Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2

Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2

Aim: To test the hypothesis, whether H. pylori infection may affect the level of PKD2 expression and/or activation in gastric cancer cells. Methods: Studies were performed on AGS human gastric adenocarcinoma cell line, gastric tissues samples from 36 cases of different histological variants of gastr...

Повний опис

Збережено в:
Бібліографічні деталі
Дата:2009
Автори: Shabelnik, M.Yu, Kostyuk, O.V., Merentsev, S.V., Tarasova, T.O., Sidorenko, S.P.
Формат: Стаття
Мова:English
Опубліковано: Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України 2009
Назва видання:Experimental Oncology
Теми:
Original contributions
Онлайн доступ:http://dspace.nbuv.gov.ua/handle/123456789/138136
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2 / M.Yu. Shabelnik, O.V. Kostyuk, S.V. Merentsev, T.O. Tarasova, S.P. Sidorenko // Experimental Oncology. — 2009. — Т. 31, № 3. — С. 134-139. — Бібліогр.: 38 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine
id irk-123456789-138136
record_format dspace
spelling irk-123456789-1381362018-06-19T03:02:49Z Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2 Shabelnik, M.Yu Kostyuk, O.V. Merentsev, S.V. Tarasova, T.O. Sidorenko, S.P. Original contributions Aim: To test the hypothesis, whether H. pylori infection may affect the level of PKD2 expression and/or activation in gastric cancer cells. Methods: Studies were performed on AGS human gastric adenocarcinoma cell line, gastric tissues samples from 36 cases of different histological variants of gastric cancer. Immunohistochemical, cell and molecular biology, bacteriological and biochemical approaches have been used in this study. Results: H. pylori 16S rRNA gene was detected in 97% cases of gastric tumors, and in 83% of cases cаgA gene was detected. In all tested adenocarcinoma samples cagA+ H. pylori was revealed. These cases were characterized by high level of PKD1/2 expression and autophosphorylation. In adenogenic cancer samples the presence of cagA– H. pylori was identified. Carcinoid and nondifferentiated gastric cancers contain H. pylori, with very low numbers of cagA+ copies. All cases of gastric tumors with cagA– H. pylori had very low levels of PKD1/2 autophosphorylation. AGS cell line infection with cagA– and cagA+ H. рylori resulted in elevation of PKD2 expression levels in 3.29 and 3.66 times respectively (p < 0.001). In cells infected by cag+ H. рylori the level of PKD2 transphosphorylation was 1.39 higher than in cells infected by cagA– H. pylori. For PKD2 autophosphorylation this difference was even higher — 3.27 times (p < 0.001). Conclusion: H. pylori infection enhanced the level of protein kinase D2 expression, trans- and autophosphorylation. The level of PKD2 autophosphorylation/activation was higher in AGS cell line inoculated of with cag+ H. pylori than in AGS cells with cagA– H. pylori. These suggest that H. pylori induces activation of PKD1/2 and could exploit PKD2 mediated signaling pathways that may contribute to the pathogenesis of gastric cancer. 2009 Article Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2 / M.Yu. Shabelnik, O.V. Kostyuk, S.V. Merentsev, T.O. Tarasova, S.P. Sidorenko // Experimental Oncology. — 2009. — Т. 31, № 3. — С. 134-139. — Бібліогр.: 38 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/138136 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection DSpace DC
language English
topic Original contributions
Original contributions
spellingShingle Original contributions
Original contributions
Shabelnik, M.Yu
Kostyuk, O.V.
Merentsev, S.V.
Tarasova, T.O.
Sidorenko, S.P.
Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2
Experimental Oncology
description Aim: To test the hypothesis, whether H. pylori infection may affect the level of PKD2 expression and/or activation in gastric cancer cells. Methods: Studies were performed on AGS human gastric adenocarcinoma cell line, gastric tissues samples from 36 cases of different histological variants of gastric cancer. Immunohistochemical, cell and molecular biology, bacteriological and biochemical approaches have been used in this study. Results: H. pylori 16S rRNA gene was detected in 97% cases of gastric tumors, and in 83% of cases cаgA gene was detected. In all tested adenocarcinoma samples cagA+ H. pylori was revealed. These cases were characterized by high level of PKD1/2 expression and autophosphorylation. In adenogenic cancer samples the presence of cagA– H. pylori was identified. Carcinoid and nondifferentiated gastric cancers contain H. pylori, with very low numbers of cagA+ copies. All cases of gastric tumors with cagA– H. pylori had very low levels of PKD1/2 autophosphorylation. AGS cell line infection with cagA– and cagA+ H. рylori resulted in elevation of PKD2 expression levels in 3.29 and 3.66 times respectively (p < 0.001). In cells infected by cag+ H. рylori the level of PKD2 transphosphorylation was 1.39 higher than in cells infected by cagA– H. pylori. For PKD2 autophosphorylation this difference was even higher — 3.27 times (p < 0.001). Conclusion: H. pylori infection enhanced the level of protein kinase D2 expression, trans- and autophosphorylation. The level of PKD2 autophosphorylation/activation was higher in AGS cell line inoculated of with cag+ H. pylori than in AGS cells with cagA– H. pylori. These suggest that H. pylori induces activation of PKD1/2 and could exploit PKD2 mediated signaling pathways that may contribute to the pathogenesis of gastric cancer.
format Article
author Shabelnik, M.Yu
Kostyuk, O.V.
