mRNA and protein levels was investigated by semi-quantitative RT-PCR and Western blotting, respectively. Results: Our data showed that 24 h treatment of LNCaP cells with 0.5 and 3.0 µM CPT resulted in higher number of apoptotic cells, than that in PC-3 cells. Western blot analysis revealed that the clusterin level in PC-3 cells was 5-fold higher than that in LNCaP cells. In contrast, XIAP expression level in PC-3 cells was lower than that in LNCaP cells, and survivin levels were similar in these two cell lines. Treatment with 0.5 and 3.0 µM CPT resulted in the reduced survivin and XIAP expression in both cell lines, while clusterin expression remained unchanged in LNCaP cells, but was increased in PC-3 cells. Conclusion: The results suggest that clusterin may take a greater part in CPT-resistance than survivin and XIAP in PC-3 cells. |
| format |
Article |
| author |
Mizutani, K. Matsumoto, K. Hasegawa, N. Deguchi, T. Nozawa, Y. |
| author_facet |
Mizutani, K. Matsumoto, K. Hasegawa, N. Deguchi, T. Nozawa, Y. |
| author_sort |
Mizutani, K. |
| title |
Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells |
| title_short |
Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells |
| title_full |
Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells |
| title_fullStr |
Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells |
| title_full_unstemmed |
Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells |
| title_sort |
expression of clusterin, xiap and survivin, and their changes by camptothecin (cpt) treatment in cpt resistant pc-3 and cpt-sensitive lncap cells |
| publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| publishDate |
2006 |
| topic_facet |
Original contributions |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/137572 |
| citation_txt |
Expression of clusterin, XIAP and survivin, and their changes by camptothecin (CPT) treatment in CPT resistant PC-3 and CPT-sensitive LNCaP cells / K. Mizutani, K. Matsumoto,
N. Hasegawa, T. Deguchi, Y. Nozawa // Experimental Oncology. — 2006. — Т. 28, № 3. — С. 209-215. — Бібліогр.: 26 назв. — англ. |
| series |
Experimental Oncology |
| work_keys_str_mv |
AT mizutanik expressionofclusterinxiapandsurvivinandtheirchangesbycamptothecincpttreatmentincptresistantpc3andcptsensitivelncapcells AT matsumotok expressionofclusterinxiapandsurvivinandtheirchangesbycamptothecincpttreatmentincptresistantpc3andcptsensitivelncapcells AT hasegawan expressionofclusterinxiapandsurvivinandtheirchangesbycamptothecincpttreatmentincptresistantpc3andcptsensitivelncapcells AT deguchit expressionofclusterinxiapandsurvivinandtheirchangesbycamptothecincpttreatmentincptresistantpc3andcptsensitivelncapcells AT nozaway expressionofclusterinxiapandsurvivinandtheirchangesbycamptothecincpttreatmentincptresistantpc3andcptsensitivelncapcells |
| first_indexed |
2025-07-10T02:36:27Z |
| last_indexed |
2025-07-10T02:36:27Z |
| _version_ |
1837225729728708608 |
| fulltext |
Experimental Oncology 28, 209–215, 2006 (September) 209
Prostate cancer is the most commonly diagnosed
malignancy in male. Although early prostate cancer
is eminently treatable due to hormone dependency,
androgen withdrawal results in incurability of its ad-
vanced stage because of the inevitable emergence
of androgen-independent cells within few years [1].
Thus hormone-refractory prostate cancer has long
been recognized as a chemo-resistance disease,
and there is a great need novel therapeutic strategies
that target the molecular basis of hormone refractory
chemo-resistance of prostate cancer. Recently, it was
reported that clusterin and inhibitors of apoptosis
proteins (IAPs) are related to chemo-resistance in
some cancer cells including prostate cancer [2–6].
Furthermore, the targeted downregulation of XIAP or
survivin genes have been shown to directly sensitize
cancer cells to apoptosis induced by various conven-
tional chemotherapeutic drugs [7, 8]. Clusterin (also
known as ApoJ, TRPM-2, and SGP-2) is a secretory
glycoprotein known as an anti-apoptotic protein [9–
14]. Survivin and XIAP belong to a family of IAPs that
have been shown to prevent chemotherapy-induced
apoptosis by inhibiting caspase [15, 16].
