Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system

Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological variants of primary gastric cancer w...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Datum:2011
Hauptverfasser: Shabelnik, M.Yu., Kovalevska, L.M., Yurchenko, M.Y., Shlapatska, L.M., Rzepetsky, Yu., Sidorenko, S.P.
Format: Artikel
Sprache:English
Veröffentlicht: Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України 2011
Schriftenreihe:Experimental Oncology
Schlagworte:
Online Zugang:http://dspace.nbuv.gov.ua/handle/123456789/138681
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Zitieren:Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system / M.Yu. Shabelnik, L.M. Kovalevska, M.Y. Yurchenko, L.M. Shlapatska, Yu. Rzepetsky, S.P. Sidorenko // Experimental Oncology. — 2011. — Т. 33, № 4. — С. 206-211. — Бібліогр.: 20 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
id irk-123456789-138681
record_format dspace
spelling irk-123456789-1386812018-06-20T03:11:21Z Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system Shabelnik, M.Yu. Kovalevska, L.M. Yurchenko, M.Y. Shlapatska, L.M. Rzepetsky, Yu. Sidorenko, S.P. Original contributions Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological variants of primary gastric cancer were analyzed. PKD1 and PKD2 expression levels in tumor samples were accessed by Western blot analysis and quantitative polymerase chain reaction (Q-PCR). As a model system we have used gastric adenocarcinoma сell line AGS sublines constitutively transfected by pcDNA3.1 coding PKD1 or PKD2, or empty pcDNA3.1 vector. These cell lines were analyzed by Western blot, Q-PCR, MTT and proliferation assays, in vitro scratch and Transwell assays, clonogenic assay. Results: It was found that primary gastric tumors possess different levels of PKD1 and PKD2 expression on mRNA and protein levels. Low level of PKD1 expression on protein and mRNA level was detected in low differentiated adenocarcinoma and ring cell gastric cancer — disorders with poor clinical prognosis. The high level of PKD2 expression was also found in gastric tumors with poor prognosis: low differentiated adenocarcinoma and adenogen cancer. To find out whether differential expression of PKD1 and PKD2 could affect biology of gastric tumor cells in vitro, we used a model system based on AGS cell line that constitutively expressed PKD1 or overexpressed PKD2. PKD1 transfection led to the inhibition of cell proliferation, migration and colony formation, in the meanwhile, the PKD2 overexpression enhanced proliferation, migration and colony formation capacities of AGS cells. Conclusions: Our data suggest that both downregulation of PKD1 or upregulation of PKD2 expression may determine the behavior of gastric tumor cells, which promotes invasive phenotype and could result in general poor prognosis. 2011 Article Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system / M.Yu. Shabelnik, L.M. Kovalevska, M.Y. Yurchenko, L.M. Shlapatska, Yu. Rzepetsky, S.P. Sidorenko // Experimental Oncology. — 2011. — Т. 33, № 4. — С. 206-211. — Бібліогр.: 20 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/138681 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection DSpace DC
language English
topic Original contributions
Original contributions
spellingShingle Original contributions
Original contributions
Shabelnik, M.Yu.
Kovalevska, L.M.
Yurchenko, M.Y.
Shlapatska, L.M.
Rzepetsky, Yu.
Sidorenko, S.P.
Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system
Experimental Oncology
description Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological variants of primary gastric cancer were analyzed. PKD1 and PKD2 expression levels in tumor samples were accessed by Western blot analysis and quantitative polymerase chain reaction (Q-PCR). As a model system we have used gastric adenocarcinoma сell line AGS sublines constitutively transfected by pcDNA3.1 coding PKD1 or PKD2, or empty pcDNA3.1 vector. These cell lines were analyzed by Western blot, Q-PCR, MTT and proliferation assays, in vitro scratch and Transwell assays, clonogenic assay. Results: It was found that primary gastric tumors possess different levels of PKD1 and PKD2 expression on mRNA and protein levels. Low level of PKD1 expression on protein and mRNA level was detected in low differentiated adenocarcinoma and ring cell gastric cancer — disorders with poor clinical prognosis. The high level of PKD2 expression was also found in gastric tumors with poor prognosis: low differentiated adenocarcinoma and adenogen cancer. To find out whether differential expression of PKD1 and PKD2 could affect biology of gastric tumor cells in vitro, we used a model system based on AGS cell line that constitutively expressed PKD1 or overexpressed PKD2. PKD1 transfection led to the inhibition of cell proliferation, migration and colony formation, in the meanwhile, the PKD2 overexpression enhanced proliferation, migration and colony formation capacities of AGS cells. Conclusions: Our data suggest that both downregulation of PKD1 or upregulation of PKD2 expression may determine the behavior of gastric tumor cells, which promotes invasive phenotype and could result in general poor prognosis.
format Article
author Shabelnik, M.Yu.
