Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population
Aim: To identify clinically significant molecular markers of endometrial cancer. Materials and Methods: Cancer and normal endometrial tissue samples from 20 patients of the Gynecology Clinic of Odessa State Medical University (Odessa, Ukraine) with confirmed endometrial cancer were compared for SSR...
Збережено в:
| Дата: | 2007 |
|---|---|
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2007
|
| Назва видання: | Experimental Oncology |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/138574 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population / V.P. Domenyuk, K.V. Litovkin, T.G. Verbitskaya, V.G. Dubinina, V.V. Bubnov // Experimental Oncology. — 2007. — Т. 29, № 2. — С. 152–155. — Бібліогр.: 15 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-138574 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1385742020-10-11T00:35:43Z Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population Domenyuk, V.P. Litovkin, K.V. Verbitskaya, T.G. Dubinina, V.G. Bubnov, V.V. Original contributions Aim: To identify clinically significant molecular markers of endometrial cancer. Materials and Methods: Cancer and normal endometrial tissue samples from 20 patients of the Gynecology Clinic of Odessa State Medical University (Odessa, Ukraine) with confirmed endometrial cancer were compared for SSR and ISSR polymorphisms. Identified polymorphic fragments from anonymous genome regions situated between microsatellite repeats underwent direct DNA sequencing; analysis of their homology to sequences from human genome database has been performed. Results: No significant variability for the microsatellite loci adjacent to the E2F1, BAX, TCF7L2, C-MYC, WNT1, FES, DCC, P27, THRA, APC, CYP19 and P53 genes was detected. Search for new molecular markers of endometrial cancer within anonymous DNA sequences located between microsatellite repeats revealed 100 bp and 174 bp polymorphic fragments. These fragments were detected correspondingly in 60% and 35% of patients. 100 bp fragment appeared to be homologous to a region within the NFKB gene, 174 bp fragment – to a sequence within the DDR1 gene. Conclusions: NFKB1 and DDR1 genes may be regarded as potential markers for some types of endometrial cancer. This is a first report about possible association of these genes with endometrial cancer. Цель: идентификация клинически значимых маркеров рака эндометрия. Материалы и Методы: проведен анализ SSR- и ISSR-полиморфизма в образцах опухолей и непораженной ткани эндометрия двадцати пациентов, получавших лечение в клинике гинекологии Одесского государственного медицинского университета (Одесса, Украина). Выполнено секвенирование выявленных полиморфных фрагментов ДНК, локализованных в анонимных участках генома между микросателлитными повторами (ISSR-полиморфизм), осуществлен анализ их гомологии с известными участками ДНК из базы данных генома человека. Результаты: не установлено значительной вариабельности микросателлитных повторов, соседствующих с генами E2F1, BAX, TCF7L2, C-MYC, WNT1, FES, DCC, P27, THRA, APC, CYP19 и P53. В процессе поиска новых маркеров рака эндометрия среди анонимных последовательностей ДНК, локализующихся между микросателлитными повторами, выявлены полиморфные фрагменты длиной 100 и 174 пн. Эти фрагменты присутствовали соответственно у 60 и 35% пациентов . Фрагмент длиной 100 пн оказался гомологичным участку гена NFKB1, а фрагмент длиной 174 пн – участку гена DDR1. Выводы: гены NFKB1 и DDR1 могут рассматриваться в качестве потенциальных маркеров некоторых типов рака эндометрия. Это первое сообщение о возможной ассоциации данных генов с опухолями эндометрия. 2007 Article Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population / V.P. Domenyuk, K.V. Litovkin, T.G. Verbitskaya, V.G. Dubinina, V.V. Bubnov // Experimental Oncology. — 2007. — Т. 29, № 2. — С. 152–155. — Бібліогр.: 15 назв. — англ. 1812-9269 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/138574 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Original contributions Original contributions |
| spellingShingle |
Original contributions Original contributions Domenyuk, V.P. Litovkin, K.V. Verbitskaya, T.G. Dubinina, V.G. Bubnov, V.V. Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population Experimental Oncology |
| description |