Camptothecin (CPT) specifically targets topoisome-
rase I (Top1), which is required for maintenance of
double helical structure of DNA [17]. Studies by Wang et
al. and our data [18, 19] demonstrated that CPT induces
growth inhibition and apoptosis in a time- and dose-de-
pendent manner in androgen-sensitive prostate cancer
cells (LNCaP), but not in androgen–resistant PC-3 cells.
However, the precise mechanism underling the different
sensitivity to CPT between these cell types remains to
be explored. As an approach to gain some insight into
the CPT-resistance, we have examined the expression
levels of clusterin, survivin and XIAP and the changes in
during CPT treatment in LNCaP and PC-3 cells.
Materials and Methods
Cell culture. LNCaP and PC-3 human prostate can-
cer cells were cultured in RPMI 1640 (Nikken Bio Medical
Laboratory, Kyoto, Japan) supplemented with 10% fetal
bovine serum (Sigma, USA) under a humidified atmo-
sphere of 5% CO2 and 95% air at 37 °C. (S)-(+)-camp-
tothecin (CPT) (Sigma, USA) dissolved in DMSO was
added to the cell cultures with final DMSO concentration
less than 0.03% v/v, which had no significant effect on
the growth and differentiation of LNCaP and PC-3 cells.
0.03% DMSO treatment was used as control.
Cell death assay. To identify apoptotic or necrotic cell
death, double staining with Hoechst 33342 and propidium
iodide (PI) was performed. Cells were stained with 5 µg/ml
Hoechst 33342 (Calbiochem, San Diego, CA, USA) and
2 µg/ml PI (Invitrogen, Carlsbad, CA, USA) for 20 min. After
washing with phosphate-buffered saline (PBS), cells were
observed under a fluorescence microscope, Olympus
BX-51 (Olympus, Tokyo, Japan). To evaluate the type of
cell death, over 500 cells were analyzed.
Western blotting. Antibodies used were rabbit
polyclonal anti-survivin (Santa Cruz Biotechnology, Santa
Cruz, CA, USA), rabbit polyclonal anti-clusterin γ chain
(Upstate, Charlottesville, VA, USA), rabbit polyclonal anti-
XIAP (Cell Signaling Technology, Beverly MA, USA) and
mouse monoclonal anti-β-tubulin (Sigma). Cells washed
expression of clusterin, xiap and survivin,
and their changes by caMptothecin (cpt) treatMent
in cpt‑resistant pc‑3 and cpt‑sensitive lncap cells
K. Mizutani1, *, K. Matsumoto2, N. Hasegawa2, T. Deguchi1, Y. Nozawa2
1Department of Urology, Gifu University Graduate school of Medicine, 1-1 Yanagido,
Gifu, Gifu 501-1194, Japan
2Gifu International Institute of Biotechnology, 1-1 Naka-Fudogaoka, Kakamigahara, Gifu 504-0838, Japan
Aim: Clusterin and IAPs (inhibitor of apoptosis proteins), such as survivin and XIAP, are known to be related to chemo-resistance in
several cancer cells. In the current study, we investigated their expression levels in human prostate cancer cell lines, LNCaP and PC-3
which are sensitive and resistant to camptothecin (CPT), topoisomerase I inhibitor, respectively. Methods: LNCaP and PC-3 cells
were cultured in the presence of CPT, cell death was evaluated using Hoechst 33342 and propidium iodide (PI) double staining. The
expression of clusterin, XIAP and survivin on mRNA and protein levels was investigated by semi-quantitative RT-PCR and Western
blotting, respectively. Results: Our data showed that 24 h treatment of LNCaP cells with 0.5 and 3.0 µM CPT resulted in higher
number of apoptotic cells, than that in PC-3 cells. Western blot analysis revealed that the clusterin level in PC-3 cells was 5-fold
higher than that in LNCaP cells. In contrast, XIAP expression level in PC-3 cells was lower than that in LNCaP cells, and survivin
levels were similar in these two cell lines. Treatment with 0.5 and 3.0 µM CPT resulted in the reduced survivin and XIAP expression
in both cell lines, while clusterin expression remained unchanged in LNCaP cells, but was increased in PC-3 cells. Conclusion: The
results suggest that clusterin may take a greater part in CPT-resistance than survivin and XIAP in PC-3 cells.
Key Words: LNCaP, PC-3, clusterin, XIAP, survivin, camptothecin.
Received: July 28, 2006.
