Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines

The aim of the study was to analyze an effect of cytostatic agents of different mechanism of action on expression levels of human beta-defensins-1-4 (hBD-1-4) in cultured human cancer cell lines. Materials and Methods: Expression levels of hBD-1-4 mRNA were assessed using qPCR in human epidermoid ca...

Ausführliche Beschreibung

Gespeichert in:

Bibliographische Detailangaben
Datum:	2018
Hauptverfasser:	Zubenko, O.S., Semeniuk, D.O., Starenka, I.O., Pogribnyy, P.V.
Format:	Artikel
Sprache:	English
Veröffentlicht:	Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України 2018
Schriftenreihe:	Experimental Oncology
Schlagworte:	Short communications
Online Zugang:	http://dspace.nbuv.gov.ua/handle/123456789/139241
Tags:	Tag hinzufügen Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:	Digital Library of Periodicals of National Academy of Sciences of Ukraine
Zitieren:	Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines / O.S. Zubenko, D.O. Semeniuk, I.O. Starenka, P.V. Pogribnyy // Experimental Oncology. — 2018 — Т. 40, № 1. — С. 79-81. — Бібліогр.: 6 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine

id	irk-123456789-139241
record_format	dspace
spelling	irk-123456789-1392412018-06-20T03:06:46Z Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines Zubenko, O.S. Semeniuk, D.O. Starenka, I.O. Pogribnyy, P.V. Short communications The aim of the study was to analyze an effect of cytostatic agents of different mechanism of action on expression levels of human beta-defensins-1-4 (hBD-1-4) in cultured human cancer cell lines. Materials and Methods: Expression levels of hBD-1-4 mRNA were assessed using qPCR in human epidermoid carcinoma A431 cells and human breast adenocarcinoma MCF7 cells treated with cisplatin, methotrexate, doxorubicin or vincristine at the IC20 concentrations. Results: The cytostatic agents with different mechanisms of action affected differently expression of hBDs, dependent on the cell line. Mostly, cytostatic agents suppressed significantly expression of hBDs. In contrast, vincristine caused significant up-regulation of hBD-1 (12 fold, p < 0.05) and hBD-4 (2 fold, p < 0.05) in MCF7, and doxorubicin significantly enhanced expression of hBD-3 (2 fold, p < 0.05) and hBD-4 (> 10 fold, p < 0.05) in A431 cells. Conclusion: The results of this pilot study show that expression levels of hBD-1-4 may be altered upon treatment with cytostatic agents depending on nature of cells. 2018 Article Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines / O.S. Zubenko, D.O. Semeniuk, I.O. Starenka, P.V. Pogribnyy // Experimental Oncology. — 2018 — Т. 40, № 1. — С. 79-81. — Бібліогр.: 6 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/139241 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
institution	Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection	DSpace DC
language	English
topic	Short communications Short communications
spellingShingle	Short communications Short communications Zubenko, O.S. Semeniuk, D.O. Starenka, I.O. Pogribnyy, P.V. Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines Experimental Oncology
description	The aim of the study was to analyze an effect of cytostatic agents of different mechanism of action on expression levels of human beta-defensins-1-4 (hBD-1-4) in cultured human cancer cell lines. Materials and Methods: Expression levels of hBD-1-4 mRNA were assessed using qPCR in human epidermoid carcinoma A431 cells and human breast adenocarcinoma MCF7 cells treated with cisplatin, methotrexate, doxorubicin or vincristine at the IC20 concentrations. Results: The cytostatic agents with different mechanisms of action affected differently expression of hBDs, dependent on the cell line. Mostly, cytostatic agents suppressed significantly expression of hBDs. In contrast, vincristine caused significant up-regulation of hBD-1 (12 fold, p < 0.05) and hBD-4 (2 fold, p < 0.05) in MCF7, and doxorubicin significantly enhanced expression of hBD-3 (2 fold, p < 0.05) and hBD-4 (> 10 fold, p < 0.05) in A431 cells. Conclusion: The results of this pilot study show that expression levels of hBD-1-4 may be altered upon treatment with cytostatic agents depending on nature of cells.
format	Article
author	Zubenko, O.S. Semeniuk, D.O. Starenka, I.O. Pogribnyy, P.V.
author_facet	Zubenko, O.S. Semeniuk, D.O. Starenka, I.O. Pogribnyy, P.V.
author_sort	Zubenko, O.S.