Aim: To identify clinically significant molecular markers of endometrial cancer. Materials and Methods: Cancer and normal endometrial tissue samples from 20 patients of the Gynecology Clinic of Odessa State Medical University (Odessa, Ukraine) with confirmed endometrial cancer were compared for SSR and ISSR polymorphisms. Identified polymorphic fragments from anonymous genome regions situated between microsatellite repeats underwent direct DNA sequencing; analysis of their homology to sequences from human genome database has been performed. Results: No significant variability for the microsatellite loci adjacent to the E2F1, BAX, TCF7L2, C-MYC, WNT1, FES, DCC, P27, THRA, APC, CYP19 and P53 genes was detected. Search for new molecular markers of endometrial cancer within anonymous DNA sequences located between microsatellite repeats revealed 100 bp and 174 bp polymorphic fragments. These fragments were detected correspondingly in 60% and 35% of patients. 100 bp fragment appeared to be homologous to a region within the NFKB gene, 174 bp fragment – to a sequence within the DDR1 gene. Conclusions: NFKB1 and DDR1 genes may be regarded as potential markers for some types of endometrial cancer. This is a first report about possible association of these genes with endometrial cancer. |
| format |
Article |
| author |
Domenyuk, V.P. Litovkin, K.V. Verbitskaya, T.G. Dubinina, V.G. Bubnov, V.V. |
| author_facet |
Domenyuk, V.P. Litovkin, K.V. Verbitskaya, T.G. Dubinina, V.G. Bubnov, V.V. |
| author_sort |
Domenyuk, V.P. |
| title |
Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population |
| title_short |
Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population |
| title_full |
Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population |
| title_fullStr |
Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population |
| title_full_unstemmed |
Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population |
| title_sort |
identification of new dna markers of endometrial cancer in patients from the ukrainian population |
| publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| publishDate |
2007 |
| topic_facet |
Original contributions |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/138574 |
| citation_txt |
Identification of new DNA markers of endometrial cancer in patients from the Ukrainian population / V.P. Domenyuk, K.V. Litovkin, T.G. Verbitskaya, V.G. Dubinina, V.V. Bubnov // Experimental Oncology. — 2007. — Т. 29, № 2. — С. 152–155. — Бібліогр.: 15 назв. — англ. |
| series |
Experimental Oncology |
| work_keys_str_mv |
AT domenyukvp identificationofnewdnamarkersofendometrialcancerinpatientsfromtheukrainianpopulation AT litovkinkv identificationofnewdnamarkersofendometrialcancerinpatientsfromtheukrainianpopulation AT verbitskayatg identificationofnewdnamarkersofendometrialcancerinpatientsfromtheukrainianpopulation AT dubininavg identificationofnewdnamarkersofendometrialcancerinpatientsfromtheukrainianpopulation AT bubnovvv identificationofnewdnamarkersofendometrialcancerinpatientsfromtheukrainianpopulation |
| first_indexed |
2025-07-10T06:05:31Z |
| last_indexed |
2025-07-10T06:05:31Z |
| _version_ |
1837238883265282048 |
| fulltext |
152 Experimental Oncology 29, 152–155, 2007 (June)
Endometrial cancer is recognized worldwide as one
of the most common oncological disorders of the female
genital tract. At present this disease is being diagnosed
in 70% of cases at stage III–IV, when it is already quite
difficult to find an effective treatment. Molecular changes
in structure of several genes have recently been reported
to lead to endometrial cancer progression. Up to 83%
of hormone-dependent endometrioid carcinomas are
associated with the loss-of-function mutation in the
tumor suppressor PTEN gene located on chromosome
10. Altered PTEN expression is considered as a marker
of the earliest endometrial precancers and good survival
prognosis, while methylation of its promoter is associated
with late-stage disease [1, 2]. Some data suggest that
structural alterations in p53, p16, K-ras, as well as Her2/
neu overexpression may have prognostic value, though
without relation to histological type and stage [3–8]. Pre-
dictive significance of K-ras mutations may depend on
age at disease onset. However, contradictory reports and
polygenic nature of the disease do not allow to consider
the known molecular markers quite reliable. Thus, further
detailed investigation of genetic components related to
endometrial cancer progression is needed to identify ad-
ditional molecular markers of clinical significance.