*Correspondence: Fax +81 582-306338
E-mail: kosukemz@cc.gifu-u.ac.jp
Abbreviations used: ApoJ — apolipoprotein J; CPT — campto-
thecin; IAPs — inhibitors of apoptosis proteins; PI — propidium
iodide; TopI — topoisomerase I; TRPM-2 — testosterone-repressed
prostate message 2.
Exp Oncol 2006
28, 3, 209–215
210 Experimental Oncology 28, 209–215, 2006 (September)
with PBS were resuspended in RIPA buffer (10 mM Tris-
HCl pH7.4, 1% NP-40, 0.1% sodium deoxycholate,
0.1 SDS, 150 mM NaCl, 1 mM EDTA) containing the
protease inhibitor cocktail (Sigma, USA), and stored
on ice for 30 min. After centrifugation at 13,000 rpm for
30 min at 4 ˚C, the resultant supernatant was used as
protein sample. Each protein content was measured
with a DC protein assay kit (BIORAD, USA). 30 µg of
each protein sample was subjected to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and transferred to PVDF membrane. The membrane was
blocked with 5% non-fat dry milk in 0.1 M Tris buffered
saline containing 0.1% Tween-20 for 30 min, and incu-
bated overnight with primary antibodies at 4 ̊ C. The im-
munocomplex was detected with horseradish peroxidase
conjugated anti-mouse or anti-rabbit IgG (Amersham
Biosciences, USA) using an ECL system (Amersham
Biosciences).
Semi-quantitative RT-PCR. Total RNA was isola-
ted from LNCaP cells and PC-3 cells using a Quick Prep
Total RNA Extraction Kit (Amersham Biosciences) ac-
cording to manufacturer’s instruction. 2 µg of total RNA
of each sample were reverse transcribed by using Super
Script II RNase H-reverse transcriptase and oligo(dT)
primer (Invitrogen). Primers and reaction conditions for
each gene are summarized in Table 1. The housekeep-
ing transcript, elongation factor-1α (EF-1α), was used
as a control for standardization [20]. Each PCR product
was separated by electrophoresis on 2 % (w/v) agarose
gel, and then visualized by ethidium bromide staining.
To measure the density of each band, we use computer-
imaging analysis (BIO-1D Vilber Lourmat, France).
results
CPT sensitivity in LNCaP and PC-3 cells. We exami-
ned CPT sensitivity in LNCaP cells and PC-3 cells using
Hoechst 33,342 and PI double staining (Fig. 1). At 0.5
µM of CPT, nuclear fragmentation and PI positive staining
were observed in LNCaP cells, but not in PC-3 cells. When
LNCaP cells were treated with 0.5 µM and 3.0 µM of CPT
for 24 h, PI positive cells (necrotic or late apoptotic) and
PI negative cells with nuclear fragmentation (apoptotic)
were observed. At 0.5 µM CPT, less than 10% of cell death
was mainly due to necrosis/late apoptosis, whereas at
3.0 µM cell death was enhanced up to over 20% of total
cells (~70% necrotic/late apoptotic and ~30% apoptotic)
(Fig. 1, B). In contrast, in PC-3 cells the effect of CPT treat-
ment on cell death was much less pronounced.
Expression of clusterin, XIAP and survivin in
prostate cancer cells. To investigate the mechanism
underlying the different susceptibility of LNCaP cells and
PC-3 cells to CPT, we examined expression levels of the
Table. PCR Primers and Conditions
Gene 5’ primer 3’ primer Annealing Temperature (°C) Cycle
Clusterin AATACAACGAGCTGCTAAAGTCCT AATTTAGGGTTCTTCCTGGAGACT 62 25
Survivin AGAGGAACATAAAAAGCATTCGTC ACAGGAGCACAGTTGAAACATCTA 62 27
XIAP GCAGATCTAGTGAATGCTCAGAAA TACTTGGTAGCAAATGCTAATGGA 62 29
EF-1α CTCAGGTGATTATCCTGAACCATC AACAGTTCTGAGACCGTTCTTCCA 60 22
fig. 1. CPT-induced cell death in prostate cancer cell lines. (a) Morphological examination of CPT-induced cell death in LNCaP and
PC-3 cells. Cell death was examined by the Hoechst 33342 and PI double staining. After 24 h incubation with 0.5 µM and 3.0 µM
CPT, cells were stained and examined by fluorescence microscopy. (b) Time course of cell death in LNCaP and PC-3 cells. Both
cells were exposed to 0.5 µM and 3.0 µM CPT for different time intervals (6, 24 h). After Hoechst 33,342 and PI double staining,
over 500 cells were analyzed in each experiment
Experimental Oncology 28, 209–215, 2006 (September) 211
proteins that exert the anti-apoptotic action by Western
blotting. α-clusterin with 60 kDa has been known as anti-
apoptotic protein in normal state [21]. Its expression in
LNCaP cells was marginal while it is much higher in PC-3
cells (Fig. 2, a). The XIAP expression level was slightly
higher in LNCaP cells compared to PC-3 cells (Fig. 2, b).
