Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system
Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological variants of primary gastric cancer w...
Збережено в:
| Дата: | 2011 |
|---|---|
| Автори: | , , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2011
|
| Назва видання: | Experimental Oncology |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/138681 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system / M.Yu. Shabelnik, L.M. Kovalevska, M.Y. Yurchenko, L.M. Shlapatska, Yu. Rzepetsky, S.P. Sidorenko // Experimental Oncology. — 2011. — Т. 33, № 4. — С. 206-211. — Бібліогр.: 20 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-138681 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1386812018-06-20T03:11:21Z Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system Shabelnik, M.Yu. Kovalevska, L.M. Yurchenko, M.Y. Shlapatska, L.M. Rzepetsky, Yu. Sidorenko, S.P. Original contributions Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological variants of primary gastric cancer were analyzed. PKD1 and PKD2 expression levels in tumor samples were accessed by Western blot analysis and quantitative polymerase chain reaction (Q-PCR). As a model system we have used gastric adenocarcinoma сell line AGS sublines constitutively transfected by pcDNA3.1 coding PKD1 or PKD2, or empty pcDNA3.1 vector. These cell lines were analyzed by Western blot, Q-PCR, MTT and proliferation assays, in vitro scratch and Transwell assays, clonogenic assay. Results: It was found that primary gastric tumors possess different levels of PKD1 and PKD2 expression on mRNA and protein levels. Low level of PKD1 expression on protein and mRNA level was detected in low differentiated adenocarcinoma and ring cell gastric cancer — disorders with poor clinical prognosis. The high level of PKD2 expression was also found in gastric tumors with poor prognosis: low differentiated adenocarcinoma and adenogen cancer. To find out whether differential expression of PKD1 and PKD2 could affect biology of gastric tumor cells in vitro, we used a model system based on AGS cell line that constitutively expressed PKD1 or overexpressed PKD2. PKD1 transfection led to the inhibition of cell proliferation, migration and colony formation, in the meanwhile, the PKD2 overexpression enhanced proliferation, migration and colony formation capacities of AGS cells. Conclusions: Our data suggest that both downregulation of PKD1 or upregulation of PKD2 expression may determine the behavior of gastric tumor cells, which promotes invasive phenotype and could result in general poor prognosis. 2011 Article Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system / M.Yu. Shabelnik, L.M. Kovalevska, M.Y. Yurchenko, L.M. Shlapatska, Yu. Rzepetsky, S.P. Sidorenko // Experimental Oncology. — 2011. — Т. 33, № 4. — С. 206-211. — Бібліогр.: 20 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/138681 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Original contributions Original contributions |
| spellingShingle |
Original contributions Original contributions Shabelnik, M.Yu. Kovalevska, L.M. Yurchenko, M.Y. Shlapatska, L.M. Rzepetsky, Yu. Sidorenko, S.P. Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system Experimental Oncology |
| description |
Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological variants of primary gastric cancer were analyzed. PKD1 and PKD2 expression levels in tumor samples were accessed by Western blot analysis and quantitative polymerase chain reaction (Q-PCR). As a model system we have used gastric adenocarcinoma сell line AGS sublines constitutively transfected by pcDNA3.1 coding PKD1 or PKD2, or empty pcDNA3.1 vector. These cell lines were analyzed by Western blot, Q-PCR, MTT and proliferation assays, in vitro scratch and Transwell assays, clonogenic assay. Results: It was found that primary gastric tumors possess different levels of PKD1 and PKD2 expression on mRNA and protein levels. Low level of PKD1 expression on protein and mRNA level was detected in low differentiated adenocarcinoma and ring cell gastric cancer — disorders with poor clinical prognosis. The high level of PKD2 expression was also found in gastric tumors with poor prognosis: low differentiated adenocarcinoma and adenogen cancer. To find out whether differential expression of PKD1 and PKD2 could affect biology of gastric tumor cells in vitro, we used a model system based on AGS cell line that constitutively expressed PKD1 or overexpressed PKD2. PKD1 transfection led to the inhibition of cell proliferation, migration and colony formation, in the meanwhile, the PKD2 overexpression enhanced proliferation, migration and colony formation capacities of AGS cells. Conclusions: Our data suggest that both downregulation of PKD1 or upregulation of PKD2 expression may determine the behavior of gastric tumor cells, which promotes invasive phenotype and could result in general poor prognosis. |