For this purpose we conducted our study in two direc-
tions: 1. Detection of molecular polymorphisms in micro-
satellite loci adjacent to the known E2F1, BAX, TCF7L2,
C-MYC, WNT1, FES, DCC, P27, THRA, APC, CYP19, P53
genes and estimation of their association with endome-
trial cancer risk. 2. Search for the potential molecular
markers in anonymous DNA sequences located between
microsatellite repeats (inter simple sequence repeat
polymorphism) in human genome, sequence analysis
of polymorphic fragments, their identification in human
genome database and evaluation of their possible role
in endometrial cancer progression.
Materials and Methods
The study cohort was comprised of twenty women
with surgically and histologically confirmed endome-
trial cancer who underwent surgery at the Gynecology
Clinic of Odessa State Medical University, Odessa,
Ukraine. All subjects were informed and gave written
consent to participate in the study and to allow their
biological samples to be genetically analyzed. Ap-
proval for this study was obtained from the Scientific
Council of Odessa State Medical University.
DNA was extracted from the tumor and normal
endometrial tissue samples of the same patients us-
ing “DNA purification kit” (Promega Corporation, USA)
according to the manufacturer’s recommendations.
DNA was stored at 4 °C until analyzed.
The amplification of 12 microsatellite loci adjacent
to the known E2F1, BAX, TCF7L2, C-MYC, WNT1,
FES, DCC, P27, THRA, APC, CYP19, P53 genes was
performed. The primers and PCR conditions are sum-
marized in Table 1.
Four ISSR primers were used to discover new
potential DNA markers: ISSR1 — (GTG)7A, ISSR12 —
(TG)9C, ISSR14 — (AC)9G, ISSR17 — (CA)10G.
The primers were synthesized by the MWG-BIOTECH
(Germany). PCR mix in a volume of 25 μl contained
50 mМ KCl, 20 mМ Tris-HCl (рН 8.4 at 25 °С), MgCl2
(2 mM for ISSR-primers and 4 mM for SSR-primers),
0.01% Tween-20, 0.15 mМ each dNTP, 0.2 μМ primers,
10-20 ng DNA, 0.8-1 U Taq-polimerase.
identification of new dna Markers of endoMetrial
cancer in patients froM the Ukrainian popUlation
V.P. Domenyuk, K.V. Litovkin*, T.G. Verbitskaya, V.G. Dubinina, V.V. Bubnov
Institute of Molecular and Cellular Medicine, Odessa State Medical University, Odessa, Ukraine
Aim: To identify clinically significant molecular markers of endometrial cancer. Materials and Methods: Cancer and normal en-
dometrial tissue samples from 20 patients of the Gynecology Clinic of Odessa State Medical University (Odessa, Ukraine) with
confirmed endometrial cancer were compared for SSR and ISSR polymorphisms. Identified polymorphic fragments from anony-
mous genome regions situated between microsatellite repeats underwent direct DNA sequencing; analysis of their homology to
sequences from human genome database has been performed. Results: No significant variability for the microsatellite loci adjacent
to the E2F1, BAX, TCF7L2, C-MYC, WNT1, FES, DCC, P27, THRA, APC, CYP19 and P53 genes was detected. Search for
new molecular markers of endometrial cancer within anonymous DNA sequences located between microsatellite repeats revealed
100 bp and 174 bp polymorphic fragments. These fragments were detected correspondingly in 60% and 35% of patients. 100 bp
fragment appeared to be homologous to a region within the NFKB gene, 174 bp fragment – to a sequence within the DDR1 gene.