As for survivin, there was no significant difference in both
cell lines.
Changes in expression levels of clusterin, XIAP
and surviving by CPT treatment. We examined CPT-
induced changes of clusterin and its mRNA by Western
blotting and semi-quantitative RT-PCR. Interestingly,
fig. 2. Clusterin and IAPs expression levels in LNCaP and PC-3 cells analyzed by Western blotting with polyclonal antibodies to
human clusterin (a), XIAP (b) and survivin (c). Values represent means ± SD (bars) from three independent experiments. The blots
are representative of three separate experiments
fig. 3. Expression of clusterin in LNCaP and PC-3 cells upon CPT treatment. (a) Time course of the protein expression of clusterin
analysed by Western blotting with the specific antibody for human clusterin. Fold changes were determined from relative intensity
compared to the control. Values represent means ± SD (bars) from three independent experiments. The blots represent one of three
separate experiments with similar results. (b) Time course of expression of clusterin mRNA. Fold changes were determined from
relative intensity to the control. Values represent means ± SD (bars) from three independent experiments
212 Experimental Oncology 28, 209–215, 2006 (September)
clusterin protein expression appeared to increase by CPT
treatment at 0.5 µM and 3.0 µM in PC-3 cells in a time-
dependent manner (Fig. 3, a). The temporal profile of its
mRNA expression was reflected in the protein expression
pattern (Fig. 3, b). However, clusterin expression in LN-
CaP cells did not change upon CPT treatment.
CPT-induced changes were also examined for pro-
tein and mRNA of XIAP. After treatment with 0.5 µM and
3.0 µM CPT, the content of XIAP protein were shown to
be decreased in both cell lines in a time-dependent
manner. The general patterns of the XIAP protein
changes in LNCaP and PC-3 cells were compatible
with those of mRNA changes (Fig. 4).
Further, we have examined survivin expression levels in
LNCaP cells and PC-3 cells exposed to 0.5 µM and 3.0 µM
CPT. CPT treatment resulted in reduced protein expression
level in both cell lines. It’s interesting to note that in LNCaP
cells there was a marked decrease in protein expression
level of survivin upon 24 h-incubation with 0.5 µM CPT,
while the treatment with 3.0 µM CPT caused only a small
decrease (Fig. 5). The profile of expression levels was
similar for proteins and respective mRNAs. In PC-3 cells,
there was a trend to decreased survivin expression during
treatment with either 0.5 µM or 3.0 µM CPT.
As it is shown here, the expression levels were dis-
cordant between proteins and mRNAs, suggesting the
transcriptional and/or post-transcriptional regulation
of protein expression.
discussion
Prostate cancer is the most common in men and
the major leading cause of cancer-related death in
males. Prostate cancer is characterized by the andro-
gen-dependent growth at the early stage and can be
effectively treated by hormone ablation [1]. However,
prostate cancer cells often become androgen-inde-
pendent and refractory to chemotherapy. Despite
abundant investigations, the molecular mechanism
underlying the resistance to chemotherapy-induced
apoptosis remains poorly understood. For in vitro
studies, androgen-sensitive LNCaP and androgen-
resistant PC-3 cell lines have been most commonly
used as a model system to search for biochemical or
molecular differences between these two cell lines [1,
22]. Wang et al. [18] have demonstrated that LNCaP
cells produced ceramide, a key apoptotic mediator,
by CPT treatment while PC-3 cells were defective
in the ceramide generation, and concluded that the
fig. 4. Expression of XIAP in LNCaP and PC-3 cells upon CPT-treatment. (a) Time course of the protein expression of XIAP analyzed
by Western blotting with the specific antibody for human XIAP. Fold changes were determined from relative intensity to the control.