| format |
Article |
| author |
Shabelnik, M.Yu. Kovalevska, L.M. Yurchenko, M.Y. Shlapatska, L.M. Rzepetsky, Yu. Sidorenko, S.P. |
| author_facet |
Shabelnik, M.Yu. Kovalevska, L.M. Yurchenko, M.Y. Shlapatska, L.M. Rzepetsky, Yu. Sidorenko, S.P. |
| author_sort |
Shabelnik, M.Yu. |
| title |
Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system |
| title_short |
Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system |
| title_full |
Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system |
| title_fullStr |
Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system |
| title_full_unstemmed |
Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system |
| title_sort |
differential expression of pkd1 and pkd2 in gastric cancer and analysis of pkd1 and pkd2 function in the model system |
| publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| publishDate |
2011 |
| topic_facet |
Original contributions |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/138681 |
| citation_txt |
Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system / M.Yu. Shabelnik, L.M. Kovalevska, M.Y. Yurchenko, L.M. Shlapatska, Yu. Rzepetsky, S.P. Sidorenko // Experimental Oncology. — 2011. — Т. 33, № 4. — С. 206-211. — Бібліогр.: 20 назв. — англ. |
| series |
Experimental Oncology |
| work_keys_str_mv |
AT shabelnikmyu differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem AT kovalevskalm differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem AT yurchenkomy differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem AT shlapatskalm differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem AT rzepetskyyu differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem AT sidorenkosp differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem |
| first_indexed |
2025-07-10T06:21:19Z |
| last_indexed |
2025-07-10T06:21:19Z |
| _version_ |
1837239879420870656 |
| fulltext |
206 Experimental Oncology 33, 206–211, 2011 (December)
DIFFERENTIAL EXPRESSION OF PKD1 AND PKD2 IN GASTRIC
CANCER AND ANALYSIS OF PKD1 AND PKD2 FUNCTION
IN THE MODEL SYSTEM
M.Yu. Shabelnik1, L.M. Kovalevska1, M.Y. Yurchenko1, L.M. Shlapatska1, Yu. Rzepetsky2, S.P. Sidorenko1*
1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NASU, Kiev 03022, Ukraine
2Cell Signaling Department, Institute of Cell Biology, NASU, Lviv 79005, Ukraine
Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and
PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological
variants of primary gastric cancer were analyzed. PKD1 and PKD2 expression levels in tumor samples were accessed by Western
blot analysis and quantitative polymerase chain reaction (Q-PCR). As a model system we have used gastric adenocarcinoma сell
line AGS sublines constitutively transfected by pcDNA3.1 coding PKD1 or PKD2, or empty pcDNA3.1 vector. These cell lines
were analyzed by Western blot, Q-PCR, MTT and proliferation assays, in vitro scratch and Transwell assays, clonogenic assay.
Results: It was found that primary gastric tumors possess different levels of PKD1 and PKD2 expression on mRNA and protein
levels. Low level of PKD1 expression on protein and mRNA level was detected in low differentiated adenocarcinoma and ring cell
gastric cancer — disorders with poor clinical prognosis. The high level of PKD2 expression was also found in gastric tumors with
poor prognosis: low differentiated adenocarcinoma and adenogen cancer. To find out whether differential expression of PKD1 and
PKD2 could affect biology of gastric tumor cells in vitro, we used a model system based on AGS cell line that constitutively expressed
PKD1 or overexpressed PKD2. PKD1 transfection led to the inhibition of cell proliferation, migration and colony formation, in the
meanwhile, the PKD2 overexpression enhanced proliferation, migration and colony formation capacities of AGS cells. Conclusions:
Our data suggest that both downregulation of PKD1 or upregulation of PKD2 expression may determine the behavior of gastric
tumor cells, which promotes invasive phenotype and could result in general poor prognosis.
Key Words: PKD1, PKD2, levels of expression, gastric cancer, cell proliferation, cell migration.
Kinases of protein kinase D (PKD) family are ex-
pressed ubiquitously in different human tissues. PKDs
could be activated by growth factors, antigen stimula-
tion and oxidative stress, the processes that usually are
observed during tumor progression [1]. PKDs regulate
cell-cell contacts by affecting cell adhesion [2, 3].