Merentsev, S.V.
Tarasova, T.O.
Sidorenko, S.P.
author_facet Shabelnik, M.Yu
Kostyuk, O.V.
Merentsev, S.V.
Tarasova, T.O.
Sidorenko, S.P.
author_sort Shabelnik, M.Yu
title Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2
title_short Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2
title_full Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2
title_fullStr Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2
title_full_unstemmed Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2
title_sort helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase d2
publisher Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
publishDate 2009
topic_facet Original contributions
url http://dspace.nbuv.gov.ua/handle/123456789/138136
citation_txt Helicobacter pylori infection of gastric cancercells elevates the level of expression and activation of protein kinase D2 / M.Yu. Shabelnik, O.V. Kostyuk, S.V. Merentsev, T.O. Tarasova, S.P. Sidorenko // Experimental Oncology. — 2009. — Т. 31, № 3. — С. 134-139. — Бібліогр.: 38 назв. — англ.
series Experimental Oncology
work_keys_str_mv AT shabelnikmyu helicobacterpyloriinfectionofgastriccancercellselevatesthelevelofexpressionandactivationofproteinkinased2
AT kostyukov helicobacterpyloriinfectionofgastriccancercellselevatesthelevelofexpressionandactivationofproteinkinased2
AT merentsevsv helicobacterpyloriinfectionofgastriccancercellselevatesthelevelofexpressionandactivationofproteinkinased2
AT tarasovato helicobacterpyloriinfectionofgastriccancercellselevatesthelevelofexpressionandactivationofproteinkinased2
AT sidorenkosp helicobacterpyloriinfectionofgastriccancercellselevatesthelevelofexpressionandactivationofproteinkinased2
first_indexed 2025-07-10T02:47:31Z
last_indexed 2025-07-10T02:47:31Z
_version_ 1837226424927256576
fulltext 134 Experimental Oncology 31, 134–139, 2009 (September) Malignant transformation of cells is a complex process, which involves the accumulation of multiple independent mutations that lead to deregulation of cell signaling pathways that control cell growth, prolifera- tion, differentiation and apoptosis [1]. Recent progress in biomedical sciences has identified a number of mo- lecular pathways and cellular mechanisms that underline the multistage process of tumorogenesis and metastasis formation. It was shown that serine/threonine protein kinases could be involved in the integration of different signaling pathways in normal and malignant cells [2]. Protein kinase D (PKD) family within the group of calcium/calmodulin-dependent protein kinases (CAMK) consists of three members: PKD1/PKCμ, PKD2 and PKD3/PKCν. These kinases share high structural homology but differ in cell specific expres- sion, intracellular distribution and, most probably, in substrate specificity and cellular function [2]. Full activation of PKD involves phosphorylation of Ser resi- dues within different structural modules. Transphos- phorylation sites in so-called “activation loop” of PKDs are substrate for PKCs phosphorylation. Autophos- phorylation sites have been mapped in C-terminus of PKD1 and PKD2 and serves as indicator of kinase activation [3]. It is known that PKDs are activated by a range of cell surface receptors and pharmacological agents that could induce PKDs intracellular redistribution. PKD may be localized in the cytosol and in several intracellular compartments including nucleus, Golgi apparatus, plasma membrane and mitochondria. De- pending on site of localization PKDs can be implicated in the regulation of a variety of cellular processes, including Golgi apparatus function and organization, receptors signalling, tumor cell spreading and moti- lity that promote tumor invasion [2, 4].The presence of the nuclear translocation signal peptide may sug- gest that upon stimulation PKDs are translocated into the nucleus and phosphorylate nuclear targets, such as histone deacetylases and histone chaperone SET [5]. Moreover, indirectly PKDs could be involved in activation of transcription factor NF-κB [6]. In this way, PKD kinases are implicated in epigenetic regula- tion of gene expression [5]. PKD2 is the main serine/threonine protein kinase of PKD family, which is expressed in AGS cell line. In this cell line PKD2 is activated by gastrin and is a down- stream target of PKCs [7, 8]. However, little is known about the expression and activity of PKD2 as well as PKD1 in primary gastric cancer cells. H. pylori is a widespread chronic infection agent, that is considered to be aetiologycal factor for gastric and duodenal ulcer, MALT-lymphoma and gastric ade- nocarcinoma [9]. At the same time, the role H. pylori HELICOBACTER PYLORI INFECTION OF GASTRIC CANCER CELLS ELEVATES THE LEVEL OF EXPRESSION AND ACTIVATION OF PROTEIN KINASE D2 M.Yu. Shabelnik1, O.V. Kostyuk2, S.V. Merentsev3, T.O. Tarasova4, S.P. Sidorenko1, * 