Values represent means ± SD (bars) from three independent experiments. The blots represent one of three separate experiments
with similar results. (b) Time course of expression of XIAP mRNA analized by RT-PCR. Fold changes were determined from relative
intensity to the control. Values represent means ± SD (bars) from three independent experiments
Experimental Oncology 28, 209–215, 2006 (September) 213
loss of ceramide formation was responsible for the
anti-apoptotic response of PC-3 cells. Our study
using ceramide synthetase inhibitor suggested that
ceramide generated via its de novo synthesis may not
play a primary role in CPT-induced apoptotic cell death
in LNCaP cells [19]. Recently, studies by Pchejetski et
al. and our report [23, 24] have shown that expression
and activity of oncogenic sphingosine kinase 1 were
higher in PC-3 cells than in LNCaP cells and that the
enzyme expression level was enhanced by CPT-treat-
ment in PC-3 cells. On the other hand, we have previ-
ously performed the comparative proteomic analysis
to examine differential protein expression in PC-3
and LNCaP cells [25]. Several proteins preferentially
expressed in PC-3 cells were identified; they include
annexin A1, glutathione-S-transferase (GST) pi and
glucose-regulated protein (GRP) 78/Bip which are
thought to be involved in the anti-apoptotic response.
However, because of the low level expression, we were
unable to detect other anti-apoptotic proteins includ-
ing clusterin and inhibitor of apoptosis proteins (IAPs)
known as endogenous caspase inhibitors. Therefore,
in the current study, we have examined and compared
the expression profiles of clusterin, XIAP and survivin,
and their changes by CPT-treatment by Western blot-
ting and RT-PCR analysis.
Clusterin, also known as apolipoprotein J or tes-
tosterone-repressed prostate message 2 (TRPM-2),
is a cytosolic glycoprotein that has multiple functions
including regulation of apoptosis [21]. There is accu-
mulating evidence suggesting that clusterin is an anti-
apoptotic protein associated with chemoresistance.
In fact, recent study has shown that clusterin-over-
expressing cells are highly resistant to CPT- and eto-
poside-mediated apoptosis [26]. We have observed
a striking difference in clusterin protein expression
between LNCaP and PC-3 cells, as shown in Fig. 2, a;
abundant in PC-3 cells and marginal in LNCaP cells.
This predominant expression of clusterin may at least
in part account for resistance to CPT in PC-3 cells but
not in LNCaP cells. Moreover, it is of great interest
to note that the expression of clusterin protein was
enhanced in a time-dependent fashion within 24 h
following CPT-treatment in PC-3 cells. This enhanced
clusterin expression was considered to be regulated
at the transcriptional regulation.
The IAP proteins XIAP and survivin expression were
shown to be at the nearly same level, which is distinct
fig. 5. Expression of survivin in LNCaP and PC-3 cells upon CPT-treatment. (a) Time course of the protein expression of surviving
analyzed by Western blotting with the specific antibody for human survivin. Fold changes were determined from relative intensity to
the control. Values represent means ± SD (bars) from three independent experiments. The blots represent one of three separate
experiments with similar results. (b) Time course of survivin mRNA expression analyzed by RT-PCR. Fold changes were determined
from relative intensity to the control. Values represent means ± SD (bars) from three independent experiments
214 Experimental Oncology 28, 209–215, 2006 (September)
from clusterin. Furthermore, in sharp contrast to clus-
terin, CPT-induced up-regulation of XIAP and survivin
was not observed in PC-3 cells as well as LNCaP cells.
Instead, the content of both anti-apoptotic proteins
was reduced in a time-dependent fashion in both cell
lines. The down-regulated expression of these proteins
is favoring for induction of the apoptotic process. Un-
expectedly, the survivin level was markedly reduced
in LNCaP cells exposed to 0.5 µM CPT compared to
3.0 µM CPT-treated cells, and this profound decrease
in the protein level was well correlated with mRNA
expression (Fig. 5). At present, we have no adequate
explanation for this finding and further experiments
are needed to address this phenomenon.
Taken together, the comparative investigations of
the expression profiles for three anti-apoptotic pro-
teins provide at least in part some evidence suggesting
that clusterin may take a greater part in resistance to
CPT in PC-3 cells, compared to XIAP and survivin.
references
1. Denis L, Murphy GP. Overview of phase III trials on
combined androgen treatment in patients with metastatic
prostate cancer. Cancer 1993; 72: 3888–95.