title	Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines
title_short	Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines
title_full	Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines
title_fullStr	Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines
title_full_unstemmed	Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines
title_sort	effect of cytostatic agents on expression levels of human beta-defensins-1-4 in a431 and mcf-7 cell lines
publisher	Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
publishDate	2018
topic_facet	Short communications
url	http://dspace.nbuv.gov.ua/handle/123456789/139241
citation_txt	Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines / O.S. Zubenko, D.O. Semeniuk, I.O. Starenka, P.V. Pogribnyy // Experimental Oncology. — 2018 — Т. 40, № 1. — С. 79-81. — Бібліогр.: 6 назв. — англ.
series	Experimental Oncology
work_keys_str_mv	AT zubenkoos effectofcytostaticagentsonexpressionlevelsofhumanbetadefensins14ina431andmcf7celllines AT semeniukdo effectofcytostaticagentsonexpressionlevelsofhumanbetadefensins14ina431andmcf7celllines AT starenkaio effectofcytostaticagentsonexpressionlevelsofhumanbetadefensins14ina431andmcf7celllines AT pogribnyypv effectofcytostaticagentsonexpressionlevelsofhumanbetadefensins14ina431andmcf7celllines
first_indexed	2025-07-10T07:52:42Z
last_indexed	2025-07-10T07:52:42Z
_version_	1837245628305899520
fulltext	Experimental Oncology �� arc�� arc�� arc�� EFFECT OF CYTOSTATIC AGENTS ON EXPRESSION LEVELS OF HUMAN BETA-DEFENSINS-1-4 IN A431 AND MCF-7 CELL LINES O.S. Zubenko, D.O. Semeniuk, I.O. Starenka, P.V. Pogribnyy R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv 03022, Ukraine The aim of the study was to analyze an effect of cytostatic agents of different mechanism of action on expression levels of human beta-defensins-1-4 (hBD-1-4) in cultured human cancer cell lines. Materials and Methods: Expression levels of hBD-1-4 mRNA were assessed using qPCR in human epidermoid carcinoma A431 cells and human breast adenocarcinoma MCF7 cells treated with cisplatin, methotrexate, doxorubicin or vincristine at the IC20 concentrations. Results: The cytostatic agents with different mecha- nisms of action affected differently expression of hBDs, dependent on the cell line. Mostly, cytostatic agents suppressed significantly expression of hBDs. In contrast, vincristine caused significant up-regulation of hBD-1 (12 fold, p < 0.05) and hBD-4 (2 fold, p < 0.05) in MCF7, and doxorubicin significantly enhanced expression of hBD-3 (2 fold, p < 0.05) and hBD-4 (> 10 fold, p < 0.05) in A431 cells. Conclusion: The results of this pilot study show that expression levels of hBD-1-4 may be altered upon treatment with cytostatic agents depending on nature of cells. Key Words: A431 cells, MCF7 cells, human beta-defensins, cytostatic agents. Human defensins are cationic cysteine-ric� anti- microbial peptides and represent important compo- nents of innate immune system. Depending on t�eir structure� in particular� disulfide bonding� defensins are classified into t�e subfamilies of alp�a- and beta-defensins ��uman beta-defensins — �BDs�. Originally defensins were described as antibacte- rial peptides� but furt�er researc� s�owed t�at t�ey �ave a wide range of functions in t�e �uman body. As t�e molecules capable to link innate and adap- tive immunity� defensins are ascribed to t�e family of alarmins� molecules involved in danger signaling; it is supposed t�at t�ey may play a role in t�e tumor microenvironment [�]. Apart from t�is� some defen- sins are capable to cause tumor cell lysis and exert pro- or antitumorigenic and angiogenic activities [�]. Hypot�etically� beta-defensins could be capable to influence t�e cancer cell sensitivity to cytototoxic agents. To address t�is issue� we �ave analyzed t�e influence of cytostatic agents of different mec�a- nisms of action on t�e expression of beta-defensins in cultured �uman cancer cell lines. MATERIALS