1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kiev 03022, Ukraine 2A.A. Bogomolets National Medical University, Kiev 04053, Ukraine 3Kiev City Oncоlogical Hospital, Kiev 03115, Ukraine 4State National Institute of Cancer, Kiev 03022, Ukraine Aim: To test the hypothesis, whether H. pylori infection may affect the level of PKD2 expression and/or activation in gastric cancer cells. Methods: Studies were performed on AGS human gastric adenocarcinoma cell line, gastric tissues samples from 36 cases of different histological variants of gastric cancer. Immunohistochemical, cell and molecular biology, bacteriological and biochemical approaches have been used in this study. Results: H. pylori 16S rRNA gene was detected in 97% cases of gastric tumors, and in 83% of cases cаgA gene was detected. In all tested adenocarcinoma samples cagA+ H. pylori was revealed. These cases were characterized by high level of PKD1/2 expression and autophosphorylation. In adenogenic cancer samples the presence of cagA– H. pylori was identified. Car­ cinoid and nondifferentiated gastric cancers contain H. pylori, with very low numbers of cagA+ copies. All cases of gastric tumors with cagA– H. pylori had very low levels of PKD1/2 autophosphorylation. AGS cell line infection with cagA– and cagA+ H. рylori resulted in elevation of PKD2 expression levels in 3.29 and 3.66 times respectively (p < 0.001). In cells infected by cag+ H. рylori the level of PKD2 transphosphorylation was 1.39 higher than in cells infected by cagA– H. pylori. For PKD2 autophosphorylation this diffe­ rence was even higher — 3.27 times (p < 0.001). Conclusion: H. pylori infection enhanced the level of protein kinase D2 expression, trans­ and autophosphorylation. The level of PKD2 autophosphorylation/activation was higher in AGS cell line inoculated of with cag+ H. pylori than in AGS cells with cagA– H. pylori. These suggest that H. pylori induces activation of PKD1/2 and could exploit PKD2 mediated signaling pathways that may contribute to the pathogenesis of gastric cancer. Key Words: gastric cancer, protein kinase D, AGS cell line, Helicobacter рylori, CagA. Received: July 20, 2009. *Correspondence: Fax: 38 (044) 258-16-56 E-mail: svitasyd@yahoo.com Abbreviation used: AGS — adenocarcinoma gastric cell line; АР-1 — activator protein; CAMK — calcium/calmodulin-dependent protein kinase; Csk — C-terminal Src kinase; MIF — macrophage migration inhibitory factor; NF-kB — nuclear factor -kB; PKC — protein kinase C; PKD — protein kinase D. Exp Oncol 2009 31, 3, 134–139 ORIGINAL CONTRIbuTIONS Experimental Oncology 31, 134–139, 2009 (September) 135 infection in pathogenesis of gastric cancer is not com- pletely clarified. Virulent H. pylori strains harbor a cagA pathogeni- city island for delivery of the bacterial CagA protein into gastric epithelial cells [10, 11]. CagA is transported into the host target cells and subsequently phosphorylated. Clearly this is a mechanism by which H. pylori could take control of one or more host cell signal transduction path- ways [10]. Presumably the final result of this interaction favors survival of H. pylori, irrespective of eventual da- mage to the host cell. After translocation, CagA is phos- phorylated by Src family kinases at the tyrosine residue in the EPIYA sequence repeats [12]. Phosphorylation of CagA is accompanied by high motility and elonga- tion of cells, the so-called hummingbird phenotype [13]. CagA has been shown to interact with a number of host signaling molecules, such as the adaptor molecule Grb-2, tyrosine phosphatase SHP-2, Src, and C-terminal Src kinase (Csk) to induce inactivation of Src kinase and dephosphorylation of cortactin [14]. It was also shown, that infection by H. pylori induced signal transduction pathways that involve РКС kinases [15, 16]. PKCs phosphorylate and activate kinases of PKD family [3]. Taking into account that previously we have found heterogeneity in PKD1/2 autophos- phorylation in gastric adenocarcinomas [17], in cur- rent study we tested the hypothesis whether infection by the H. pylori may affect the level of PKD2 expression and/or activation in gastric cancer cells. MATERIALS AND METHODS Studies were performed on AGS cell line, gastric tumor samples and surrounding normal tissues of sto- mach (29 cases of adenocarcinomas with different level of differentiation, 3 — cases of adenogenic cancer, 2 — cases of nondifferentiated cancer, 1 — case of carci- noid tumor, 1 — case of adenoma). Gastric tumors were classified and graded according to WHO classification on the basis of combination of morphologic and clini- cal characteristics [18]. The usage of tissue samples was approved by the Institutional Review Board and Re- search Ethics Committee of R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, National Academy of Sciences of