Kovalevska, L.M.
Yurchenko, M.Y.
Shlapatska, L.M.
Rzepetsky, Yu.
Sidorenko, S.P.
author_facet Shabelnik, M.Yu.
Kovalevska, L.M.
Yurchenko, M.Y.
Shlapatska, L.M.
Rzepetsky, Yu.
Sidorenko, S.P.
author_sort Shabelnik, M.Yu.
title Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system
title_short Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system
title_full Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system
title_fullStr Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system
title_full_unstemmed Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system
title_sort differential expression of pkd1 and pkd2 in gastric cancer and analysis of pkd1 and pkd2 function in the model system
publisher Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
publishDate 2011
topic_facet Original contributions
url http://dspace.nbuv.gov.ua/handle/123456789/138681
citation_txt Differential expression of PKD1 and PKD2 in gastric cancer and analysis of PKD1 and PKD2 function in the model system / M.Yu. Shabelnik, L.M. Kovalevska, M.Y. Yurchenko, L.M. Shlapatska, Yu. Rzepetsky, S.P. Sidorenko // Experimental Oncology. — 2011. — Т. 33, № 4. — С. 206-211. — Бібліогр.: 20 назв. — англ.
series Experimental Oncology
work_keys_str_mv AT shabelnikmyu differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem
AT kovalevskalm differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem
AT yurchenkomy differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem
AT shlapatskalm differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem
AT rzepetskyyu differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem
AT sidorenkosp differentialexpressionofpkd1andpkd2ingastriccancerandanalysisofpkd1andpkd2functioninthemodelsystem
first_indexed 2025-07-10T06:21:19Z
last_indexed 2025-07-10T06:21:19Z
_version_ 1837239879420870656
fulltext 206 Experimental Oncology 33, 206–211, 2011 (December) DIFFERENTIAL EXPRESSION OF PKD1 AND PKD2 IN GASTRIC CANCER AND ANALYSIS OF PKD1 AND PKD2 FUNCTION IN THE MODEL SYSTEM M.Yu. Shabelnik1, L.M. Kovalevska1, M.Y. Yurchenko1, L.M. Shlapatska1, Yu. Rzepetsky2, S.P. Sidorenko1* 1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NASU, Kiev 03022, Ukraine 2Cell Signaling Department, Institute of Cell Biology, NASU, Lviv 79005, Ukraine Aim: To study the differential expression of PKD1 and PKD2 in primary gastric cancer samples and to examine the role of PKD1 and PKD2 protein kinases in regulation of gastric tumor cell biology in the model system. Methods: Tumor samples of different histological variants of primary gastric cancer were analyzed. PKD1 and PKD2 expression levels in tumor samples were accessed by Western blot analysis and quantitative polymerase chain reaction (Q-PCR). As a model system we have used gastric adenocarcinoma сell line AGS sublines constitutively transfected by pcDNA3.1 coding PKD1 or PKD2, or empty pcDNA3.1 vector. These cell lines were analyzed by Western blot, Q-PCR, MTT and proliferation assays, in vitro scratch and Transwell assays, clonogenic assay. Results: It was found that primary gastric tumors possess different levels of PKD1 and PKD2 expression on mRNA and protein levels. Low level of PKD1 expression on protein and mRNA level was detected in low differentiated adenocarcinoma and ring cell gastric cancer — disorders with poor clinical prognosis. The high level of PKD2 expression was also found in gastric tumors with poor prognosis: low differentiated adenocarcinoma and adenogen cancer. To find out whether differential expression of PKD1 and PKD2 could affect biology of gastric tumor cells in vitro, we used a model system based on AGS cell line that constitutively expressed PKD1 or overexpressed PKD2. PKD1 transfection led to the inhibition of cell proliferation, migration and colony formation, in the meanwhile, the PKD2 overexpression enhanced proliferation, migration and colony formation capacities of AGS cells. Conclusions: Our data suggest that both downregulation of PKD1 or upregulation of PKD2 expression may determine the behavior of gastric tumor cells, which promotes invasive phenotype and could result in general poor prognosis. Key Words: PKD1, PKD2, levels of expression, gastric cancer, cell proliferation, cell migration. Kinases of protein kinase D (PKD) family are ex- pressed ubiquitously in different human tissues. PKDs could be activated by growth factors, antigen stimula- tion and oxidative stress, the processes that usually are observed during tumor progression [1]. PKDs regulate cell-cell contacts by affecting cell adhesion [2, 3]. These kinases are involved in the regulation of cell proliferation and apoptosis and also participate in epi- genetic regulation of gene expression. The presence of the nuclear translocation signal peptide may allow PKD translocation to the nucleus and phosphorylation of its nuclear targets, such as transcription factor NF- kB, histone deacetylases and histone chaperone SET [4–6]. Depending on PKD localization site, this kinase can be implicated in the regulation of a variety of cel- lular and subcellular processes, such as Golgi function and organization, receptor signalling, apoptotic or an- tiapoptotic signalling, tumor cell invasion. PKD family of protein kinases can be involved in the regulation of tumor cells survival [7–9]. Nevertheless, the role of different PKD isoforms in these processes in normal and malignant cells is not fully clarified. Recently the differential expression of PKD genes was found in pri- mary tumors of different histogenesis: gastric cancer, breast cancer, prostate cancer, lymphoproliferative disorders [2, 10–13]. Thus, the studies of differen- tial expression and activity of PKD1 and PKD2 in the context of tumor invasiveness and prognosis could be of interest for translational research in oncology. MATERIALS AND METHODS The protein levels of PKD1 and PKD2 were evalu- ated in 38 primary tumor samples and surrounding tissues from various histological variants of gastric cancer that are characterized by different prognosis. Samples have been received from the patients cured in Kyiv City Oncological Hospital (Kyiv, Ukraine), and written consent was obtained from each patient before enrolling into the study. The study was ap- proved by Ethical Committee of R.E.Kavetsky Institute of Experimental Pathology, Oncology and Radiobi- ology, NAS of Ukraine. To access the protein level of PKD1/2 we used Western blot analysis [13]. For Western blot analysis we used anti-PKCμ rabbit anti- body that detects both PKD1 and PKD2 (Clone D-20, Santa Cruz, USA) and anti-actin rabbit antibody (Santa Cruz, USA), secondary goat anti-rabbit antibody con- jugated with peroxidase (Santa Cruz, USA). mRNA level of PKD1 and PKD2 kinases was evalu- ated for 28 tumor samples of gastric cancer by quanti- tative polymerase chain reaction (Q-PCR). For Q-PCR analysis we used Applied Biosystems 7500 System SDS (USA). RNA from gastric tissue samples was isolated using Tri Reagent (Sigma, USA). RNA were re- verse transcribed using an M-MLV Reverse Transcrip- tase and Ribonuclease Inhibitor RNaseOUTTM (Invit- Received: July 26, 2011. *Correspondence: Fax: +380442581656; E-mail: svitasyd@yahoo.com; svetasid@onconet.kiev.ua Abbreviations used: MTT — 3-(4,5-Dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide; NF-kB — nuclear factor kB; PKC — protein kinase C; PKD — protein kinase D; Q-PCR — quantitative polymerase chain reaction. Exp Oncol 2011 33, 4, 206–211 ORIGINAL CONTRIBUTIONS Experimental Oncology 33, 206–211, 2011 (December)33, 206–211, 2011 (December) (December) 207 rogen, USA) and oligo(dT)18 primer (Fermentas, USA). Genetic changes and expression level were analyzed by Q-PCR with SYBR Green (Fermentas, USA). Gene expression ratios were normalized using a housekeep- ing gene β2-microglobulin. Following primers were used for PKD1: forward — AATGAATGAGGAGGGTAGGG, reverse — GCTAGGTGCATTGTCTTGAG; for PKD2: forward — TGTGTCCCATTGGTGTTGTC, reverse — TTTTATTCCCTACCCTCCTC; for β2-microglobulin: for- ward — CCGTGTGAACCATGTGACTTTGTC, reverse — TGCGGCATCTTCAAACCTCCATGATG. Relative quan- tification of the obtained results was performed using 2-∆∆Ct method [14]. Gene expression ratios for tumor samples were compared with PKD1 and PKD2 mRNA expression level in the signet-ring cell gastric carci- noma sample, which was chosen