Hypermethylation of TUSC5 genes in breast cancer tissue
Aim: Breast cancer (BC) is one of the most common forms of cancer amongst females. Early diagnosis, prognosis and therapy plays crucial role in the survival of patients with breast cancer. The study was aimed on identification of potential markers for early BC diagnostics by means of genome-wide com...
Збережено в:
| Дата: | 2012 |
|---|---|
| Автори: | , , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2012
|
| Назва видання: | Experimental Oncology |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/139864 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Hypermethylation of TUSC5 genes in breast cancer tissue / V. Bubnov, E. Moskalev, Y. Petrovskiy, A. Bauer, J. Hoheisel, V. Zaporozhan // Experimental Oncology. — 2012. — Т. 34, № 4. — С. 370-372. — Бібліогр.: 7 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-139864 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1398642018-06-22T03:05:08Z Hypermethylation of TUSC5 genes in breast cancer tissue Bubnov, V. Moskalev, E. Petrovskiy, Y. Bauer, A. Hoheisel, J. Zaporozhan, V. Short communications Aim: Breast cancer (BC) is one of the most common forms of cancer amongst females. Early diagnosis, prognosis and therapy plays crucial role in the survival of patients with breast cancer. The study was aimed on identification of potential markers for early BC diagnostics by means of genome-wide comparative analysis of gene expression in cancer and normal tissue of breast. Methods: The analysis of gene expression in 15 invasive adenocarcinoma specimens and 15 normal breast tissue was conducted using the full-genome microarrays Sentrix HumanWD-6V3 BeadChip (Illumina). Methylation of TP53INK1 and TUSС5 promoters was interrogated by the combined bisulfite restriction analysis (COBRA). Results: Analysis of gene expression in the samples of breast adenocarcinoma revealed abnormal expression of more than 2,300 genes. While genes TFF1, S100P, ERBB2, TOP2A, CDF15, HOOK1, DNAJC12, CORO2A were up-regulated in cancer, decreased expression was found for genes TUSC5, SFRP1, PPPQR1B, NTRK4, TIMP4, BARD1, AKR1C2, TP53INK1 and others. Analysis of DNA methylation of TUSC5 by COBRA revealed higher levels of exon 1 methylation (11/12) in samples of breast cancer, whereas the gene was essentially unmethylated in matched normal appearing tissue of breast (2/12). TP53INK1 gene was methylated neither in cancer nor in normalcy. Conclusion: A total of 149 genes exhibited the highest difference in expression in cancer versus normal appearing tissue of breast. Most prominent down-regulated candidates, TUSC5 and TP53INK1, were reported for the first time in breast cancer and may be considered as potential markers of the disease. Aberrant DNA hypermethylation of TUSC5 suggests epigenetic mechanism of cancer associated down-regulation. 2012 Article Hypermethylation of TUSC5 genes in breast cancer tissue / V. Bubnov, E. Moskalev, Y. Petrovskiy, A. Bauer, J. Hoheisel, V. Zaporozhan // Experimental Oncology. — 2012. — Т. 34, № 4. — С. 370-372. — Бібліогр.: 7 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/139864 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Short communications Short communications |
| spellingShingle |
Short communications Short communications Bubnov, V. Moskalev, E. Petrovskiy, Y. Bauer, A. Hoheisel, J. Zaporozhan, V. Hypermethylation of TUSC5 genes in breast cancer tissue Experimental Oncology |
| description |