Ukraine. Polyclonal rabbit antibodies, that recognize both PKD1 and PKD2 kinases (anti-PKD1/2) and auto- phosphorylated sites in both PKD1 and PKD2 (anti- pPKD1/2) (kind gift of Prof. VanLint, Belgium), PKD2 (Calbiochem, USA), Ser876 in PKD2 (autophospho- rylated pPKD2) (Upstate, USA), Ser 744/748 in PKD2 (transphosphorylated ppPKD2) (Cell Signaling, USA) and goat anti-actin antibodies (Santa Cruz, CA, USA) were used as primary antibodies. EnVision detec- tion system (DAKO, Denmark), goat anti-rabbit IgG- HRP and donkey anti-goat IgG-HRP (Santa Cruz, CA, USA) were applied as a secondary antibodies. Immunohistochemistry. Tissue samples of all studied cases were fixed in 4% paraformaldehyde and embedded in paraffin. Immunohistochemistry stu dies of PKD1 and PKD2 were performed on de- paraffined tissues sections. We used specific anti- PKD1/2 antibodies that recognized both isoforms. The levels of autophosphorylated PKD1 and PKD2 were used as a criterion of activated PKD1/2 and were ac- cessed with anti-pPKD1/2 serum, which recognize con- served autophosphorylation site in PKD1 and PKD2. To reduce non-specific background, prior to spe- cific antibodies, sections were treated with normal goat serum and 1% BSA solution. EnVision detection system was used in 45 min second-step incubation. After washing in phosphate-buffered saline peroxidase activity was assayed using DAB. Section were counter- stained with hematoxylin for 1 min, embedded in balm, and studied under the microscope. Isolation and cultivation of H. pylori. For isola- tion we used samples of pyloric antrum of the sto- mach from 4 patients with gastric ulcer (Department of Therapy № 2 of A.A. Bogomolets National Medical University, Kiev, Ukraine). For tissue sample trans- portation we used Stuart’s transport medium (Merck, USA). Prior inoculation, material was homogenized in 0.5 ml of sterile PBS or brain heart infusion broth du- ring 1 min. Selective medium Agar pylori (Bio Merieux, France) and nonselective — Columbia agar with 10% of the sheep blood (Bio Merieux, France) were ino- culated with gomogenized tissues. Tissues dishes were incubated in GENbox Jar (Bio Merieux, France), in microaerofilic condition that was created by spe- cial gas generation packages (Bio Merieux, France) at 37 °C during 7 days. Typing of bacterial cultures was performed using cultural, morphological, tinctorial and enzymatic cri- teria. Selected cultures of Н. pylori were subcultivated on Columbia agar with 10% of horse blood in microaero- filic condition at 37 °C during 48–72 h. For inoculation of AGS cell line we used only “young” cultures of H. py- lori, that had less than 25% of coccal forms and in size of the 108 CFU on Mac-Farland̓s scale. Inoculation AGS cell line with Н. pylori. AGS cell line was cultivated with cagA– and cagA+ Н. pylori cultures during 4.5 h and proteins were extracted using Triton- X100 lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton-X100, 5 mM EDTA) with cocktail of inhibitors of proteases and phosphatases (Sigma, USA). Western blot analysis. Western blot analysis was performed using rabbit anti-PKD2, anti-ppPKD1/2 (Ser 744/748), and anti-pPKD2 (Ser876) rabbit sera. The cells from cell cultures were lysed using Tri- ton-X100 lysis buffer with cocktail of inhibitors of pro- teases and phosphatases (Sigma, USA). Lysates were subjected to SDS-PAGE on 7.5% gels. Proteins were transferred to Immobilon-NC membranes (Millipore, USA) and blocked during overnight incubation with 5% nonfat dried milk in TBS-T. Membranes were incubated with primary antisera at 4 °C for 12 h and with seconda- ry antibodies for 2 h. For semiquantitative evaluation of Western blot analysis Total lab software version 2.01 (Phoretix, Nonlinear Dynamics Ltd) was applied. DNA isolation and polymerase chain reaction for H. pylori identification. DNA isolation was per- 136 Experimental Oncology 31, 134–139, 2009 (September) formed using TRI reagent (Sigma, USA) according to manufacturers protocol. DNA pellet was dissolved in TE buffer. For polymerase chain reaction (PCR) we used 0.5 μg of DNA for each probe. The universal primers for H. pylori detection in gastric tissue included two oligonucleotides designed to amplify 16S rRNA (Maxim Biotech. Inc., USA), (GenBank Acession No.: U00679) the 5’Oligo: СTGGAGAGACTAAGCCCTCC and the 3ʼOligo: ATTACTGACGCTGATTGTGC, which generated a 110-bp product. PCR amplification with specific primers was performed according to standard protocol: thirty five cycles, with each cycle consis- ting of denaturation step at 94 °C, annealing step at 58 °C and extension step at 72 °C. The specific pri- mers for PCR amplification of cagA H. pylori (Helicopol Ca, Russia), which generated a 404-bp product, were used for identification of cagA+ strains of H. pylori. Thirty five cycles were performed, with