because of the lowest PKD1 and PKD2 expression levels among all analyzed gastric tumor samples. Gene expression ratios for trans- fected cells were compared with parental cell line AGS. For in vitro studies the gastric adenocarcinoma cell line AGS was used. Cells were cultivated in IMDM media (Sigma, USA) supplemented with 10% of fetal bovine serum (Sigma, USA) and antibiotics. AGS cells were transfected with following plasmids: pcDNA3.1, pcDNA3.1-PKD1 or pcDNA3.1-FLAG-PKD2. We used standard protocol of Ca-phosphate transfection followed by clone selection on G418 (0.6 mg/ml). After selection on G418 for 14 days, transfected cells were cloned and sublines that constitutively express PKD1 and PKD2 were obtained: AGS-PKD1, AGS- PKD2 and AGS-pcDNA3.1. To explore the characteristics of AGS transfectants we have used an array of standard in vitro assays, includ- ing dye exclusion method with 0.4% trypan blue, MTT assay (colorimetric assay with 3-(4,5 Dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide), cell migration scratch assay, Transwell and clonogenic assays [15–18]. The results of biological assays represent the mean + s.d. derived from at least three different ex- periments. Statistical significance of differences was evaluated by Student’s t-test. RESULTS AND DISCUSSION In current study we have explored PKD1 and PKD2 ex- pression on protein and mRNA levels in primary gastric cancer samples. To confirm our preliminary data on dif- ferential level of PKD1/2 expression in gastric tumors tissues shown by immunohistochemistry [13], we have performed Western blot analysis and Q-PCR. Western blot analysis has shown both PKD1 (120 kDa) and PKD2 (105 kDa) expression in the majority of tumor sam- ples. It should be noted that the low level of PKD1 expres- sion was detected in low differentiated adenocarcinoma and signet-ring cell gastric cancer (Fig. 1, tracks 1–3, and data not shown). Altogether, in 6 out from 38 samples (15.8%) the level of PKD1 expression was much lower than PKD2. Moreover, in one case of adenogen cancer PKD1 expression was not detected on protein level. To study the expression of PKD1 and PKD2 on mRNA level we applied Q-PCR analysis. In samples 2, 5, 7–9 of tu- mors with poor prognosis, the level of PKD1 expression was considerably low in comparison with other tumor samples (Fig. 2). The highest level of PKD2 expression was shown for adenogen tumor (Fig. 2, sample 6) and low differentiated adenocarcinoma (Fig. 2, sample 2) that also had poor prognosis. At the same time in gastric tis- sues surrounding both low and moderately differentiated adenocarcinomas (Fig. 2, samples 1 and 3) PKD1 and PKD2 were expressed on higher levels than in correspond- ing tumors (Fig. 2, samples 2 and 4). It should be noted that in tumors with more favorable prognosis (moderately differentiated adenocarcinoma, cardioesophageal can- cer and gastric adenoma, Fig. 2, samples 4, 10 and 11, respectively) the expression level of PKD1 mRNA was higher than in other cases. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 150 kDa — 100 kDa — 50 kDa — 37 kDa — 150 kDa — 100 kDa — 50 kDa — 37 kDa — — PKD1 — PKD2 — actin — PKD1 — PKD2 — actin Fig. 1. Western blot analysis of cancer cells from different histo- logical variants of primary gastric cancer. 1 — low differentiated adenocarcinoma, 2 — normal gastric tissues surrounding low differentiated adenocarcinoma, 3 — signet-ring cell gastric carci- noma, 4 — adenogen tumor, 5, 6, — gastric adenoma, 7, 8 — non differentiated cancer, 9, 13 — normal gastric tissues surrounding moderately differentiated adenocarcinoma, 10, 12, 14 — moder- ately differentiated adenocarcinoma, 11 — carcinoid, 15 — cells lysate of НЕК293T-PKD2, 16 — cells lysate of НЕК293T-PKD1 0 100 200 300 400 500 600 700 800 900 1000 1100 1200 1 2 3 4 5 6 7 8 9 10 11 Samples Fo ld o f i nc re as e The level of expression of PKD1 The level of expression of PKD2 Fig. 2. Results of the Q-PCR on mRNA from tumor samples of different histological variants of primary gastric cancer. White columns — PKD1 expression ratio, black — the PKD2 expression ratio, both in comparison with PKD1 and PKD2 expression level in the sample of signet-ring cell gastric cancer, which demonstrated the lowest PKD1 and PKD2 expression levels. 