Aim: Breast cancer (BC) is one of the most common forms of cancer amongst females. Early diagnosis, prognosis and therapy plays crucial role in the survival of patients with breast cancer. The study was aimed on identification of potential markers for early BC diagnostics by means of genome-wide comparative analysis of gene expression in cancer and normal tissue of breast. Methods: The analysis of gene expression in 15 invasive adenocarcinoma specimens and 15 normal breast tissue was conducted using the full-genome microarrays Sentrix HumanWD-6V3 BeadChip (Illumina). Methylation of TP53INK1 and TUSС5 promoters was interrogated by the combined bisulfite restriction analysis (COBRA). Results: Analysis of gene expression in the samples of breast adenocarcinoma revealed abnormal expression of more than 2,300 genes. While genes TFF1, S100P, ERBB2, TOP2A, CDF15, HOOK1, DNAJC12, CORO2A were up-regulated in cancer, decreased expression was found for genes TUSC5, SFRP1, PPPQR1B, NTRK4, TIMP4, BARD1, AKR1C2, TP53INK1 and others. Analysis of DNA methylation of TUSC5 by COBRA revealed higher levels of exon 1 methylation (11/12) in samples of breast cancer, whereas the gene was essentially unmethylated in matched normal appearing tissue of breast (2/12). TP53INK1 gene was methylated neither in cancer nor in normalcy. Conclusion: A total of 149 genes exhibited the highest difference in expression in cancer versus normal appearing tissue of breast. Most prominent down-regulated candidates, TUSC5 and TP53INK1, were reported for the first time in breast cancer and may be considered as potential markers of the disease. Aberrant DNA hypermethylation of TUSC5 suggests epigenetic mechanism of cancer associated down-regulation. |
| format |
Article |
| author |
Bubnov, V. Moskalev, E. Petrovskiy, Y. Bauer, A. Hoheisel, J. Zaporozhan, V. |
| author_facet |
Bubnov, V. Moskalev, E. Petrovskiy, Y. Bauer, A. Hoheisel, J. Zaporozhan, V. |
| author_sort |
Bubnov, V. |
| title |
Hypermethylation of TUSC5 genes in breast cancer tissue |
| title_short |
Hypermethylation of TUSC5 genes in breast cancer tissue |
| title_full |
Hypermethylation of TUSC5 genes in breast cancer tissue |
| title_fullStr |
Hypermethylation of TUSC5 genes in breast cancer tissue |
| title_full_unstemmed |
Hypermethylation of TUSC5 genes in breast cancer tissue |
| title_sort |
hypermethylation of tusc5 genes in breast cancer tissue |
| publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| publishDate |
2012 |
| topic_facet |
Short communications |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/139864 |
| citation_txt |
Hypermethylation of TUSC5 genes in breast cancer tissue / V. Bubnov, E. Moskalev, Y. Petrovskiy, A. Bauer, J. Hoheisel, V. Zaporozhan // Experimental Oncology. — 2012. — Т. 34, № 4. — С. 370-372. — Бібліогр.: 7 назв. — англ. |
| series |
Experimental Oncology |
| work_keys_str_mv |
AT bubnovv hypermethylationoftusc5genesinbreastcancertissue AT moskaleve hypermethylationoftusc5genesinbreastcancertissue AT petrovskiyy hypermethylationoftusc5genesinbreastcancertissue AT bauera hypermethylationoftusc5genesinbreastcancertissue AT hoheiselj hypermethylationoftusc5genesinbreastcancertissue AT zaporozhanv hypermethylationoftusc5genesinbreastcancertissue |
| first_indexed |
2025-07-10T09:15:41Z |
| last_indexed |
2025-07-10T09:15:41Z |
| _version_ |
1837250847979864064 |
| fulltext |
370 Experimental Oncology 34, 370–372, 2012 (December)
HYPERMETHYLATION OF TUSC5 GENES IN BREAST CANCER TISSUE
V. Bubnov1,*, E. Moskalev2, Y. Petrovskiy1, A. Bauer2, J. Hoheisel2, V. Zaporozhan1
1Odessa National Medical University, Odessa 65082, Ukraine
2Functional Genome Analysis, Deutsches Krebsforschungszentrum (DKFZ), Heidelberg 69120, Germany
Aim: Breast cancer (BC) is one of the most common forms of cancer amongst females. Early diagnosis, prognosis and therapy plays
crucial role in the survival of patients with breast cancer. The study was aimed on identification of potential markers for early
BC diagnostics by means of genome-wide comparative analysis of gene expression in cancer and normal tissue of breast. Methods:
The analysis of gene expression in 15 invasive adenocarcinoma specimens and 15 normal breast tissue was conducted using the
full-genome microarrays Sentrix HumanWD-6V3 BeadChip (Illumina). Methylation of TP53INK1 and TUSС5 promoters was
interrogated by the combined bisulfite restriction analysis (COBRA). Results: Analysis of gene expression in the samples of breast