each cycle consisting of denaturizing step at 94 °C, annealing step at 52 °C, and extension step at 72 °C. Each experi- ment included negative and positive controls provided by manufacturers. Statistical analysis. Statistical significance of dif- ferences was evaluated by Student’s t-test. RESuLTS AND DISCuSSION Starting from our previous results that showed hete- rogeneity of primary adenocarcinoma cancer samples by expression levels of PKD1 and PKD2 and auto- phosphorylation/activation, we found that diffe rent histological variants of gastric cancer also vary in the level of PKD1/2 autophosphorylation. The high level of PKD1/2 autophosphorylation was detected in adenocarcinomas with moderate level of differ- entiation (Fig. 1, a), whereas in adenogenic cancer the level of PKD1/2 autophosphorylation was very low or undetectable (Fig. 1, b). At the same time, benign tumor (adenoma) demonstrated high level of PKD1/2 autophosphorylation (Fig. 1, с). Heteroge- neity of gastric cancer primary samples by PKD1/2 au- tophosphorylation could depend not only on the level of cell differentiation [17], but also reflect tumor cell activation with infectious agents. Since H. pylori in- fection was shown to trigger PKC-mediated signaling pathway [15, 16], and activity (autophosphorylation) of PKD kinases is regulated by PKCs [2, 19], we ana- lyzed the pre sence of H. pylori in the primary gastric tumor samples and addressed the question whether H. pylori could induce PKD phosphorylation. The 16S rRNA gene of H. pylori is a highly specific target for amplification and has been used previously to help reclassify these bacteria [20]. Weiss et al. [21] have demonstrated the specificity of unique H. pylori 16S rRNA gene primers to identify the bacteria in pa- raffin-embedded gastric biopsy specimens. In primary tissue samples we found that 97% (35 from 36) cases of examined gastric tumors contain H. pylori 16S rRNA (Fig. 2, a) that is comparable to the previously pub- lished data [22]. a b c Fig. 1. The level of PKD1/2 autophosphorylation in gastric tumors, immunohistochemical staining. a, adenocarcinoma; b, adenogenic cancer; c, adenoma (X400) 1 2 3 4 5 6 7 8 9 16s RNA CagA DNA a b c Fig. 2. PCR analysis of DNA isolated from gastric tissue samples. The presense of 16S rRNA (a) of H. pylori identify the bacteria from frozen (1–4, 7) and in paraffin-embedded gastric biopsy specimens (5–6, 8). b, cagA+ from H. pylori. c, Control of assayed material (DNA). 1–5 — adenocarcinomas, 6 — adenogenic can- cer, 7 — carcinoid cancer, 8 — nondifferentiated gastric cancer, 9 — positive control Some strains of H. pylori have been shown to be more pathogenic than others. Strains that possess CagA are associated with increased severity of gastritis and with additional risk for developing atrophic gastritis and gastric cancer [23]. Moreover, it has been demon- Experimental Oncology 31, 134–139, 2009 (September) 137 strated that after H. pylori infection, CagA is translocated into the epithelial cells, and it undergoes tyrosine phos- phorylation in the host cells. The phosphorylated form of CagA might function as a phosphatase that regulates host cell growth [24]. As we can find out, cаgA gene was detected in 83% (30 from 36) cases of primary tumor tissue samples (Fig. 2, b). It should be noted that H. pylori cagA+ was revealed in all tested 29 adenocarci- noma samples as well as gastric adenoma tissue sample (see Fig. 2, a, b, tracks 1–5; other data not shown). In two samples of adenogenic cancer cagA– gene H. py- lori was identified, however one case of adenogenic cancer can be considered as H. pylori negative, since H. pylori 16S rRNA gene was not detected here (see Fig. 2, a, b, track 6 and data not shown). In carcinoid and nondifferentiated gastric cancer we found the pre- sence of H. pylori, with very low numbers of cagA copies (see Fig.2 a, b, tracks 7 and 8). Since in our studies the presence of cagA+ H. pylori in tumor tissues was correlated with the moderate to high level of PKD1/2 autophosphorylation, we ad- dressed the question whether H. pylori infection may affect the level of PKD2 expression and/or trans- and autophosphorylation. To test this hypothesis we used the model gastric cancer cell line AGS which was infected with H. pylori. Cultivation of AGS cell line with cagA– or cagA+ H. pylori cultures during 4.5 h caused the elevation of PKD2 expression level in comparison with the control cultures, moreover, it resulted in PKD2 transphosphorylation (ppPKD2) and autophosphorylation (pPKD2) (Fig. 3). Control cell culture did not demonstrate PKD2 trans- phosphorylation that is PKC-dependent. PKD2 in these cultures was not activated and, accordingly, was not auto- phosphorylated (see Fig. 3, a). At the same time, ino- culation of AGS cell line with H. pylori led to substantial PKD2 