AND METHODS Cell lines. In t�e experiment� we used �uman epidermoid carcinoma A�3� and �uman breast ad- enocarcinoma �CF� cell lines. T�e cell lines were obtained from t�e Bank of Cell Lines from Human and Animal Tissues of t�e R.E. Kavetsky Institute of Ex- perimental Pat�ology� Oncology and Radiobiology� NAS of Ukraine. A�3� and �CF� cells were cultured in D�E� medium supplemented wit� ��% fetal bo- vine serum �FBS�� in a �umidified atmosp�ere wit� 5% CO� at 3� °C. Analysis of cell viability (MT T-assay). To evaluate t�e effect of cytotoxic agents on cell viability� �TT met�od was used [3]. In s�ort� tumor cells were seeded in 96-well plates (7•103 cells per well� and incubated wit� cytotoxic agents �doxorubicin� cisplatin� vincristine� met�otrexate in a wide range of concentrations ��.��5 mg/ml; �.�5�5� mg/ml; �.��5�5 mg/ml; �.5�5�� mg/ml� respectively� in D�E� medium� wit� t�e addition of �.5% FBS for �� . T�en t�e cells were treated wit� 3-��5-dimet�ylt�iazol-�-yl�-��5-dip�enyl- tetrazolium ��TT� reagent by standard protocol. Colorimetric reaction was evaluated using a Plate Analyzer StarFax �� at a wavelengt� of �� nm. Isolation of total RNA. Isolation of total RNA from cultured cells was carried out using t�e Trizol reagent. T�e concentration of RNA was determined by spectrop�oto metry at a wavelengt� of �6� nm us- ing a NanoDrop �� mac�ine. T�e quality of RNA was assessed by electrop�oresis in �% agarose gels. Quantitative real-time PCR. Expression of beta-defensins in A�3� and �CF� cells treated wit� cytotoxic agents was analyzed by quantitative polymerase c�ain reaction �qPCR� using specific primers. Design of primers was performed using Oligo 6.3� program. T�e reaction was carried out in a volume of �� ml� containing �� ml mixture of reagents �axima SYBR Green/ROX qPCR �aster �ix� �.5 pmol of eac� specific primer� � ml of cDNA obtained in t�e reverse transcription reaction and demineralized water. T�e reaction was performed on T�ermocycler �5�� Real- Time PCR System. T�e reaction conditions and se- quences of specific primers are s�own in t�e Table �. Submitted: June 10, 2017. Correspondence: E-mail: Oleksiy2017ZOS@gmail.com Abbreviations used: СP — cisplatin; DOX — doxorubicin; FBS — fe- tal bovine serum; hBD — human beta-defensin; МЕТ — methotrex- ate; MTT — 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium; qPCR — quantitative polymerase chain reaction; VIN — vincristine. Exp Oncol �� SHORT COMMUNICATION �� Experimental Oncology �� arc�� Table 1. Conditions for quantitative real time PCR Gene Primer Conditions Beta-actin F: GAAATCGTGCGTGACATTAA R: CCAGACAGCACTGTGTTGG Denaturation — 94 °С, 15 s Annealing/Elongation — 59 °С, 60 s Number of cycles — 40 HBD-1 F: CTCCCCAGTTCCTGAAATCCT R: GCCTGTGAGAAAGTTACCACC Denaturation — 94 °С, 15 s Annealing — 57 °С, 30 s Elongation — 72 °С, 30 s Number of cycles — 40 HBD-2 F: TGAAGCTCCCAGCCATCAG R: ATCGCCTATACCACCAAAAACAC Denaturation — 94 °С, 15 s Annealing — 57 °С, 30 s Elongation — 72 °С, 30 s Number of cycles — 40 HBD-3 R: CCTGTTTTTGGTGCCTGTTCC R: CTTTCTTCGGCAGCATTTTCG Denaturation — 94 °С, 15 s Annealing — 57 °С, 30 s Elongation — 72 °С, 30 s Number of cycles — 40 HBD-4 F: GACTTGTGCTGCTATTAGCCA R: CGATTCAGTAAGCTCTCATCC Denaturation — 94 °С, 15 s Annealing — 57 °С, 30 s Elongation — 72 °С, 30 s Number of cycles — 40 T�e t�res�old fluorescence level was determined using software SDS software V.�.3.�. Gene expres- sion was normalized by t�e reference gene �beta-ac- tin�� comparison of gene expression was performed by �-δδCt met�od. Statistical analysis. To determine t�e signifi- cance of t�e differences between t�e data groups Student’s t-criterion was used. T�e differences were considered significant at p < �.�� for �TT test and p < �.