adenocarcinoma revealed abnormal expression of more than 2,300 genes. While genes TFF1, S100P, ERBB2, TOP2A, CDF15,
HOOK1, DNAJC12, CORO2A were up-regulated in cancer, decreased expression was found for genes TUSC5, SFRP1, PPPQR1B,
NTRK4, TIMP4, BARD1, AKR1C2, TP53INK1 and others. Analysis of DNA methylation of TUSC5 by COBRA revealed higher
levels of exon 1 methylation (11/12) in samples of breast cancer, whereas the gene was essentially unmethylated in matched normal
appearing tissue of breast (2/12). TP53INK1 gene was methylated neither in cancer nor in normalcy. Conclusion: A total of 149 genes
exhibited the highest difference in expression in cancer versus normal appearing tissue of breast. Most prominent down-regulated
candidates, TUSC5 and TP53INK1, were reported for the first time in breast cancer and may be considered as potential markers
of the disease. Aberrant DNA hypermethylation of TUSC5 suggests epigenetic mechanism of cancer associated down-regulation.
Key Words: differentially expressed genes, DNA methylation, breast cancer.
The majority of breast cancer deaths are associ-
ated with metastases. Therefore, early detection
of tumors would have substantial preventive effects.
The routine diagnostic methods that are currently
in use lack sensitivity for the detection of tumors at the
early stage. For examples, mammography may lead
to false-negative results in up to 31% of cases. Thus,
identification of tumor-specific molecular markers
is vital for development of new sensitive diagnostic
methods that are capable of early detection of tumor
cells [1]. Analysis of DNA methylation is one of the
promising diagnostic approaches given the facts
that: (1) aberrant DNA methylation occurs at any
stage of tumorigenesis in various cancers including
breast cancer [3]; (2) covalent cytosine modification
by methylation is stable and can be readily detected
in body fluids; (3) modification of DNA by methylation
is functionally involved in regulation of gene expression
[2]. Cancer is associated with the global and localized
hypermethylation of DNA in GC-rich regions referred
to as CpG islands. Taken together, these properties
of methylated DNA strongly suggest detection of DNA
hypermethylation for cancer diagnostics. For instance,
detection of hypermethylated promoters of certain
genes has been suggested as potential clinical mark-
ers for early diagnostics of prostate cancer (GSTP1),
prognosis of lung and colorectal cancer (p16INK4) and
response to temozolomid treatment of glioma patients
(MGMT) [4]. Therefore, identification of novel markers
for early diagnostics, prognosis and therapy of breast
cancer is of substantial practical use.
MATERIALS AND METHODS
Breast tissue samples. A total of 30 samples were
analyzed in the study. These included 15 adenocarci-
nomas of breast along with matched normal-appearing
breastspecimens. Fresh-frozen breast tissue samples
were obtained, with written informed consent from
patients from Odessa State Medical University after
approval by the Institutional Review Board (Table 1).
RNA extraction and microarrray study. After
surgical removal, samples were immediately placed
in RNAlater Stabilization Reagent (Qiagen, Hilden,
Germany), transported to the laboratory and frozen
at -80 °C. For RNA isolation, they were homogenized
on dry ice using mortar and pestle. Total RNA was
extracted using the RNEasy Mini Kit (Qiagen) accord-
ing to manufacturer’s instructions. The quality of iso-
lated patient RNA was controlled using a Bioanalyzer
2100 (Agilent Technologies, Palo Alto, CA, USA). Full-
genome microarrays Sentrix HumanWD-6V3 BeadChip
(Illumina inc., USA) were employed for analysis of gene
expression. cDNA was synthesized using 1 µg of total
RNA obtained from each tissue sample. Hybridisa-
tion to the BeadChip was performed according to the
manufacturer’s instructions. A maximum of 10 µl cDNA
was mixed with a 20 µL GEX-HYB hybridization solution.