2. Amantana A, London CA, Iversen PL, Devi GR. X-linked
inhibitor of apoptosis protein inhibition induces apoptosis and
enhances chemotherapy sensitivity in human prostate cancer
cells. Mol Cancer Ther 2004; 3: 699–707.
3. Chiou SK, Jones MK, Tarnawski A. Survivin — an
anti-apoptosis protein: its biological roles and implications for
cancer and beyond. Med Sci Monit 2003; 9: 43–7.
4. Deveraux QL, Takahashi R, Salvesen GS, Reed JC.
X-linked IAP is a direct inhibitor of cell-death proteases.
Nature 1997; 388: 300–4.
5. Hayashi N, Asano K, Suzuki H, Yamamoto T, Taniga-
wa N, Egawa S, Manome Y. Adenoviral infection of survivin
antisense sensitizes prostate cancer cells to etoposide in vivo.
Prostate 2005; 65: 10–9.
6. Nomura T, Mimata H, Takeuchi Y, Yamamoto H, Miya-
moto H, Nomura Y. The X-linked inhibitor of apoptosis protein
inhibits taxol-induced apoptosis in LNCaP cells. Urol Res
2003; 31: 37–44.
7. Phylchenkov A, Zavelevich M, Kroczak TJ, Los M.
Caspeses and cancer: mechanisms of inactivation and new
treatment modalities. Exp Oncol 2004; 26: 82–97.
8. Zhang M. Mukherijee N, Bermudez RS, Latham DE,
Delaney MA, Zietman AL, Shiplay WU, Chakravarti A. Ade-
novirus-mediated inhibition of survivin expression sensitizes
human prostate cancer cells to paclitaxel in vitro and in vivo.
Prostate 2005; 64: 293–302.
9. Hara I, Miyake H, Gleave ME, Kamidono S. Introduc-
tion of clusterin gene into human renal cell carcinoma cells
enhances their resistance to cytotoxic chemotherapy through
inhibition of apoptosis both in vitro and in vivo. Jpn J Cancer
Res 2001; 92: 1220–4.
10. Lakins J, Bennett SA, Chen JH, Arnold JM, Mor-
rissey C, Wong P, O’Sullivan J, Tenniswood M. Clusterin
biogenesis is altered during apoptosis in the regressing rat
ventral prostate. J Biol Chem 1998; 273: 27887–95.
11. Lee C, Janulis L, Ilio K, Shah A, Park I, Kim S, Cryns V,
Pins M, Bergan R. In vitro models of prostate apoptosis:
clusterin as an antiapoptotic mediator. Prostate Suppl 2000;
9: 21–4.
12. Scartriti M, Bettuzzi S, Sharrard RM, Caporali A, Cac-
camo AE, Maitland NJ. Clusterin overexpression in both ma-
lignant and nonmalignant prostate epithelial cells induces cell
cycle arrest and apoptosis. Br J Cancer 2004; 91: 1842–50.
13. Trougakos IP, So A, Jansen B, Gleave ME, Gonos ES.
Silencing expression of the clusterin/apolipoprotein J gene
in human cancer cells using small interfering RNA induces
spontaneous apoptosis, reduced growth ability, and cell sen-
sitization to genotoxic and oxidative stress. Cancer Res 2004;
64: 1834–42.
14. Zellweger T, Chi K, Miyake H, Adomat H, Kiyama S,
Shov K, Gleave ME. Enhanced radiation sensitivity in prostate
cancer by inhibition of the cell survival protein clusterin. Clin
Cancer Res 2002; 8: 32763–84.
15. Deveraux QL, Roy N, Stennicke HR, VanArsdale T,
Zhou Q, Srinivasula SM, Alnemli ES, Salvesen GS, Reed JC.
IAPs block apoptotic events induced by caspase-8 and cyto-
chrome c by direct inhibition of distinct caspases. EMBO J
1998; 17: 2215–23.
16. Wright ME, Han DK, Hockenbery DM. Caspase-3
and inhibitor of apoptosis protein(s) interactions in Saccha-
romyces cerevisiae and mammalian cells. FEBS Lett 2000;
481: 13–8.
17. Rasheed ZA, Rubin EH. Mechanisms of resistance
to topoisomerase I-targeting drugs. Oncogene 2003; 22:
7296–304.
18. Wang XZ, Beebe JR, Pwiti L, Bielawska A, Smyth MJ.
Aberrant sphingolipid signaling is involved in the resistance of
prostate cancer cell lines to chemotherapy. Cancer Res 1999;
59: 5842–8.