Conclusions: NFKB1 and DDR1 genes may be regarded as potential markers for some types of endometrial cancer. This is a first
report about possible association of these genes with endometrial cancer.
Key Words: SSR-marker, ISSR-marker, endometrial cancer, sequencing.
Received: March 30, 2007.
*Correspondence: E-mail: k.litovkin@rambler.ru
Abbreviations used: APC – adenomatosis polyposis coli; BAX –
BCL2-associated X protein; CYP19 – cytochrome P450 family
19 subfamily A polypeptide 1; DCC – deleted in colorectal carcinoma;
DDR1 – discoidin domain receptor family member 1; E2F1 – E2F
transcription factor 1; FES – feline sarcoma oncogene; ISSR – in-
ter-simple sequence repeats; NFKB1 – nuclear factor of kappa light
polypeptide gene enhancer in B-cells 1; PTEN – phosphatase and
tensin homolog; SSR – simple sequence repeats; TCF7L2 – trans-
cription factor 7-like 2; THRA – thyroid hormone receptor alpha;
WNT1 – wingless-type MMTV integration site family member 1.
Exp Oncol 2007
29, 2, 152–155
Experimental Oncology 29, 152–155, 2007 (June) 15329, 152–155, 2007 (June) 153June) 153) 153 153
Table 1. The primer sets and PCR conditions
Primer Sequence Annealing ( °C, s)
E2F1-f
E2F1-r
5�-TGCAGAAGTGGCCTTAGCAA-3�
5�-ATCATTGAACGAACAGGGGG-3�
58, 30
BAX-f
BAX-r
5�-GCTCACTTTCACTGAGGATGC-3�
5�-TTAGGCCTAGCAGAGAATCACC-3�
50, 30
TCF7L2-f
TCF7L2-r
5�-AGTGTGACTCTGGCCAAGCT-3�
5�-TGCTCTTTAAGGCACTCTTGC-3�
60, 30
C-MYC-f
C-MYC-r
5�-CGTTAGAAAGGTCTCTGGAC-3�
5�-GTCTTAGGTAAGAATTGGCA-3�
56, 30
WNT1-f
WNT1-r
5�-AGCTCTCACACACTCTCCTTCC-3�
5�-GGAAAGTTAAAGAGGCATCCG-3�
58, 30
FES-f
FES-r
5�-GCTTGTTAATTCATGTAGGGAAGGC-3�
5�-GTAGTCCCAGTCACTTGGCTACTC-3�
55, 30
DCC-f
DCC-r
5�-GATGACATTTTCCCTCTAGA-3�
5�-TTTAGTGGTTATTGCCTTGAA-3�
56, 30
P27-f
P27-r
5�-GGCACTTCCCAGCATGTAGCCG-3�
5�-GTGGCCACATGGAGTGACCTGGGCCTC-3�
60, 30
THRA-f
THRA-r
5�-CTGCGCTTTGCACTATTGGG-3�
5�-CGGGCAGCGTAGCATTGCCT-3�
60, 30
APC-f
APC-r
5�-AGCAGATAAGACAGTATTGCTAGTT-3�
5�-ACTCACTCTAGTGATAAATCGGG-3�
50, 30
CYP19-f
CYP19-r
5�-ACAGGCAAGTGGCTGAGG -3�
5�-ATTCAGCATTGACCCTTGC-3�
58, 30
P53-f
P53-r
5�-AGGGATACTATTCAGCCCGAGGTG-3�
5�-ACTGCCACTCCTTGCCCCATTC-3�
58, 30
After the amplification the SSR-PCR products were
analyzed by gel electrophoresis on 10% polyacrilamide
gels under denaturation conditions, the ISSR-PCR
products — on 6% plolyacrilamide gels. Molecular
weight of the PCR products was calculated with “Oned-
scan” software using pUC18/MspI as a standard.