These kinases are involved in the regulation of cell
proliferation and apoptosis and also participate in epi-
genetic regulation of gene expression. The presence
of the nuclear translocation signal peptide may allow
PKD translocation to the nucleus and phosphorylation
of its nuclear targets, such as transcription factor NF-
kB, histone deacetylases and histone chaperone SET
[4–6]. Depending on PKD localization site, this kinase
can be implicated in the regulation of a variety of cel-
lular and subcellular processes, such as Golgi function
and organization, receptor signalling, apoptotic or an-
tiapoptotic signalling, tumor cell invasion. PKD family
of protein kinases can be involved in the regulation
of tumor cells survival [7–9]. Nevertheless, the role
of different PKD isoforms in these processes in normal
and malignant cells is not fully clarified. Recently the
differential expression of PKD genes was found in pri-
mary tumors of different histogenesis: gastric cancer,
breast cancer, prostate cancer, lymphoproliferative
disorders [2, 10–13]. Thus, the studies of differen-
tial expression and activity of PKD1 and PKD2 in the
context of tumor invasiveness and prognosis could
be of interest for translational research in oncology.
MATERIALS AND METHODS
The protein levels of PKD1 and PKD2 were evalu-
ated in 38 primary tumor samples and surrounding
tissues from various histological variants of gastric
cancer that are characterized by different prognosis.
Samples have been received from the patients cured
in Kyiv City Oncological Hospital (Kyiv, Ukraine), and
written consent was obtained from each patient
before enrolling into the study. The study was ap-
proved by Ethical Committee of R.E.Kavetsky Institute
of Experimental Pathology, Oncology and Radiobi-
ology, NAS of Ukraine. To access the protein level
of PKD1/2 we used Western blot analysis [13]. For
Western blot analysis we used anti-PKCμ rabbit anti-
body that detects both PKD1 and PKD2 (Clone D-20,
Santa Cruz, USA) and anti-actin rabbit antibody (Santa
Cruz, USA), secondary goat anti-rabbit antibody con-
jugated with peroxidase (Santa Cruz, USA).
mRNA level of PKD1 and PKD2 kinases was evalu-
ated for 28 tumor samples of gastric cancer by quanti-
tative polymerase chain reaction (Q-PCR). For Q-PCR
analysis we used Applied Biosystems 7500 System
SDS (USA). RNA from gastric tissue samples was
isolated using Tri Reagent (Sigma, USA). RNA were re-
verse transcribed using an M-MLV Reverse Transcrip-
tase and Ribonuclease Inhibitor RNaseOUTTM (Invit-
Received: July 26, 2011.
*Correspondence: Fax: +380442581656;
E-mail: svitasyd@yahoo.com;
svetasid@onconet.kiev.ua
Abbreviations used: MTT — 3-(4,5-Dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide; NF-kB — nuclear factor kB; PKC —
protein kinase C; PKD — protein kinase D; Q-PCR — quantitative
polymerase chain reaction.
Exp Oncol 2011
33, 4, 206–211
ORIGINAL CONTRIBUTIONS
Experimental Oncology 33, 206–211, 2011 (December)33, 206–211, 2011 (December) (December) 207
rogen, USA) and oligo(dT)18 primer (Fermentas, USA).
Genetic changes and expression level were analyzed
by Q-PCR with SYBR Green (Fermentas, USA). Gene
expression ratios were normalized using a housekeep-
ing gene β2-microglobulin. Following primers were used
for PKD1: forward — AATGAATGAGGAGGGTAGGG,
reverse — GCTAGGTGCATTGTCTTGAG; for PKD2:
forward — TGTGTCCCATTGGTGTTGTC, reverse —
TTTTATTCCCTACCCTCCTC; for β2-microglobulin: for-
ward — CCGTGTGAACCATGTGACTTTGTC, reverse —
TGCGGCATCTTCAAACCTCCATGATG. Relative quan-
tification of the obtained results was performed using
2-∆∆Ct method [14]. Gene expression ratios for tumor
samples were compared with PKD1 and PKD2 mRNA
expression level in the signet-ring cell gastric carci-
noma sample, which was chosen because of the lowest
PKD1 and PKD2 expression levels among all analyzed
gastric tumor samples. Gene expression ratios for trans-
fected cells were compared with parental cell line AGS.
For in vitro studies the gastric adenocarcinoma
cell line AGS was used. Cells were cultivated in IMDM
media (Sigma, USA) supplemented with 10% of fetal
bovine serum (Sigma, USA) and antibiotics. AGS cells
were transfected with following plasmids: pcDNA3.1,
pcDNA3.1-PKD1 or pcDNA3.1-FLAG-PKD2. We used
standard protocol of Ca-phosphate transfection
followed by clone selection on G418 (0.6 mg/ml).
After selection on G418 for 14 days, transfected cells
were cloned and sublines that constitutively express
PKD1 and PKD2 were obtained: AGS-PKD1, AGS-
PKD2 and AGS-pcDNA3.1.