The preheated 30 µl assay sample was dispensed onto
the large sample port of each array and incubated for
18 hours at 58°C. Following hybridization, samples
were washed according to the protocol and scanned
with a BeadArray Reader (Illumina, San Diego, USA).
Raw data were exported from the Beadstudio software
to CHIPSTER software, whereby data quality assess-
ment, normalization and correspondence cluster
analysis were performed. Most prominent candidate
genes that were differentially expressed in cancer vs.
normal-appearing tissue were identified by filtering
Received: July 4, 2012.
*Correspondence: E-mail: bubnov@ukr.net
Abbreviations used: BC — breast cancer.
Exp Oncol 2012
34, 4, 370–372
Experimental Oncology 34, 370–372, 2012 (December)34, 370–372, 2012 (December) (December) 371
99.95% of all transcripts (р < 0.005). Pathway analy-
sis of the resulting genes was performed using IPA
Ingenuity software.
DNA isolation, bisulfite conversion and com-
bined bisulfite restriction analysis (COBRA).
Twelve samples of breast adenocarcinoma (10 ductal
and 2 lobular forms) along with matched normal ap-
pearing tissue were used to analyze CpG methylation
within exon 1 of TUSC5 and promoter of TP53INP1.
DNA was extracted by using QIAmp DNA Mini
Kit and modified by sodium bisulfite with EpiTeсt
Bisulfite kit of Qiagen. Interrogated DNA regions
were amplified by PCR by using following primers:
TUSC5-forward ATTAGTAAAGTTGTTT, TUSC5-
reverse CAAAAAACTCTAAAAAAA; TP53INP1-for-
ward1 ATTTTGGAGAGGGAATA, TP53INP1-re-
verse1 AAAAACTACTATCTTCCCCACCTC; TP53INP1-
for ward2 TTTAATTGTTTTTTTTGGTTAGTTTT,
TP53INP1-reverse2 ATCCAACCATCACCT-ATA-
AATCC. Primers were designed by using Methyl Primer
Express v. 1.0 (Applied Biosystems, USA). EpiTect
control DNA set (Qiagen) was employed as a reference
for totally methylated and unmethylated DNA samples.
Amplicons were next incubated with BstUI restriction
enzyme (New England Biolabs, USA) as suggested
by the manufacturer and analyzed by electropho-
resis in 2%-agarose gel. Semiquantitative analysis
of TUSC5 and TP53INP1 DNA methylation was per-
formed using the Quantity One software (Bio-Rad,
USA) as earlier reported [5]. Methylation degree was
estimated according to the equation
CM = ————•100,
B + C
where B and C are amounts of unmethylated and
methylated alleles, respectively.
RESULTS AND DISCUSSION
In this study, we aimed at identification of differ-
entially expressed genes in tumors of breast versus
normal appearing breast tissue. To this end, genome-
wide gene expression profiling was performed (Fig.1).
A total of 2300 genes were shown to be deregulated
including 759 candidates with log fold change > 2.0.
These included DNAJC12, TOP2A, STAT1, KIAA0101,
GGT6, HOOK1, FLJ2315, TTF1, FSIP1, S100P, CRB14,
GDF15, RASEF, TP531NP1, SEC14L2, TMEM26,
MUC1, SUSD3, SPP1 etc. Significant down-regulation
was shown for 73 genes: TUSC5, TP53INP1, CIDEC,
CIDEA, SFRP1, GSTT1, DNAJC12, SOCS2, AQ7, HBB,
IGSF1, GPD1, LEP, LPL, AKR1C2, CASP4, NTRK2,
PPP1R1B, HOXA5, RBP4 etc. Significant up-regulated
candidates included 76 genes: S100P, TFF1, CORO2A,
FLG2351, C10orf106, C15orf48, VANGL2, UGT2B7,
SOCS2, SUSD and others. Deregulation of the fol-
lowing genes in breast adenocarcinoma was reported
for the first time: TUSC5, AQ7, CORO2A, FLJ2351, CI-
DEA, CIDEC, FAM89A, DDIT4L, C10orf106, C15orf48,
MRAP, UGT2B7, CCDC3 and VANGL2.