Polymorphic DNA fragments were eluted from gel
and reamplified with M13-tailed primer 5�-TGT AAA
ACG ACG GGC CAG T-ISSR17–(CA)10G to generate
products for sequencing. PCR was carried out in a
total volume of 10 μl containing 20–50 ng of genomic
DNA, 4–6 pmol primer, 200 μM dNTPs, 50 mM KCl,
2.5 mM MgCl2; 10 mM Tris-HCl (pH 8.3), 1.5% DMSO,
50 mM TMAC, and 0.2 U Tfi-polymerase. Quality of the
PCR-products was analysed in 1% agarose gel. The
intensive major bands were cut out of the gel, purified
with a GFXTM PCR DNA and Gel Band Purification
Kit (Amersham Pharmacia Biotech) and applied to
direct DNA sequencing. The sequencing reaction
was performed with M13 primer and a ThermoSe-
quenase 7-deaza-dGTP Sequencing Kit (Amersham
Pharmacia Biotech) using the BioRad ICycler. The
process included 20 cycles of 30 s at 95 °C, 30 s at
54 °C and 1 min at 72 °C. The products were resolved
on 25 cm 7% denaturing Long Ranger gels run on a
Li-Cor 4000 sequencer, following the loading proto-
cols. Sequences were base-called using the Base
ImagIRTM 4.0 (LI-COR) software. Sequence homol-
ogy was determined using the NCBI Blast Software
(http://www.ncbi.nlm.nih.gov).
resUlts
DNA fragments of 12 microsatellite loci were ampli-
fied with primers and under conditions listed in Table 1.
No polymorphism was detected for 10 of them at com-
parison of different genotypes, or different samples
from the same patient (tumor versus normal tissue).
Genotypic differences were discovered for the DCC
(170–170, 170–200, 195–195, 195–200 bp genotypic
variants) and FES (240–240, 240–244, 244–244 bp
genotypic variants) loci. However, the fragments from
different samples of the same genotypes did not differ
in their pattern with the only exception: in one genotype
a 200 bp fragment was absent in normal tissue, but
present in cancer sample.
In this study we also performed amplification of DNA
fragments with 4 ISSR-primers. The ISSR17–(CA)10G
generated 100 bp and 174 bp polymorphic fragments
(Figure). Polymorphic 100 bp DNA fragment was de-
tected in twelve patients (60%). In two of them it was
absent in cancer samples, in the rest of the patients it
was present both in cancer and normal tissue samples.
Polymorphic fragment of 174 bp in length was detected
in seven patients (35%). In four of them it was identi-
fied only in normal tissue samples, in one patient – in
both sample types, and in two patients – only in cancer
samples. We performed sequencing of both fragments
and checked their homology to the known genes using
human genome database. The analysis included only
sequences with known functions; cloned sequences
or sequences with supposed functions were ignored.
Sequences homologous to 100 bp and 174 bp frag-
ments were detected, correspondingly, within the
NFKB1 and DDR1 genes (Table 2).
figure. Products of DNA amplification by ISSR17 (CA) 10G pri-
mer. C — tumor sample, N — normal tissue sample, M — molecu-
lar weight marker pUC18/MspI. 100 bp and 174 bp polymorphic
DNA fragments are indicated by arrows
discUssion
Microsatellites are short, simple repeated sequenc-
es of DNA distributed throughout the human genome.
The accumulation of insertion or deletion mutations in
these repetitive sequences results in a form of genomic
instability, called microsatellite instability (MSI). The
MSI has been reported in a variety of both hereditary
and sporadic tumors, including endometrial cancer,
and has been shown to have prognostic significance
[9]. However, in the present study we failed to detect
significant variability for microsatellite loci adjacent to
the E2F1, BAX, TCF7L2, C-MYC, WNT1, P27, THRA,
APC, CYP19, P53 genes in cancer and normal tissue
samples obtained from the endometrial cancer pa-
tients. Genotypic differences were detected only for
the loci located next to the DCC and FES genes, but
fragments from normal and cancer tissue samples of
the same genotypes did not differ in their pattern. Of
note, DCC regulates normal endometrial cell growth
154 Experimental Oncology 29, 152–155, 2007 (June)
and is recognized as the tumor suppressor gene for
endometrial cancer [10].