1 — normal gastric tissues at low differentiated adenocarcinoma, 2 — low differenti- ated adenocarcinoma, 3 — normal gastric tissues at moderately differentiated adenocarcinoma, 4 — moderately differentiated adenocarcinoma, 5 — non differentiated gastric cancer, 6 — adeno- gen tumor, 7 — adenogen tumor (with metastasis), 8 — carcinoid cancer, 9 — signet-ring cell gastric cancer, 10 — cardioesophageal gastric cancer, 11 — gastric adenoma, Data on PKD2 expression level was normalized to expression of β2-microglobulin. *Exactly, the value on the level of PKD2 expression in sample 6 is significantly larger than the one shown in Fig.2 (sample 6: it is equal to 8012). 208 Experimental Oncology 33, 206–211, 2011 (December) Thus, we demonstrated the differential expression of PKD1 and PKD2 in various histological variants of primary gastric cancer and surrounding tissues on mRNA and protein levels. PKD2 is the major serine/threonine protein ki- nase of PKD family, which is expressed in human gastric adenocarcinoma cell line AGS. In AGS cells PKD2 is activated by gastrin and is a downstream target of PKCs [19]. PKD1 was not detectable in these cells on protein level (Fig. 3, a, track 4). To examine the role of PKD1 and PKD2 protein kinases in regula- tion of gastric tumor cell biology we developed a AGS sublines expressing PKD1 or overexpressing PKD2. The expression levels of protein kinases PKD1 and PKD2 in constitutive transfectants was checked by Western blot (Fig. 3, a) using antibody against hu- man PKCμ (Clone D-20, Santa Cruz, USA), which rec- ognizes both PKD1 and PKD2. In our study, AGS cells were transfected with following plasmids: pcDNA3.1, pcDNA3.1-PKD1 or pcDNA3.1-FLAG-PKD2. Since FLAG peptide is about 7 kDa and PKD2 — 105 kDa the molecular weight of transfected PKD2 was expected to be 112 kDa (Fig. 3, a, tracks 1 and 2). PKD1 cDNA in pcDNA3.1 vector resulted in 120 kDa protein expres- sion (Fig. 3, a, track 5). 0 0,5 1 1,5 2 2,5 3 3,5 4 AGS AGS-PKD1 AGS-PKD2 clone 1 AGS-PKD2 clone 2 Cell sublines Fo ld o f i nc re as e 1 2 3 4 5 150 kDa — 100 kDa — 50 kDa — 37 kDa — — PKD1 — PKD2 — actine a b Fig. 3. The level of PKD1 and PKD2 expression in AGS sub- lines. a. Western blot analysis of PKD1 and PKD2 expression in cell lysates. 1, 2 — AGS-PKD2 (two different colonies with over expression of protein kinase PKD2), 3 — AGS with empty pcDNA3.1 plasmid (transfection control), 4 — AGS, 5 — AGS- PKD1. Western blot of actin expression served as a loading control (lower panel). b. Results of Q-PCR of PKD2 in AGS cell line and transfectants AGS-PKD1 and AGS-PKD2. The results of three independent experiments. Data on PKD2 expression level was normalized to expression of β2-microglobulin Also we have checked mRNA levels of PKD1 and PKD2 in AGS-PKD1 and AGS-PKD2 sublines using Q-PCR analysis (Fig. 3, b). There was a prominent difference between the level of PKD2 mRNA in AGS- PKD2 cells, which overexpress PKD2, when compared with AGS wild type cells (see Fig. 3, b). One of the clones tested expressed twice more of PKD2 coding mRNA, and other clone had 3.6 times more PKD2 cod- ing mRNA than parental AGS cell line, reflecting the efficiency of transfection. Also we have found that expression of PKD1 upon transfection in AGS cell line lead to the significant reduction of endogenous PKD2 mRNA and protein ex- pression (see Fig. 3, b). Mechanisms and nature of this phenomenon require further study, but now we have shown in this study that expression of PKD1 kinase could influence the level of PKD2 expression. Using Western blot analysis we have selected two sublines of each transfectants with different level of pro- tein kinases PKD1 and PKD2 expression when com- pared with parenteral AGS and AGS with empty plasmid (AGS-pcDNA3.1). These sublines (AGS-PKD2 and AGS-PKD1) were used to study the role of PKD1 and PKD2 isoforms in regulation of gastric tumor cell bio- logy. These cell sublines were used for morphological study, comparative analysis in MTT and proliferation assays, and also tests for cell migration and