�5 for qPCR. T�e data are presented as � ± m. RESULTS AND DISCUSSION In present researc�� we aimed to analyze t�e ef- fect of cytostatic agents commonly used in clinical practice� i.e. cisplatin� doxorubicin� vincristine� and met�otrexate on expression of �BDs mRNAs in two cancer cell lines� A�3� and �CF�. T�ese cytostatic agents are known to cause cytotoxic effects via differ- ent mec�anisms: �� cisplatin� inorganic water-soluble platinum complex� acts as DNA crosslinker� disturbing replication and translation; �� doxorubicin� ant�ra- cycline antibiotic� intercalates DNA and blocks its replication; 3� met�otrexate� folate analog� is an an- timetabolite blocking t�e synt�esis of t�ymidine� purine and pyrimidine; and �� vincristine is an alkaloid capable to bind wit� microtubules and prevents t�e formation of mitotic spindles� consequently blocking cell mitosis. To study effects of t�ese agents on �BDs expression in vitro� first of all� we �ave determined minimal concentrations of t�e cytotoxic drugs caus- ing a significant decrease of tumor cell viability using �TT assay. T�ese concentrations corresponding to IC�� values �Table �� were used in our furt�er experiments. Breast cancer cells were muc� more sensitive to t�e studied cytostatics t�an epidermoid carcinoma cells. Table 2. ІС20 values for cytostatic agents estimated in culture of А431 and MCF7 cells ІС20 agent А431, µg/ml MCF7, µg/ml Doxorubicin 42 ± 3 0.19 ± 0.02 Cisplatin 4.4 ± 1.5 0.13 ± 0.02 Methotrexate 60 ± 9 1.8 ± 0.2 Vincristine 0.4 ± 0.2 0.16 ± 0.02 Expression of �BD-�-� mRNAs in t�e A�3� and �CF� cell line treated wit� minimal effective con- centrations of cytotoxic agents was assessed wit� qPCR �Fig. �� . As it �as been s�own� expression of �BD-� gene significantly decreased after incuba- tion of bot� cell lines wit� cisplatin� met�otrexate and doxorubicin� especially in A�3� cells �by �� ± �� times in cisplatin-treated A�3� cells� and 6� ± 6 times in met�otrexate-treated А�3�� p < �.�5� �Fig. �� a�. In contrary� treatment wit� vincristine did not cause significant influence on t�e expression of �BD-� gene in A�3� cells� but significantly stimulate its expression in �CF� cells �up to �� ± �.� fold� p < �.�5� �Fig. �� a�. Expression of �BD-� gene drastically fall in A�3� cells treated wit� any of mentioned agents: by �� ± 5 fold� �� ± 3� fold� �� fold� and �5� ± 3� fold in t�e cells treated wit� doxorubicin� met�o trexate� cisplatin� and vincristine� respectively �p < �.�5� �Fig. �� b�. Interest- ingly� in �CF� cells t�e cytostatic agents �ad no effect of t�e level of �BD-� expression as well as expression of �BD-3 gene. Interestingly� in A�3� cells expression of �BD-3 gene increased more t�an � fold and expres- sion of �BD-� more t�an �� fold after treatment wit� doxorubicin �p < �.�5�. Regarding �BD-3 and �BD-� ex- pression in �CF� cells treated wit� cytostatic agents� significant differences were detected just in � cases: 0 0.2 0.4 0.6 0.8 1 1.2 1.4 Re la tiv e ex pr es si on le ve l o f h BD 2 Re la tiv e ex pr es si on le ve l o f h BD 3 Re la tiv e ex pr es si on le ve l o f h BD 4 0 0.5 1 1.5 2 2.5 * * * * * * * * * Re la tiv e ex pr es si on le ve l o f h BD 1 Treatment Treatment Treatment Treatment 0 0.5 1 1.5 2 2.5 3 0 2 4 6 8 10 12 14 C DOX CP MET VIN C DOX CP MET VIN C DOX CP MET VIN C DOX CP MET VIN a b c d Fig. 1. Effect of cytotoxic agents on t�e expression of �BD� �a�� BD-� �b�� BD-3 �c� and �BD-� �d� in A�3� cell line. C — control sample; �ET — 6� mg/ml met�otrexate; DOX — �� mg/ml doxo- rubicin; CP — �.� mg/ml cisplatin; VIN — �.� mg/ml vincristin sulfate. T�e data are presented as � ± m� n = �. T�e difference is significant compared wit� t�e control� p < �.�5 Experimental Oncology �� arc�� arc�� arc�� expression of �BD-� genes was significantly down- regulated by МЕТ �by �3 ± � fold� p < �.�5� and sig- nificantly up-regulated by vincristine �by �.� ± �.� fold� p < �.