In our previous study [11] we compared the vari-
ability of the above-mentioned loci in patients with
leiomyoma, a benign neoplasm, using the normal
myometrium as a control tissue. According to our
observations, detected polymorphism reached 40%
at the genotypic level, and up to 60% in neoplastic
and normal tissue within the same genotype. The
SSR-markers are far less informative in the present
study, which may be explained by differences in ge-
netic pathways involved in leiomyoma and endome-
trial cancer progression. On the basis of our data, we
conclude that the analyzed microsatellite loci adjacent
to the DCC and FES genes cannot be regarded as
markers of endometrial cancer.
Search for the potential markers for endometrial
cancer in anonymous DNA sequences located be-
tween microsatellite repeats revealed 100 bp and
174 bp fragments. The first fragment detected in 60%
of patients appeared to be homologous to a sequence
within the NFKB1 gene. NFKB1 is one of the genes
controlling immune response; loss of its expression
suppresses the immune system and apoptosis, dis-
rupts the regulation of the genes involved in cell-to-cell
interaction, intercellular communication and spreading
of primary pathogenic signals [12]. Thus, mutation just
in one NFKB1 gene may trigger a set of pathological
processes leading to tumor formation. The discovered
polymorphic fragment was lost in two cancer samples,
which means that such a loss may affect gene function.
Although in ten patients this fragment was detected
both in cancer and normal tissue sample, it has to be
mentioned that we did not perform microdissection in
the present study, so DNA derived from tumor samples
could in fact contain some DNA from non-malignant
cells. The presence of this fragment both in tumor and
normal tissue samples of some patients may partly be
explained by such DNA heterogenity.
Based on the role of NFKB1 in tumorigenesis [12]
and our own observation, we conclude that the NFKB1
gene may be regarded as a potential informative
marker for endometrial cancer progression. However,
a more detailed study of its role in tumorigenesis must
be performed in a bigger population of cancer patients
with the use of microdissection.
Another polymorphic fragment of 174 bp in length,
detected in 35% of patients, appeared to be homolo-
gous to a sequence within the DDR1 gene. It is known
that DDR1 is overexpessed in some human tumors,
e. g. breast, ovarian, esophageal and brain tumors
[13–15]. As far as we know, no data concerning its
involvement in endometrial cancer progression have
been published previously. However, evidence for
its activity in epithelial cells indirectly confirms such
suggestion. Besides, it plays a key role in regula-
tion of cellular growth, differentiation, metabolism,
intercellular communications and interaction of cells
with their environment. Suggestion about relation of
functional alterations in such a key gene to endo-
metrial cancer progression needs to be confirmed
in a more detailed study. The results presented here
show that the polymorphic fragment may be present
not only in cancer samples, but also in normal tissue.
Absence of regularities in the populational distribu-
tion of these fragments restricts to some extent the
possibility of the wide application of such markers. On
the other hand, polymorphism within the same geno-
type reflects the specific ways of cancer progression.
Investigation of such ways will tailor modern clinical
medicine to each patient according to his/her genetic
fingerprints and drive state-of-the-art screening and
prevention of different cancer forms to a new level.
On the basis of our observations we suggest that
DDR1 may influence to some extent endometrial
cancer development, though its effect may depend
on genotype and/or stage of the disease.
In conclusion, polymorphic 100 bp and 174 bp
DNA fragments, which may be regarded as potential
markers of endometrial cancer, were detected in our
study. DNA sequence analysis revealed their homol-
ogy to sequences within the NFKB1 and DDR1 genes.