survival. Morphological examination of the transfectants AGS-PKD1 and AGS-PKD2 demonstrated that these cells acquired morphological features different from the parental AGS cells. AGS-PKD1 cells were of po- lygonal shape, and increased in size in comparison with sublines with constitutive expression of PKD2, AGS-pcDNA3.1 and parental AGS cells (Fig. 4, a). It was observed that colonies of AGS-PKD1 cells had sufficiently more compact edge (Fig. 4, b), while colo- nies of transfectant cells with constitutive expression of AGS-PKD2 had irregular edge. Moreover, AGS- PKD2 cells were round-shaped (Fig. 4, c). a b c Fig. 4. The morphological differences of AGS sublines. a — con- trol cell line AGS, b — transfectant AGS-PKD1, c — transfectant AGS-PKD2. x80 To explore the cell survival and proliferation activity the transfected cells were stained with 0.4% trypan blue dye. Tested cells were cultured in 24-well plates in IMDM medium in concentration of 7х104 cell/ml/well in triplicates. After 24, 48 and 72 h of cultivation the number of alive and dead cells was calculated. The transfection of AGS cell line with PKD1 or PKD2 did not significantly affect the survival of cells: the number of dead cells in each of the studied sublines was the same within 72 h of cultivation (from 3.7% to 7.5%). At the same time we have revealed the significant differences in the number of alive cells for AGS-PKD1 and AGS-PKD2 sublines. After 24 h of cultivation the number of AGS-PKD2 cells increased 4.6 times, while the number of control AGS cells — only 2.5 times. At the same time the rate of AGS-PKD1 subline proliferation was lower than of control AGS and AGS-pcDNA3.1 cells (Fig. 5, a, lower curve). The kinetics studies up to 72 hs showed Experimental Oncology 33, 206–211, 2011 (December)33, 206–211, 2011 (December) (December) 209 even more prominent difference. Taken together, AGS-PKD1 cell were characterized by slight inhibition of cell proliferation and AGS-PKD2 — with strongly enhanced proliferation rate, in comparison with AGS and AGS-pcDNA3.1 sublines. We also applied MTT assay to evaluate cell prolif- eration activity of transfected cells. With this approach we also observed the same difference between AGS- PKD1 and AGS-PKD2 sublines and AGS parental cells in 24 hs of cultivation (Fig. 5, b). As shown on Fig. 5, b, AGS-PKD2 line had much higher proliferation activity than AGS-PKD1. Thus, PKD1 expression led to the inhibition of cell proliferation, and, in contrary, PKD2 overexpression resulted in the enhancement of cell proliferation. 40000 90000 140000 190000 240000 290000 0 24 48 72 Time of incubation (hs) Ce ll nu m be r AGS AGS plasmid AGS PKD1 AGS PKD2 -- - 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 5000 10000 15000 20000 Cell number O pt ic al d en ci ty AGS AGS pcDNA3.1 AGS PKD1 AGS PKD2 media a b Fig. 5. Evaluation of proliferative activity of AGS, AGS-pcNDA3.1, AGS-PKD1 and AGS-PKD2 sublines. a — kinetics of cell number changes in cultures of AGS sublines. Results of three indepen- dent experiments. b — MTT assay after 24 h of cultivation of AGS sublines. Results of three independent experiments Since it is known that PKD1 kinase is involved in regulation of cell adhesion by phosphorylation of β-catenin, integrins and cortaktin [20, 21], we car- ried out in vitro scratch and Transwell assays in order to access the migration properties of gastric cancer cell sublines that express PKD1 or PKD2. In in vitro scratch assay with cell cultures, expressing only PKD2 (AGS, AGS-pcDNA3.1 and AGS-PKD2), the migration of cells on the free surface of the plastic was observed already after 4 h. At the same time, for AGS- PKD1 cells, migration was not registered for the same time period (Fig. 6, a). This trend was maintained for 12, 24 and 48 h of observation. Even after 48 h in cul- ture the free surface area of the scratch was only slightly decreased for AGS-PKD1 cells, while AGS- PKD2 cells culture formed 100% confluent monolayer. 