To explore the characteristics of AGS transfectants
we have used an array of standard in vitro assays, includ-
ing dye exclusion method with 0.4% trypan blue, MTT
assay (colorimetric assay with 3-(4,5 Dimethylthiazol-
2-yl)-2,5-diphenyltetrazolium bromide), cell migration
scratch assay, Transwell and clonogenic assays [15–18].
The results of biological assays represent the
mean + s.d. derived from at least three different ex-
periments. Statistical significance of differences was
evaluated by Student’s t-test.
RESULTS AND DISCUSSION
In current study we have explored PKD1 and PKD2 ex-
pression on protein and mRNA levels in primary gastric
cancer samples. To confirm our preliminary data on dif-
ferential level of PKD1/2 expression in gastric tumors
tissues shown by immunohistochemistry [13], we have
performed Western blot analysis and Q-PCR. Western
blot analysis has shown both PKD1 (120 kDa) and
PKD2 (105 kDa) expression in the majority of tumor sam-
ples. It should be noted that the low level of PKD1 expres-
sion was detected in low differentiated adenocarcinoma
and signet-ring cell gastric cancer (Fig. 1, tracks 1–3,
and data not shown). Altogether, in 6 out from 38 samples
(15.8%) the level of PKD1 expression was much lower
than PKD2. Moreover, in one case of adenogen cancer
PKD1 expression was not detected on protein level.
To study the expression of PKD1 and PKD2 on mRNA
level we applied Q-PCR analysis. In samples 2, 5, 7–9 of tu-
mors with poor prognosis, the level of PKD1 expression
was considerably low in comparison with other tumor
samples (Fig. 2). The highest level of PKD2 expression
was shown for adenogen tumor (Fig. 2, sample 6) and
low differentiated adenocarcinoma (Fig. 2, sample 2) that
also had poor prognosis. At the same time in gastric tis-
sues surrounding both low and moderately differentiated
adenocarcinomas (Fig. 2, samples 1 and 3) PKD1 and
PKD2 were expressed on higher levels than in correspond-
ing tumors (Fig. 2, samples 2 and 4). It should be noted
that in tumors with more favorable prognosis (moderately
differentiated adenocarcinoma, cardioesophageal can-
cer and gastric adenoma, Fig. 2, samples 4, 10 and 11,
respectively) the expression level of PKD1 mRNA was
higher than in other cases.
1 2 3 4 5 6 7 8
9 10 11 12 13 14 15 16
150 kDa —
100 kDa —
50 kDa —
37 kDa —
150 kDa —
100 kDa —
50 kDa —
37 kDa —
— PKD1
— PKD2
— actin
— PKD1
— PKD2
— actin
Fig. 1. Western blot analysis of cancer cells from different histo-
logical variants of primary gastric cancer. 1 — low differentiated
adenocarcinoma, 2 — normal gastric tissues surrounding low
differentiated adenocarcinoma, 3 — signet-ring cell gastric carci-
noma, 4 — adenogen tumor, 5, 6, — gastric adenoma, 7, 8 — non
differentiated cancer, 9, 13 — normal gastric tissues surrounding
moderately differentiated adenocarcinoma, 10, 12, 14 — moder-
ately differentiated adenocarcinoma, 11 — carcinoid, 15 — cells
lysate of НЕК293T-PKD2, 16 — cells lysate of НЕК293T-PKD1
0
100
200
300
400
500
600
700
800
900
1000
1100
1200
1 2 3 4 5 6 7 8 9 10 11
Samples
Fo
ld
o
f i
nc
re
as
e
The level of expression
of PKD1
The level of expression
of PKD2
Fig. 2. Results of the Q-PCR on mRNA from tumor samples
of different histological variants of primary gastric cancer. White
columns — PKD1 expression ratio, black — the PKD2 expression
ratio, both in comparison with PKD1 and PKD2 expression level
in the sample of signet-ring cell gastric cancer, which demonstrated
the lowest PKD1 and PKD2 expression levels. 1 — normal gastric
tissues at low differentiated adenocarcinoma, 2 — low differenti-
ated adenocarcinoma, 3 — normal gastric tissues at moderately
differentiated adenocarcinoma, 4 — moderately differentiated
adenocarcinoma, 5 — non differentiated gastric cancer, 6 — adeno-
gen tumor, 7 — adenogen tumor (with metastasis), 8 — carcinoid
cancer, 9 — signet-ring cell gastric cancer, 10 — cardioesophageal
gastric cancer, 11 — gastric adenoma, Data on PKD2 expression
level was normalized to expression of β2-microglobulin. *Exactly, the
value on the level of PKD2 expression in sample 6 is significantly larger
than the one shown in Fig.2 (sample 6: it is equal to 8012).