This a first report on possible association of NFKB1
and DDR1 with endometrial cancer. The pattern of
populational distribution of discovered polymorphic
fragments indicates that NFKB1 and DDR1 may be
involved in some specific pathways of endometrial
cancer development, but their likely role in patho-
logical processes demands further investigation in a
more detailed study using microdissection.
acknowledGeMents
This work was supported by the Ministry of Health
of Ukraine and performed within the scopes of the
State Research “Program Oncology” (2002–2006),
research theme “Molecular and ecology-dependent
mechanisms of tumorigenesis of reproductive sphere:
ways to improve diagnostics, treatment and prophy-
laxis” (State registration number No. 0102U006588).
Table 2. Identified polymorphic DNA fragments and functions of corresponding genes (from Human Genome Database)
Polymorphic fragment 100 b.p. gggaggcagaggttgcagtgagccgagatcataccattgcactccag cctgggcaacagcagcgaaactccgtctcaaaaaataaataaaatatctgtgtgt-
gtgtgtgtgtgtg (primer)
Gene Locus Function
Homo sapiens nuclear factor of
kappa light polypeptide gene en-
hancer in B-cells 1 (NFKB1)
NT_011786 Regulation of the genes involved in cell-to-cell interaction, intercellular communication, cell recruitment
or transmigration, amplification or spreading of primary pathogenic signals, and initiation or acceleration
of tumorigenesis.
Regulation of the immune system and programmed cell death [12]
Polymorfic fragment 174 b.p. ccagatggactcctgtcttacaccgcccctgtggggcagacaatgtatttatctgaggсcgtgtacctcaacgactccacctatgacggacataccgtgggcggg-
taagaaaggcccctgcaggatatggagtttggggtgggagggaggactctgtgtgtgtgtgtgtgtgtg (primer)
Homo sapiens discoidin domain
receptor family, member 1 (DDR1)
NM_013993 Plays a key role in the communication of cells with their microenvironment. Regulation of cell growth, dif-
ferentiation and metabolism.
Plays a role in cell-to-cell contact and in cell adhesion signaling pathways [13–15]
Experimental Oncology 29, 152–155, 2007 (June) 15529, 152–155, 2007 (June) 155June) 155) 155 155
references
1. Mutter GL, Lin MC, Fitzgerald JT, Kum JB, Baak JP,
Lees JA, Weng LP, Eng C. Altered PTEN expression as a
diagnostic marker for the earliest endometrial precancers.
J Natl Cancer Inst 2000; 92: 924–30.
2. Guzeloglu KO, Kayisli UA, Al Rejjal R, Wenxin Z, Lu-
leci G, Arici A. Regulation of PTEN (Phosphatase and tensin
homolog deleted on chromosome 10) expression by estradiol
and progesterone in human endometrium. J Clin Endocrinol
Metabol 2003; 88: 5017–22.
3. Sherman ME, Bur ME, Kurman RJ. p53 in endometrial
cancer and its putative precursors: evidence for diverse path-
ways of tumorigenesis. Hum Pathol 1995; 26: 1268–74.
4. Semczuk A, Schneider-Stock R, Berbec H, Marzec B,
Jakowicki JA, Roessner A. K-ras exon 2 point mutations in
human endometrial cancer. Cancer Lett 2001; 164: 207–12.
5. Lax SF, Kendall B, Tashiro H, Slebos RJ, Ellenson LH.
The frequency of p53, K-ras mutations, and microssatellite
instability differs in uterine endometrioid and serous carci-
noma: evidence of distinct molecular genetic pathways. Cancer
2000; 88: 814–24.
6. Salvesen HB, Das S, Akslen LA. Loss of nuclear p16
protein expression is not associated with promoter methylation
but defines a subgroup of aggressive endometrial carcinomas
with poor prognosis. Clin Cancer Res 2000; 6: 153–9.
7. Rolitsky CD, Theil KS, Mcgaughy VR, Copeland LJ,
Niemann TH. Her-2/neu amplification and overexpres-
sion in endometrial carcinoma. Int J Gynecol Pathol 1999;
18: 138–43.
8. Buchynska LG, Nesina IP. Expression of the cell cycle
regulators p53, p21WAF1/CIP1 and p16INK4A in human endometrial
adenocarcinoma. Exp Oncol 2006; 28: 152–5.