�5� �Fig. �� d�. T�e obtained data �ave s�own t�at t�e cytostatic agents wit� different mec�anisms of action differen- tially affect expression of �BDs dependent on cell line. �ostly� cytostatic agents suppress expression of �BDs� �owever vincristine caused significant up-regulation of �BD-� and �BD-� genes in breast cancer cells� w�ile doxorubicin significantly en�anced expression of �BD-3 and �BD-� genes in A�3� cells. It is tempt- ing to speculate t�at t�e mentioned above effects of particular �BDs up-regulation caused by vincristine in �CF-� cells and doxorubicin in A�3� cells could point on possible protective functions of t�ese defensins in t�e cells undergoing cytotoxic treatment. Unfortunately� t�e studies in t�is field are scarce. For example� it was reported t�at doxorubicin in�i- bits t�e expression of �BD-3 in orop�aryngeal cancer cells� possibly� via activation of t�e transcription factor p53� w�ic� is a repressor of �BD-3 gene transcrip- tion [�]. Anot�er study reported t�at met�otrexate is capable to block induction of �BD-� expression in �FOB cells [5]. An interesting observation �as been done regarding alp�a-defensins expression in breast tumors. In t�is researc�� proteomic and genetic profiling of pretreatment breast cancer biopsies demonstrated t�at expression of alp�a-defensins and a microtubule- associated protein �AP� is associated wit� pat�ologic complete response to t�erapy wit� taxanes� antimicro- tubule agents� in t�e patients wit� breast cancer [6]. So� alp�a-defensins could be considered as t�e markers of sensitivity of breast tumors to taxane-based t�erapy. In conclusion� our pilot study �as revealed t�at cyto- static agents wit� different mec�anism of action differen- tially affect expression of beta-defensins-�-� in two cul- tured tumor cell lines. Expression of �BD-� gene was t�e most sensititve for cytotoxic treatments and significantly decreased in t�e presence of any of t�em in A�3� cells. Expression of �BD-� gene was t�e most protected against cytotoxic influence� moreover� it significantly increased un- der t�e action of doxorubicin in A�3� cells and vincristine in �CF� cells. Furt�er study will possibly �elp to under- stand w�et�er beta-defensins� especially� �BD-� could play a role in t�e protection of cancer cells against cyto- toxic agents or in t�eir sensibilization to cytostatic drugs. REFERENCES 1. Coffelt SB, Scandurro AB. Tumors sound the alarmin(s). Cancer Res 2008; 68: 6482–5. 2. Weinberg A, Jin G, Sieg S, McCormick TS. The Yin and Yang of human beta-defensins in health and disease. Front Immunol 2012; 3: 294. 3. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cyto- toxicity assays. Immunol Methods 1983; 65: 55–63. 4. DasGupta T, Nweze EI, Yue H, et al. Human papillomavirus oncogenic E6 protein regulates human β-defensin 3 (hBD3) expression via the tumor suppressor protein p53. Oncotarget 2016; 7: 27430–44. 5. Varoga D, Tohidnezhad M, Paulsen F, et al. The role of human β-defensin-2 in bone. J Anat 2008; 213: 749–57. 6. Bauer JA, Chakravarthy AB, Rosenbluth JM, et al. Identification of markers of taxane sensitivity using proteomic and genomic analyses of breast tumors from patients receiving neoadjuvant paclitaxel and radiation. Clin Cancer Res 2010; 16: 681–90. Re la tiv e ex pr es si on le ve l o f h BD 1 Re la tiv e ex pr es si on le ve l o f h BD 2 Re la tiv e ex pr es si on le ve l o f h BD 3 Re la tiv e ex pr es si on le ve l o f h BD 4 Treatment Treatment -2 0 2 4 6 8 10 12 14 C DOX CP MET VIN 0 0.5 1 1.5 2 2.5 C DOX CP MET VIN Treatment C DOX CP MET VIN Treatment C DOX CP MET VIN 0 0,5 1 1,5 2 2,5 3 3,5 4 4,5 5 0 0,5 1 1,5 2 2,5 3 3,5 4 4,5 a b c d Fig. 2. Effect of cytotoxic agents on t�e expression of �BD� �a�� BD-� �b�� BD-3 �c� and �BD-� �d� in �CF� cell line. C — control sample; �ET — �.� mg/ml met�otrexate; DOX — �.�� mg/ml doxo- rubicin; CP — �.�3 mg/ml cisplatin; VIN — �.�6 mg/ml vincristin sulfate. T�e data are presented as � ± m� n = �. T�e difference is significant compared wit� t�e control� p < �.�5 Copyright © Experimental Oncology, 2017

Effect of cytostatic agents on expression levels of human beta-defensins-1-4 in A431 and MCF-7 cell lines

Institution

Ähnliche Einträge