208 Experimental Oncology 33, 206–211, 2011 (December)
Thus, we demonstrated the differential expression
of PKD1 and PKD2 in various histological variants
of primary gastric cancer and surrounding tissues
on mRNA and protein levels.
PKD2 is the major serine/threonine protein ki-
nase of PKD family, which is expressed in human
gastric adenocarcinoma cell line AGS. In AGS cells
PKD2 is activated by gastrin and is a downstream
target of PKCs [19]. PKD1 was not detectable in these
cells on protein level (Fig. 3, a, track 4). To examine
the role of PKD1 and PKD2 protein kinases in regula-
tion of gastric tumor cell biology we developed a AGS
sublines expressing PKD1 or overexpressing PKD2.
The expression levels of protein kinases PKD1 and
PKD2 in constitutive transfectants was checked
by Western blot (Fig. 3, a) using antibody against hu-
man PKCμ (Clone D-20, Santa Cruz, USA), which rec-
ognizes both PKD1 and PKD2. In our study, AGS cells
were transfected with following plasmids: pcDNA3.1,
pcDNA3.1-PKD1 or pcDNA3.1-FLAG-PKD2. Since
FLAG peptide is about 7 kDa and PKD2 — 105 kDa the
molecular weight of transfected PKD2 was expected
to be 112 kDa (Fig. 3, a, tracks 1 and 2). PKD1 cDNA
in pcDNA3.1 vector resulted in 120 kDa protein expres-
sion (Fig. 3, a, track 5).
0
0,5
1
1,5
2
2,5
3
3,5
4
AGS AGS-PKD1 AGS-PKD2
clone 1
AGS-PKD2
clone 2
Cell sublines
Fo
ld
o
f i
nc
re
as
e
1 2 3 4 5
150 kDa —
100 kDa —
50 kDa —
37 kDa —
— PKD1
— PKD2
— actine
a
b
Fig. 3. The level of PKD1 and PKD2 expression in AGS sub-
lines. a. Western blot analysis of PKD1 and PKD2 expression
in cell lysates. 1, 2 — AGS-PKD2 (two different colonies with
over expression of protein kinase PKD2), 3 — AGS with empty
pcDNA3.1 plasmid (transfection control), 4 — AGS, 5 — AGS-
PKD1. Western blot of actin expression served as a loading
control (lower panel). b. Results of Q-PCR of PKD2 in AGS cell
line and transfectants AGS-PKD1 and AGS-PKD2. The results
of three independent experiments. Data on PKD2 expression
level was normalized to expression of β2-microglobulin
Also we have checked mRNA levels of PKD1 and
PKD2 in AGS-PKD1 and AGS-PKD2 sublines using
Q-PCR analysis (Fig. 3, b). There was a prominent
difference between the level of PKD2 mRNA in AGS-
PKD2 cells, which overexpress PKD2, when compared
with AGS wild type cells (see Fig. 3, b). One of the
clones tested expressed twice more of PKD2 coding
mRNA, and other clone had 3.6 times more PKD2 cod-
ing mRNA than parental AGS cell line, reflecting the
efficiency of transfection.
Also we have found that expression of PKD1 upon
transfection in AGS cell line lead to the significant
reduction of endogenous PKD2 mRNA and protein ex-
pression (see Fig. 3, b). Mechanisms and nature of this
phenomenon require further study, but now we have
shown in this study that expression of PKD1 kinase
could influence the level of PKD2 expression.
Using Western blot analysis we have selected two
sublines of each transfectants with different level of pro-
tein kinases PKD1 and PKD2 expression when com-
pared with parenteral AGS and AGS with empty plasmid
(AGS-pcDNA3.1). These sublines (AGS-PKD2 and
AGS-PKD1) were used to study the role of PKD1 and
PKD2 isoforms in regulation of gastric tumor cell bio-
logy. These cell sublines were used for morphological
study, comparative analysis in MTT and proliferation
assays, and also tests for cell migration and survival.
Morphological examination of the transfectants
AGS-PKD1 and AGS-PKD2 demonstrated that these
cells acquired morphological features different from
the parental AGS cells. AGS-PKD1 cells were of po-
lygonal shape, and increased in size in comparison
with sublines with constitutive expression of PKD2,
AGS-pcDNA3.1 and parental AGS cells (Fig. 4, a).