9. McDonald ND, Salvesen HB, Ryan A, Iversen OE,
Akslen LA, Jacobs IJ. Frequency and prognostic impact of
microsatellite instability in a large population-based study of
endometrial carcinomas. Cancer Res 2000; 60: 1750–52.
10. Kato H, Zhoul Y, Asanomal K, Kondo H, Yoshikawa Y,
Watanabe K, Matsuda T, Wake N, Barret J. Suppressed tu-
morigenicity of human endometrial cancer cells by the restored
expression of the DCC gene. Br J Cancer 2000; 82: 459–66.
11. Dubinina VG, Domenyuk VP, Verbitskaja TG, Bub-
nov VV. Microsatellite instability in uterine myoma. Odessa
Med Zh 2006; 2: 50–3.
12. Atlas of Genetics and Cytogenetics in Oncology and
Haematology. http://atlasgeneticsoncology.org/Genes/NFK-
B1ID323.html.
13. Heinzelmann-Schwarz VA, Gardiner-Garden M, Hen-
shall SM, Scurry J, Scolyer RA, Davies MJ, Heinzelmann M,
Kalish LH, Bali A, Kench JG, Edwards LS, Vanden Bergh PM,
Hacker NF, Sutherland RL, O’Brien PM. Overexpression of
the cell adhesion molecules DDR1, Claudin 3, and Ep-CAM
in metaplastic ovarian epithelium and ovarian cancer. Clin
Cancer Res 2004; 10: 4427–36.
14. Ongusaha PP, Kim JI, Fang L, Wong TW, Yancopou-
los GD, Aaronson SA, Lee SW. P53 induction and activation
of DDR1 kinase counteract p53-mediated apoptosis and influ-
ence p53 regulation through a positive feedback loop. EMBO
J 2003; 22: 1289–301.
15. Jonhson JD, Edman JC, Rutter WJ. A receptor tyro-
sine kinase found in breast carcinoma cells has an extracel-
lular discoidin I-like domain. Proc Natl Acad Sci USA 1993;
90: 5677–81.
ИДЕНТИФИКАЦИЯ НОВЫХ МАРКЕРОВ РАКА ЭНДОМЕТРИЯ
В гРуппЕ пАЦИЕНТОВ Из уКРАИНСКОЙ пОпуЛЯЦИИ
Цель: идентификация клинически значимых маркеров рака эндометрия. Материалы и Методы: проведен анализ
SSR- и ISSR-полиморфизма в образцах опухолей и непораженной ткани эндометрия двадцати пациентов, получавших
лечение в клинике гинекологии Одесского государственного медицинского университета (Одесса, Украина). Выполнено
секвенирование выявленных полиморфных фрагментов ДНК, локализованных в анонимных участках генома между
микросателлитными повторами (ISSR-полиморфизм), осуществлен анализ их гомологии с известными участками ДНК из
базы данных генома человека. Результаты: не установлено значительной вариабельности микросателлитных повторов,
соседствующих с генами E2F1, BAX, TCF7L2, C-MYC, WNT1, FES, DCC, P27, THRA, APC, CYP19 и P53. В процессе поиска
новых маркеров рака эндометрия среди анонимных последовательностей ДНК, локализующихся между микросателлитными
повторами, выявлены полиморфные фрагменты длиной 100 и 174 пн. Эти фрагменты присутствовали соответственно у 60 и
35% пациентов . Фрагмент длиной 100 пн оказался гомологичным участку гена NFKB1, а фрагмент длиной 174 пн – участку
гена DDR1. Выводы: гены NFKB1 и DDR1 могут рассматриваться в качестве потенциальных маркеров некоторых типов
рака эндометрия. Это первое сообщение о возможной ассоциации данных генов с опухолями эндометрия.
Ключевые слова: SSR-маркер, ISSR-маркер, рак эндометрия, секвенирование.
Copyright © Experimental Oncology, 2007
|