trans- and autophosphorylation reflecting the acti- vation of this kinase. Furthermore, the level of PKD2 auto- phosphorylation in AGS cell line inoculated with cagA+ H. pylori was much higher than that in cells inocula ted with cagA– H. pylori (see Fig. 3, a). To evaluate H. рylori induced changes in PKD2 expression and phosphoryla- tion we have performed densitometric analysis of Western blots with normalization to the level of actin expression (see Fig. 3, b). As it is shown on the left panel of Fig. 3, b, infection with cagA– and cagA+ of H. рylori led to elevation of PKD2 expression by 3.29 and 3.66 times respectively (p < 0.001). H. рylori infection dramatically increased both trans- and autophosphorylation of PKD2. It worth to note that in cultures with cagA+ H. рylori the level of transpho- sphorylation (PKC-dependent) was by 1.39 times higher than in cultures infected with cagA– H. рylori (p < 0.001). For PKD2 autophosphorylation this difference was even higher — 3.27 times (p < 0.001) (see Fig. 3, middle and right panel). The development of cancer is often associated with chronic inflammation [25]. Inflammation is linked to all stages of tumor development — initiation, progres- sion and metastasis. Although the connection between chronic inflammation and cancerogenesis has been well established, the underlying mechanisms remain unclear [25]. Recent studies have begun to unravel signaling pathways linking inflammation and cancer [26]. 105 kDa 42 kDa PKD2 ppPKD2 pPKD2 Actin 0 10 20 30 40 50 60 70 80 90 100 Control CagA– CagA+ Control CagA– CagA+ Control CagA– CagA+ Control CagA– CagA+ PKD2 PK D2 e xp re ss io n (r el at ive u ni ts ) ppPKD2 0 10 20 30 40 50 60 70 80 90 100 PK D2 tr an sp ho sp ho ry la tio n (r el at ive u ni ts ) 0 10 20 30 40 50 60 70 80 90 100 pPKD2 PK D2 a ut op ho sp ho ry la tio n( re la tiv e un its ) a b Fig. 3. Protein expression, trans- and autophosphorylation of PKD2 in AGS cell line after H. pylori infection. a, Western blot analysis of PKD2 expression, transphosphorylation (ppPKD1/2), and autophosphorylation (pPKD2). The level of actin expression served as loading control. Control — noninfected AGS cell line, cagA– — AGS cell line infected with cagA– culture of H. pylori. cagA+ — AGS cell line infected with cagA+ culture of H. pylori. b, Densitometry of Western blot analysis with normalization to actin (p < 0.001) H. pylori that infects over half of the world’s popu- lation, usually persists in the gastric mucosa [27] 138 Experimental Oncology 31, 134–139, 2009 (September) and confers risk of serious diseases, including peptic ulceration and gastric neoplasia [28]. Н. pylori is the first bacterium to be classified as a definite carcinogen because of its epidemiologic relationship to gastric adenocarcinoma and gastric mucosa-associated lym- phoid tissue MALT lymphoma. Understanding how this bacteria interacts with its host and affects biological functions of epithelial cells via interaction with different intracellular signaling pathways is essential for desig- ning the strategy for optimized therapy [29]. Recently the mechanisms H. pylori interaction with host cells have been clarified. H. pylori possesses over 30 genes related to the expression of outer membrane proteins. Several of these proteins have been classi- fied as adhesins, suggesting multiple and perhaps redundant or variable modes of attachment to cell surface. The best studied H. pylori adhesins are outer membrane proteins that bind carbohydrate moie- ties in host cell glycoproteins [29]. Bacterium also use CD74 for adhesion to epithelial cells [30]. There are known several distal outcomes of H. pylori interaction with gastric epithelial cell for example, activa- tion of transcription factors NF-κB and АР-1, induction of secretion of MIF, IL-8, IL-1β [30, 31], but the mecha- nisms of signal transduction and intracellular pathways utilized by this bacterium was not explored. In our studies we tested the hypothesis whether cagA+ and cagA– H. pylori can affect the PKD2 expres- sion and activation. Our study revealed the presence of H. pylori in all exa mined 29 adenocarcinoma samples that are characterized by high and moderate level of PKD1/2 autophosphorylation. Moreover, all these cases also were cagA+. Adenogenic and nondif- ferentiated gastric cancer, and also carcinoid ones had very low level of PKD1/2 aurophosphoryla- tion and are cagA– or carry low numbers of cagA. At the same time, benign tumor (adenoma) de- monstrated high level of PKD1/2 autophosphorylation and the presence of cagA+ H. pylori. Heterogeneity of primary gastric cancer samples in PKD1/2 auto- phosphorylation could depend on the level of cell differentiation, but also reflect tumor cell activation with infectious agents. Althoug the percent of H. pylori positive gastric samples vary depending