It was observed that colonies of AGS-PKD1 cells had
sufficiently more compact edge (Fig. 4, b), while colo-
nies of transfectant cells with constitutive expression
of AGS-PKD2 had irregular edge. Moreover, AGS-
PKD2 cells were round-shaped (Fig. 4, c).
a b c
Fig. 4. The morphological differences of AGS sublines. a — con-
trol cell line AGS, b — transfectant AGS-PKD1, c — transfectant
AGS-PKD2. x80
To explore the cell survival and proliferation
activity the transfected cells were stained with
0.4% trypan blue dye. Tested cells were cultured
in 24-well plates in IMDM medium in concentration
of 7х104 cell/ml/well in triplicates. After 24, 48 and
72 h of cultivation the number of alive and dead cells
was calculated. The transfection of AGS cell line with
PKD1 or PKD2 did not significantly affect the survival
of cells: the number of dead cells in each of the studied
sublines was the same within 72 h of cultivation (from
3.7% to 7.5%). At the same time we have revealed
the significant differences in the number of alive
cells for AGS-PKD1 and AGS-PKD2 sublines. After
24 h of cultivation the number of AGS-PKD2 cells
increased 4.6 times, while the number of control
AGS cells — only 2.5 times. At the same time the rate
of AGS-PKD1 subline proliferation was lower than
of control AGS and AGS-pcDNA3.1 cells (Fig. 5, a,
lower curve). The kinetics studies up to 72 hs showed
Experimental Oncology 33, 206–211, 2011 (December)33, 206–211, 2011 (December) (December) 209
even more prominent difference. Taken together,
AGS-PKD1 cell were characterized by slight inhibition
of cell proliferation and AGS-PKD2 — with strongly
enhanced proliferation rate, in comparison with AGS
and AGS-pcDNA3.1 sublines.
We also applied MTT assay to evaluate cell prolif-
eration activity of transfected cells. With this approach
we also observed the same difference between AGS-
PKD1 and AGS-PKD2 sublines and AGS parental cells
in 24 hs of cultivation (Fig. 5, b). As shown on Fig. 5,
b, AGS-PKD2 line had much higher proliferation
activity than AGS-PKD1. Thus, PKD1 expression led
to the inhibition of cell proliferation, and, in contrary,
PKD2 overexpression resulted in the enhancement
of cell proliferation.
40000
90000
140000
190000
240000
290000
0 24 48 72
Time of incubation (hs)
Ce
ll
nu
m
be
r
AGS
AGS plasmid
AGS PKD1
AGS PKD2
--
-
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
5000 10000 15000 20000
Cell number
O
pt
ic
al
d
en
ci
ty
AGS
AGS pcDNA3.1
AGS PKD1
AGS PKD2
media
a
b
Fig. 5. Evaluation of proliferative activity of AGS, AGS-pcNDA3.1,
AGS-PKD1 and AGS-PKD2 sublines. a — kinetics of cell number
changes in cultures of AGS sublines. Results of three indepen-
dent experiments. b — MTT assay after 24 h of cultivation of AGS
sublines. Results of three independent experiments
Since it is known that PKD1 kinase is involved
in regulation of cell adhesion by phosphorylation
of β-catenin, integrins and cortaktin [20, 21], we car-
ried out in vitro scratch and Transwell assays in order
to access the migration properties of gastric cancer
cell sublines that express PKD1 or PKD2. In in vitro
scratch assay with cell cultures, expressing only
PKD2 (AGS, AGS-pcDNA3.1 and AGS-PKD2), the
migration of cells on the free surface of the plastic was
observed already after 4 h. At the same time, for AGS-
PKD1 cells, migration was not registered for the same
time period (Fig. 6, a). This trend was maintained for
12, 24 and 48 h of observation. Even after 48 h in cul-
ture the free surface area of the scratch was only
slightly decreased for AGS-PKD1 cells, while AGS-
PKD2 cells culture formed 100% confluent monolayer.
0
100
200
300
400
500
600
AGS AGS-pcDNA3.1 AGS-PKD1 AGS-PKD2
Cell subline
Nu
m
be
r o
f p
en
et
ra
te
d
ce
lls
a
b
c
A B
C D
Fig. 6. Evaluation of migration capacity of AGS cell sublines. a.