0 100 200 300 400 500 600 AGS AGS-pcDNA3.1 AGS-PKD1 AGS-PKD2 Cell subline Nu m be r o f p en et ra te d ce lls a b c A B C D Fig. 6. Evaluation of migration capacity of AGS cell sublines. a. In vitro scratch assay. A — AGS cell line at once after applying stripes (as control). B, C, D — all sublines after 24 h of incubation. B — AGS cell line, C — AGS-PKD1, D — AGS-PKD2. x 40. The arrow shows the initial size of scratch. (AGS-pcDNA3.1 — data not shown). b. Transwell assay. The representative fields on membrane after 4 h of incubation. One of 5 evaluated fields for each cell subline. x40. Staining with crystal violet, cells are shown in blue, A — AGS, B — AGS-pcDNA3.1, C — AGS-PKD1, D — AGS-PKD2. c. Transwell assay. The level of cell migration activity estimated as a number of penetrated cells for 4 h in 5 microscopic fields at x40 210 Experimental Oncology 33, 206–211, 2011 (December) Further performed Transwell assay revealed that such behavior of transfectant cells could be explained by the different migration capacity of AGS transfec- tants. The AGS-PKD2 transfectants had the highest level of migration activity. However, migration capacity of AGS-PKD1 cells was twice lower then of AGS and AGS-pcDNA3.1 control cells (Fig. 6, b, c). To evaluate colony formation ability of AGS sub- lines we have used clonogenic assay, which reflects the potential tumorogenic capacity of cells. After two weeks of cultivation AGS cells gave rise to 128 colo- nies: 112 colonies with up to 20 cells/per colony and 16 colonies — more than 20 cells/per colony. In cul- tures of AGS-PKD1 transfectant all 72 colonies were less than 20 cells/colony. In the contrast, for AGS- PKD2 transfectant we have detected 408 colonies including 176 colonies with more than 20 cells/colony. Numbers of colonies formed by control cultures transfected with empty plasmid were close to parental AGS line. Thus, PKD1 transfection decreases colony formation capacity of AGS, while PKD2 overexpres- sion dramatically enhances colony formation (Fig. 7). 0 50 100 150 200 250 300 350 400 450 500 AGS AGS-pcDNA3.1 AGS-PKD1 AGS-PKD2 Cell subline Nu m be r o f c ol on ie s pe r p la te Fig. 7. Clonogenic capacity of AGS sublines. Colony formation assay in soft agar. White columns — number of colonies with up to 20 cells, grey — number of colonies with more than 20 cells, black — all colonies. Results of three independent experiments Our study provided new evidences of PKD1 and PKD2 differential expression in gastric cancer cells and their distinct roles in regulation of tumor cell biology. We have demonstrated that primary gastric tumors possess different levels of PKD1 and PKD2 expression on mRNA and protein levels that greatly complement the data on PKD1 mRNA expression previously obtained by Kim et al. [11]. We also found that low PKD1 expression levels (both on mRNA and protein level) are the feature of particular histological variants of gastric cancer: sig- net-ring cell gastric carcinoma, undifferentiated gastric cancer, carcinoid and adenogen tumor with metastasis. To find the potential biological consequences of differential PKD1 and PKD2 expression in gastric cancer cells we have created experimental system based on AGS cells line. We have shown that the expression of PKD1 upon transfection in AGS cell line lead to the significant reduction of endogenous PKD2 mRNA ex- pression. Various tests were performed, including MTT and proliferation assays, in vitro scratch, Transwell and clonogenic assays, which revealed clear difference in morphological features, proliferation, migration and colony formation of sublines overexpressing PKD2 or ex- pressing PKD1. Overall, PKD1 transfection led to the inhibition of cell proliferation, migration and colony formation. Meanwhile, PKD2 overexpression enhanced cell proliferation, cellular migration and colony formation capacities. Thus, our data clearly show that both down- regulation of PKD1 or upregulation of PKD2 expression may determine the behavior of tumor cells that resulted in invasive phenotype and in general poor prognosis. Since differential expression of PKD1 and PKD2 pro- tein kinases affects biological features of malignant cells in experimental system in vitro, heterogeneity in PKD1 and PKD2 expression of primary gastric tumor samples may influence the proliferative activity and migration capacity