19. Akao Y, Kusakabe S, Banno Y, Kito M, Nakagawa Y,
Yamiya-Koizumi K, Hattori M, Sawada M, Hirabayashi Y,
Ohishi N, Nozawa Y. Ceramide accumulation is independent
of camptothecin-induced apoptosis in prostate cancer LNCaP
cells. Biochem Biophys Res Commun 2002; 294: 363–70.
20. Matsumoto K, Hiraiwa N, Yoshiki A, Ohnishi M,
Kusakabe M. PDGF receptor-alpha deficiency in glomeru-
lar mesangial cells of tenascin-C knockout mice. Biochem
Biophys Res Commun 2002; 290: 1220–7.
21. Gleave M, Jansen B. Clusterin and IGFBPs as an-
tisense targets in prostate cancer. Ann N Y Acad Sci 2003;
1002: 95–104.
22. Daaka Yehia. Mitogenic action of LPA in prostate.
Biochim Biophys Acta 2002; 1582: 265–9.
23. Pchejetski D, Golzio M, Bonhoure E, Calvet C, Dou-
merc N, Garcia V, Mazerolles C, Rischmann P, Teissie J, Ma-
lavaud B, Cuvillier O. Sphingosine kinase-1 as a chemotherapy
sensor in prostate adenocarcinoma cell and mouse models.
Cancer Res 2005; 65: 11667–75.
24. Akao Y, Banno Y, Nakagawa Y, Hasegawa N, Kim TJ,
Murate T, Igarashi Y, Nozawa Y. High expression of sphingo-
sine kinase 1 and S1P receptors in chemotherapy-resistant
prostate cancer PC3 cells and their camptothecin-induced
up-regulation. Biochem Biophys Res Commun 2006; 342:
1284–90.
25. Hasegawa N, Mizutani K, Suzuki T, Deguchi T, No-
zawa Y. A comparative study of protein profiling by proteomic
analysis in camptothecin-resistant PC3 and camptothecin-
sensitive LNCaP human prostate cancer cells. Urol Int 2006;
in press.
36. Zhang H, Kim JK, Edwards CA, Xu Z, Taichman R,
Wang CY. Clusterin inhibits apoptosis by interacting with
activated Bax. Nat Cell Biol 2005; 7: 909–15.
Experimental Oncology 28, 209–215, 2006 (September) 215
Экспрессия кластерина, xiap и сурвивина в клетках
рака предстательной железы, устойчивых и
резистентных к камптотецину
Цель: известно, что кластерин и белки-ингибиторы апоптоза семейства IAP, такие как сурвивин и XIAP, связаны
с химиорезистентностью опухолевых клеток. Задача исследования — определить уровни экспрессии указанных белков
в линиях опухолевых клеток предстательной железы, чувствительных (LNCaP) и устойчивых (PC-3) к действию
камптотецина (CPT) — ингибитора топоизомеразы I. Методы: клетки LNCaP и PC-3 инкубировали с CPT, после чего
анализировали количество погибших клеток с использованием двойного окрашивания реактивом Херста 33 342 и пропидиум-
иодидом. Экспрессию кластерина, XIAP и сурвивина на уровне белка и мРНК оценивали методами Вестерн-блоттинга и
полуколичественного РТ-ПЦР соответственно. Результаты: установлено, что вследствие 24-часовой инкубации клеток с
0,5 и 3,0 µM CPT определяют более значительный процент гибели клеток линии LNCaP, чем таковых PC-3. Данные Вестерн
блот анализа выявили, что в клетках линии PC-3 количество кластерина в 5 раз больше, а XIAP — меньше, чем в клетках
линии LNCaP, в то время как экспрессия сурвивина одинакова в обеих клеточных линиях. Инкубация клеток с 0,5 и 3,0 µM
CPT приводила к снижению уровня сурвивина и XIAP в обеих линиях. Экспрессия кластерина на уровне мРНК и белка не
изменялась при действии CPT на клетки линии LNCaP, однако повышалась в клетках линии PC-3. Выводы: полученные
данные свидетельствуют о том, что в развитии резистентности к камптотецину клеток линии PC-3 кластерин может играть
более важную роль, чем сурвивин и XIAP.
Ключевые слова: LNCaP, PC-3, кластерин, XIAP, сурвивин, камптотецин.
Copyright © Experimental Oncology, 2006
|