In vitro scratch assay. A — AGS cell line at once after applying stripes
(as control). B, C, D — all sublines after 24 h of incubation. B — AGS
cell line, C — AGS-PKD1, D — AGS-PKD2. x 40. The arrow shows
the initial size of scratch. (AGS-pcDNA3.1 — data not shown).
b. Transwell assay. The representative fields on membrane after
4 h of incubation. One of 5 evaluated fields for each cell subline.
x40. Staining with crystal violet, cells are shown in blue, A — AGS,
B — AGS-pcDNA3.1, C — AGS-PKD1, D — AGS-PKD2. c. Transwell
assay. The level of cell migration activity estimated as a number
of penetrated cells for 4 h in 5 microscopic fields at x40
210 Experimental Oncology 33, 206–211, 2011 (December)
Further performed Transwell assay revealed that
such behavior of transfectant cells could be explained
by the different migration capacity of AGS transfec-
tants. The AGS-PKD2 transfectants had the highest
level of migration activity. However, migration capacity
of AGS-PKD1 cells was twice lower then of AGS and
AGS-pcDNA3.1 control cells (Fig. 6, b, c).
To evaluate colony formation ability of AGS sub-
lines we have used clonogenic assay, which reflects
the potential tumorogenic capacity of cells. After two
weeks of cultivation AGS cells gave rise to 128 colo-
nies: 112 colonies with up to 20 cells/per colony and
16 colonies — more than 20 cells/per colony. In cul-
tures of AGS-PKD1 transfectant all 72 colonies were
less than 20 cells/colony. In the contrast, for AGS-
PKD2 transfectant we have detected 408 colonies
including 176 colonies with more than 20 cells/colony.
Numbers of colonies formed by control cultures
transfected with empty plasmid were close to parental
AGS line. Thus, PKD1 transfection decreases colony
formation capacity of AGS, while PKD2 overexpres-
sion dramatically enhances colony formation (Fig. 7).
0
50
100
150
200
250
300
350
400
450
500
AGS AGS-pcDNA3.1 AGS-PKD1 AGS-PKD2
Cell subline
Nu
m
be
r o
f c
ol
on
ie
s
pe
r p
la
te
Fig. 7. Clonogenic capacity of AGS sublines. Colony formation
assay in soft agar. White columns — number of colonies with
up to 20 cells, grey — number of colonies with more than 20 cells,
black — all colonies. Results of three independent experiments
Our study provided new evidences of PKD1 and
PKD2 differential expression in gastric cancer cells and
their distinct roles in regulation of tumor cell biology.
We have demonstrated that primary gastric tumors
possess different levels of PKD1 and PKD2 expression
on mRNA and protein levels that greatly complement
the data on PKD1 mRNA expression previously obtained
by Kim et al. [11]. We also found that low PKD1 expression
levels (both on mRNA and protein level) are the feature
of particular histological variants of gastric cancer: sig-
net-ring cell gastric carcinoma, undifferentiated gastric
cancer, carcinoid and adenogen tumor with metastasis.
To find the potential biological consequences
of differential PKD1 and PKD2 expression in gastric
cancer cells we have created experimental system based
on AGS cells line. We have shown that the expression
of PKD1 upon transfection in AGS cell line lead to the
significant reduction of endogenous PKD2 mRNA ex-
pression. Various tests were performed, including MTT
and proliferation assays, in vitro scratch, Transwell and
clonogenic assays, which revealed clear difference
in morphological features, proliferation, migration and
colony formation of sublines overexpressing PKD2 or ex-
pressing PKD1. Overall, PKD1 transfection led to the
inhibition of cell proliferation, migration and colony
formation. Meanwhile, PKD2 overexpression enhanced
cell proliferation, cellular migration and colony formation
capacities. Thus, our data clearly show that both down-
regulation of PKD1 or upregulation of PKD2 expression
may determine the behavior of tumor cells that resulted
in invasive phenotype and in general poor prognosis.
Since differential expression of PKD1 and PKD2 pro-
tein kinases affects biological features of malignant
cells in experimental system in vitro, heterogeneity
in PKD1 and PKD2 expression of primary gastric tumor
samples may influence the proliferative activity and
migration capacity of tumor cells in vivo. Therefore, the
studies of differential expression and activity of PKD1 and
PKD2 in the context of tumor manifestation and prog-
nosis of the disease could be the perspective subject
of translational research in oncology. This will contribute
to the development of new approaches to differential
diagnostics of tumor and target therapy, and also reveal
prognostic factors for the prediction of clinical outcome.
ACKNOWLEGMENTS
This study has been supported by the Ukrai-
nian Governmental Grants: 0110U005757 and
0110U006647. We thank to Prof. J. Van Lint (Belgium)
and Prof. T. Seufferlein (Germany) for kind gifts
of PKD1 and PKD2 constructs.