of tumor cells in vivo. Therefore, the studies of differential expression and activity of PKD1 and PKD2 in the context of tumor manifestation and prog- nosis of the disease could be the perspective subject of translational research in oncology. This will contribute to the development of new approaches to differential diagnostics of tumor and target therapy, and also reveal prognostic factors for the prediction of clinical outcome. ACKNOWLEGMENTS This study has been supported by the Ukrai- nian Governmental Grants: 0110U005757 and 0110U006647. We thank to Prof. J. Van Lint (Belgium) and Prof. T. Seufferlein (Germany) for kind gifts of PKD1 and PKD2 constructs. REFERENCES 1. Pan JS, Hong MZ, Ren JL. Reactive oxygen spe- cies: a double-edged sword in oncogenesis. World J Gastro- enterol 2009; 15: 1702-07. 2. Eiseler T, Dőppler H, Yan IK, et al. Protein kinase D1 regulates matrix metalloproteinase expression and inhibits breast cancer cell invasion. Brest cancer research 2009; 11: R13. 3. Yamamoto H, Oue N, Sato A, et al. Wnt5a signaling is involved in the aggressiveness of prostate cancer and ex- pression of metalloproteinase. Oncogene 2010; 29: 2036–46. 4. Akimoto T, Li P, Yan Z. Functional interaction of regula- tory factors with the Pgc-1alpha promoter in response to exercise by in vivo imaging. Am J Physiol Cell Physiol 2008; 295: C288–92. 5. McEneaney V, Dooley R, Harvey BJ, Thomas W. Pro- tein kinase D stabilizes aldosterone-induced ERK1/2 MAP kinase activation in M1 renal cortical collecting duct cells to promote cell proliferation. Steroid Biochem Mol Biol 2009; 118: 18–28. 6. Wang S, Li X, Parra M, et al. Control of endothelial cell proliferation and migration by VEGF signaling to histone deacetylase. Proc Natl Acad Sci USA 2008; 105: 7738–43. 7. Rykx A, De Kimpe L, Mikhalap S, et al. Protein kinase D: а family affair. FEBS letters 2003; 546: 81–6. 8. Van Lint J, Rykх A, Maeda Y. Protein kinase D: intra- cellular traffic regulator on the move. Trends Cell Biol 2002; 12: 193–200. 9. Azoitei N, Kleger A, Schoo N, et al. Protein kinase D2 is a novel regulator of glioblastoma growth and tumor formation. Neuro Oncol 2011; 13: 710–24. 10. Jaggi M, Rao PS, Smith DJ, et al. Protein kinase C l is down-regulated in androgen-independent prostate cancer. Biochem and Biophys Research Comm 2003; 307: 254–60. 11. Kim M, Jang HR, Kim JH, et al. Epigenetic inac- tivation of protein kinаse D1 in gastric cancer and its role Experimental Oncology 33, 206–211, 2011 (December)33, 206–211, 2011 (December) (December) 211 in gastric cancer cell migration and invasion. Carcinogenesis 2008; 29: 629–37. 12. Kovalevska LM, Yurchenko OV, Shlapatska LM, et al. Immunohistochemical studies of protein kinase D (PKD) 2 expression in malignant human lymphomas. Exp Oncol 2006; 28: 225–30. 13. Shabelnik MY, Tarasova TA, Merencev SV, et al. The level of expression and autophosphorylation of protein kinase D1 and D2 in gastric adenocarcinoma of different level of dif- ferentiation. Oncology 2008; 10: 393–9 (in Ukrainian). 14. Logan J, Edwards K, Saunders N. Real-Time PCR: current technology and applications. Caister Academic Press 2009. ISBN 978-1-904455-39-4. 15. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxic- ity assays. J Immunol Methods 1983; 65: 55–63. 16. Liang C, Park AY, Guan J-L. In vitro scratch as- say: a convenient and inexpensive method for analysis of cell migration in vitro. Nature Protocols 2007; 2: 329–33. 17. Reckless J, Grainger DJ. Identification of oligopeptide sequences which inhibit migration induced by a wide range of chemokines. Biochem J 1999; 340: 803–11 18. Cao J., Schulte J., Knight A., et al. Prdx1 inhibits tumorigenesis via regulating PTEN/AKT activity EMBO J 2009 May 20; 28: 1505–17. 19. Sturany S, van Lint J, Gilchrist A, et al. Mechanism of activation of protein kinase D2 (PKD2) by the CCKB/ gastrin receptor. J Biol Chem 2002; 277: 29431–8. 20. Jaggi M, Rao PS, Smith DJ, et al. E-cadherin phos- phorylation by protein kinase D1/protein kinase C{mu} is associated with altered cellular aggregation and motility in prostate cancer. Cancer Res 2005; 65: 483–92. Copyright © Experimental Oncology, 2011