on age, geo- graphical localization and ethnicity, H. pylori was de- tected in vast majority of adenocarcinoma samples [27, 32]. According to our data, H. pylori was detected in all tested adenocarcinoma samples, moreover, all studied adenocarcinoma cases were cagA+. Correlation between the presence of cagA posi- tive H. pylori and PKD1/2 phosphorylation may point on causal link between infection and PKDs activation. To test this assumption we employed experimental model system. Indeed, H. pylori infection of AGS cell line induced autophosphorylation/activation of PKD2 (see Fig. 3). This activation was PKC-dependent, since PKD2 was phosphorylated at site Ser 744/748, which is the target of PKC (see Fig. 3). Moreover, we found that infection with either cagA– and cagA+ H. pylori also elevated the level of PKD2 expression in AGS cell line. Markedly, the cagA+ H. pylori was more potent than cagA– H. pylori in elevation of PKD2 level (see Fig. 3, a). It is obvious that increase of PKD2 activity was not de- pendent on the level of PKD2 expression since in con- trol cultures PKD phosphorylation was not detected. There are several lines of evidence of the functional link between H. pylori infection and PKDs activation. First, H. pylori infection was shown to trigger PKC- mediated signaling pathway [15, 16], and PKCs regu- late activity (autophosphorylation) of PKD kinases [2, 19]. Second, both H. pylori and PKDs are involved in NF-κB activation [27, 30]. Third, CagA targets an im- portant cellular E-cadherin/β-catenin pathway, which regulates epithelial junction formation, epithelial cell adhesion, and control cell growth [33]. PKDs activity is also involved in regulation of E-cadherin/β-catenin pathway especially in tumor cells [34]. Fourth, both PKDs and H. pylori are linked to regulation of HDAC (histon deacetylases), which are involved in epigenetic regulation of gene expression [28, 35]. Fifth, both regu- late matrix metalloproteinase expression [36–38]. All these suggest that in order to affect host cell bio- logical programs, H. pylori may use PKDs-mediated signalling pathways. In conclusion, using the model system of gastric cancer cell line AGS we have shown that H. pylori infection enhanced the levels of expression, trans- and autophosphorylation of protein kinase PKD2, that may lead to activation of signal transduction path- ways, promoting cell proliferation and tumor invasion. We also found that the level of PKD2 autophosphoryla- tion/activation was higher in AGS cell line inoculated of with cagA+ H. pylori than that in AGS cells with cagA– H. pylori. H. pylori induced activation of PKD1/2 could contribute to the pathogenesis of gastric cancer. ACKNOWLEDGEMENTS This work was supported in part by Ukrainian gov- ernmental grants 010U000784, 0105U005557 and 0107U002244. REFERENCES Bild AH, Yao G, Chang JT, 1. et al. Oncogenic pathway signatures in human cancers as a guide to targeted therapies. Nature 2006; 439: 353–7. Van Lint J, Rykх A, Maeda Y, 2. et al. Protein kinase D: an intracellular traffic regulator on the move. Trends Cell Biology 2002; 12: 193–200. Rozengurt E, Rey O, Waldron RT. 3. Protein kinase D sig- naling. J Biol Chem 2005; 280: 13205–8. Hausser A, Link G, Bamberg L, 4. et al. Structural require- ments for localization and activation of protein kinase Cμ (PKCμ) at the Golgi compartment. J Cell Biol 2002; 156: 65–74. Dequiedt F, Van Lint J, Lecomte E, 5. et al. Phosphoryla- tion of histone deacetylase 7 by protein kinase D mediates T cell receptor-induced Nur77 expression and apoptosis. Exp Med 2005; 201: 793–804. Mihailovic T, Marx M, Auer A, 6. et al. Protein kinase D2 me- diates activation of nuclear factor kappaB by Bcr-Abl in Bcr-Abl+ human myeloid leukemia cells. Cancer Res 2004; 64: 8939–44. Sturany S, Van Lint J, Muller F, 7. et al. Molecular cloning and characterization of the human protein kinase D2. A novel Experimental Oncology 31, 134–139, 2009 (September) 139 member of the protein kinase D family of serine threonine kinases. J Biol Chem 2001; 276: 3310–8. Sturany S, Van Lint J, Gilchrist A, 8. et al. Mechanism of activation of protein kinase D2 (PKD2) by the CCKB/ gastrin receptor. J Biol Chem 2002; 277: 29431–8. Jones RG, Trowbridge DB, Go MF. 9. Helicobacter pylori infection in peptic ulcer disease and gastric malignancy. Front Biosci 2001; 6: 213–26. Amieva MR, Vogelmann R, Covacci A, 10. et al. Disruption of the epithelial apical-junctional complex by Helicobacter pylori CagA. Science 2003; 300: 1430–4. Backert, S, Moese S, Selbach S, 11. et al. Phosphoryla- tion of tyrosine 972 of the Helicobacter pylori CagA protein is essential for induction of a scattering phenotype in gastric epithelial cells. Mol Microbiol 2001; 42: 631–44. Selbach, M, Moese S, Hauck CR, 12. et al. Src is the ki- nase of the Helicobacter pylori