REFERENCES
1. Pan JS, Hong MZ, Ren JL. Reactive oxygen spe-
cies: a double-edged sword in oncogenesis. World J Gastro-
enterol 2009; 15: 1702-07.
2. Eiseler T, Dőppler H, Yan IK, et al. Protein kinase
D1 regulates matrix metalloproteinase expression and inhibits
breast cancer cell invasion. Brest cancer research 2009; 11: R13.
3. Yamamoto H, Oue N, Sato A, et al. Wnt5a signaling
is involved in the aggressiveness of prostate cancer and ex-
pression of metalloproteinase. Oncogene 2010; 29: 2036–46.
4. Akimoto T, Li P, Yan Z. Functional interaction of regula-
tory factors with the Pgc-1alpha promoter in response to exercise
by in vivo imaging. Am J Physiol Cell Physiol 2008; 295: C288–92.
5. McEneaney V, Dooley R, Harvey BJ, Thomas W. Pro-
tein kinase D stabilizes aldosterone-induced ERK1/2 MAP
kinase activation in M1 renal cortical collecting duct cells
to promote cell proliferation. Steroid Biochem Mol Biol 2009;
118: 18–28.
6. Wang S, Li X, Parra M, et al. Control of endothelial
cell proliferation and migration by VEGF signaling to histone
deacetylase. Proc Natl Acad Sci USA 2008; 105: 7738–43.
7. Rykx A, De Kimpe L, Mikhalap S, et al. Protein kinase
D: а family affair. FEBS letters 2003; 546: 81–6.
8. Van Lint J, Rykх A, Maeda Y. Protein kinase D: intra-
cellular traffic regulator on the move. Trends Cell Biol 2002;
12: 193–200.
9. Azoitei N, Kleger A, Schoo N, et al. Protein kinase
D2 is a novel regulator of glioblastoma growth and tumor
formation. Neuro Oncol 2011; 13: 710–24.
10. Jaggi M, Rao PS, Smith DJ, et al. Protein kinase
C l is down-regulated in androgen-independent prostate cancer.
Biochem and Biophys Research Comm 2003; 307: 254–60.
11. Kim M, Jang HR, Kim JH, et al. Epigenetic inac-
tivation of protein kinаse D1 in gastric cancer and its role
Experimental Oncology 33, 206–211, 2011 (December)33, 206–211, 2011 (December) (December) 211
in gastric cancer cell migration and invasion. Carcinogenesis
2008; 29: 629–37.
12. Kovalevska LM, Yurchenko OV, Shlapatska LM, et al.
Immunohistochemical studies of protein kinase D (PKD)
2 expression in malignant human lymphomas. Exp Oncol
2006; 28: 225–30.
13. Shabelnik MY, Tarasova TA, Merencev SV, et al. The
level of expression and autophosphorylation of protein kinase
D1 and D2 in gastric adenocarcinoma of different level of dif-
ferentiation. Oncology 2008; 10: 393–9 (in Ukrainian).
14. Logan J, Edwards K, Saunders N. Real-Time
PCR: current technology and applications. Caister Academic
Press 2009. ISBN 978-1-904455-39-4.
15. Mosmann T. Rapid colorimetric assay for cellular
growth and survival: application to proliferation and cytotoxic-
ity assays. J Immunol Methods 1983; 65: 55–63.
16. Liang C, Park AY, Guan J-L. In vitro scratch as-
say: a convenient and inexpensive method for analysis of cell
migration in vitro. Nature Protocols 2007; 2: 329–33.
17. Reckless J, Grainger DJ. Identification of oligopeptide
sequences which inhibit migration induced by a wide range
of chemokines. Biochem J 1999; 340: 803–11
18. Cao J., Schulte J., Knight A., et al. Prdx1 inhibits
tumorigenesis via regulating PTEN/AKT activity EMBO
J 2009 May 20; 28: 1505–17.
19. Sturany S, van Lint J, Gilchrist A, et al. Mechanism
of activation of protein kinase D2 (PKD2) by the CCKB/
gastrin receptor. J Biol Chem 2002; 277: 29431–8.
20. Jaggi M, Rao PS, Smith DJ, et al. E-cadherin phos-
phorylation by protein kinase D1/protein kinase C{mu}
is associated with altered cellular aggregation and motility
in prostate cancer. Cancer Res 2005; 65: 483–92.
Copyright © Experimental Oncology, 2011
|