CagA protein in vitro and in vivo. J Biol Chem 2002; 277: 6775–8. Stein MF, Bagnoli R, Halenbeck R, 13. et al. c-Src/Lyn ki- nases activate Helicobacter pylori CagA through tyrosine phospho- rylation of the EPIYA motifs. Mol Microbiol 2002; 43: 971–80. Tsutsumi R, Higashi H, Higuchi M, 14. et al. Attenuation of Helicobacter pylori CagA SHP-2 signaling by interaction between CagA and C-terminal Src kinase. J Biol Chem 2003; 278: 3664–70. Nozawa Y, Nishihara K, Akizawa Y, 15. et al. Protein kinase C activation by Helicobacter pylori in human gastric epithelial cells limits interleukin-8 production through suppression of extracel- lular signal-regulated kinase. J Pharmacol Sci 2004; 94: 233–9. Brandt S, Wessler S, Hartig R, 16. et al. Helicobacter pylori activates protein kinase C delta to control Raf in MAP kinase signalling: role in AGS epithelial cell scattering and elongation. Cell Motil Cytoskeleton 2009; DOI 10.1002/cm.20373. Shabelnik MY, Tarasova TA, Merencev SV, 17. et al. The level of expression and autophosphorylation of protein kinase D1 and D2 in gastric adenocarcinoma of different level of differentiation. Oncology 2008; 10: 393–9 (In Ukrainian). Hamilton SR, Aaltoneb LA (eds). 18. World Health Organi- zation classification of tumours. Pathology and genetics of tu- mours of the digestive system. Lyon: IARC Press, 2000: 253. Waldron R, Rey O, Iglesias T, 19. et al. Activation loop Ser744 and Ser748 in protein kinase D are transphosphory- lated in vivo. J Biol Chem 2001; 276: 32606–15. Gramley WA, Asghar A, Frierson HF, 20. et al. Detection of Helicobacter pylori DNA in fecal samples from infected individuals. Clin Microbiol 1999; 37: 2236–40. Weiss J, Mecca J, Silva E, Gassner D. 21. Comparison of PCR and other diagnostic techniques for detection of Heli- cobacter pylori infection in dyspeptic patients. J Clin Microbiol 1994; 32: 1663–8. Webb PM, Crabtree JE, Forman D, 22. et al. Gastric can- cer, cytotoxin-associated gene A-positive Helicobacter pylori, and serum pepsinogens: an international study. Gastroentero- logy 1999; 116: 269–76. Sande N, Nikulin M, Nilsson I, 23. et al. Increased risk of developing atrophic gastritis in patients infected with CagA+ Helicobacter pylori. Scand J Gastroenterol 2001; 36: 928–33. Hatakeyama M, Higashi H. 24. Helicobacter pylori CagA: a new paradigm of bacterial carcinogenesis. Cancer Sci 2005; 96: 835–43. Quante M, Wang TC. 25. Inflammation and stem cells in gastrointestinal carcinogenesis. Physiology 2008; 23: 350–9. Colotta F, Allavena P, Sica A, 26. et al. Cancer-related inflammation, the seventh hallmark of cancer: links to genetic instability. Carcinogenesis 2009; 30: 1073–81. Portal­Celhay C, Perez­Perez GI. 27. Immune responses to Helicobacter pylori colonization: mechanisms and clinical outcomes. Clin Sci 2006; 110: 305–14. Xia G, Schneider­Stock R, Diestel A, 28. et al. Helicobacter pylori regulates p21WAF1 by histone H4 acetylation. Biochem Biophys Res Comm 2008; 369: 526–53. Amieva MR, El­Omar EM. 29. Host-bacterial interac- tions in Helicobacter pylori infection. Gastroenterology 2008; 134: 306–23. Beswick EJ, Reyes VE. 30. CD74 in antigen presentation, inflammation, and cancers of the gastrointestinal tract. World J Gastroenterol 2009; 15: 2855–61. Sharma SA, Tummuru MK, Blaser MJ, 31. et al. Activa- tion of IL-8 gene expression by Helicobacter pylori is regulated by transcription factor nuclear factor-κB in gastric epithelial cells. J Immunol 1998; 160: 2401–7. Majid MA, Faruq TI, Hossain AB. 32. Association of He- licobacter pylori infection with gastric carcinoma. Bangladesh Med Res Counc Bull 2009; 35: 7–10. Murata­Kamiya N, Kurashima Y, Teishikata Y, 33. et al. He- licobacter pylori CagA interacts with E-cadherin and deregulates the β-catenin signal that promotes intestinal transdifferentiation in gastric epithelial cells. Oncogene 2007; 26: 4617–26. Du C, Jaggi M, Zhang C, Balaji KC. 34. Protein kinase D1-mediated phosphorylation and subcellular localization of beta-catenin. Cancer Res 2009; 69: 1117–24. Kim M, Jang HR, Kim JH, 35. et al. Epigenetic inactivation of protein kinese D1 in gastric cancer and its role in gastric cancer cell migration and invasion. Carcinogenesis 2008; 29: 629–37. Eiseler T, Dőppler H, Yan IK, 36. et al. Protein kinase D1 regulates matrix metalloproteinase expression and inhibits breast cancer cell invasion. Brest Cancer Res 2009; 11: R13. Achyut BR, Ghoshal UC, Moorchung N, 37. et al. Transfor- ming grows factor-B1 and matrix metalloproteinase-7 promoter variants induce risk for Helicobacter pylori-associated gastric precancerous lesions. DNA Cell Biol 2009; 28: 295–301. Tomita M, Ando T, Minami M, 38. et al. Potential role for matrix metalloproteinase-3 in gastric ulcer healing. Diges- tion 2009; 79: 23–9. Copyright © Experimental Oncology, 2009

Схожі ресурси