Breast tumor sample Normal tissue
Fig. 1. Unsupervised clustering of gene expression data (rows) for
breast cancer samples (columns at the left) and matched normal
appearing tissue (columns at the right). In the heatmap, up-
regulation is shown in red, down-regulation is designated in green.
TP53INP1 and TUSC5 were among most promi-
nent down-regulated candidates in breast adeno-
carcinoma. TP53INP1 is stress-inducible protein that
is responsible for phosphorylation of р53 in response
to double-strand DNA breaks. TUSC5 is a presumable
tumor suppressor. However, it function is poorly under-
stood. Given the fact that aberrant DNA hypermethyl-
ation is a frequent epigenetic event in cancer that is as-
sociated with loss of gene function, we hypothesized
that TP53INP1 and TUSC5 may be epigenetically
silenced. We addressed methylation of CGCG sites
in exon 1 of TUSC5 and promoter of TP53INP1 by com-
bined bisulfite restriction analysis. Hypermethyl-
ation of CGCG site in TUSC5 was detected in 11 out
of 12 samples of breast cancer with mean 51.4±3.1%
methylation. Significantly lower methylation load was
observed in normal appearing breast tissue of same
patients (30.5±1.9%, p<0.002, Fig.2). TUSC5 meth-
ylation in two normal samples was higher (43% and
41%) that in the rest of normal specimens, what may
be explained by contamination of these samples with
tumor cells (Table 2). These findings suggest epi-
genetic mechanism of TUSC5 deregulation. No DNA
methylation was detected in TP53INP1 promoter both
in cancer and normalcy suggesting an alternative
mechanism of its deregulation
Tissue
Tumor Normal
M
et
hy
la
tio
n,
%
60
50
40
30
20
p = 0.00259
t = 4.121
df = 9
Fig. 2. Comparison of TUSC5 gene methylation status in breast
cancer and normal tissue in the same patients.
372 Experimental Oncology 34, 370–372, 2012 (December)
Table. Methylation level of TUSC5 in brest cancer and matched normal
appearing tissue
Sample ID Percent DNA methylation
Breast cancer Normal appearing breast tissue
1 67 28
2 45 29
3 65 31
4 48 24
5 51 32
6 56 45
7 51 23
8 49 24
9 24 41
10 53 34
11 51 27
12 53 28
51.4 ± 3.1 30.5 ± 1.9 p = 0.0029
Our results are concordant with a report by Weng
et al. [6], who have shown loss of TP53INP1 expres-
sion in esophageal carcinoma. However, in contrast
to other malignancies, where TP53INP1 was shown
(e.g., esophagus cancer and melanoma [7]), methyla- [7]), methyla-[7]), methyla-
tion could not be detected in our samples.
In conclusion. a total of 149 genes exhibited the high-
est difference in expression in cancer versus normal ap-
pearing tissue of breast. Most prominent down-regulated
candidates, TUSC5 and TP53INK1, were reported for
the first time in breast cancer and may be considered
as potential markers of the disease. Aberrant DNA hyper-
methylation of TUSC5 suggests epigenetic mechanism
of cancer associated down-regulation.
REFERENCES
1. Andre F, Michiels S, Dessen P, et al. Exonic expression
profiling of breast cancer and benign lesions: a retrospective
analysis. Lancet Oncol 2009; 10: 381–90.
2. Jones PA, Takai D. The role of DNA methylation
in mammalian epigenetics. Science 2001; 293: 1068–70.
3. Gal-Yam EN, Saito Y, Egger G, Jones PA. Cancer
epigenetics: modifications, screening, and therapy. Annu Rev
Med 2008; 59: 267–80.
4. Veeck J, Ropero S, Setien F, et al. BRCA1 CpG island hy-
permethylation predicts sensitivity to poly(adenosine diphosphate)-
ribose polymerase inhibitors. J Clin Oncol 2010; 28: 2512–9.
5. Xiong Z, Laird PW. COBRA: a sensitive and quantitative
DNA methylation assay. Nucl Acids Res 1997; 12: 2532–4.
6. Weng W, Yang Q, Huang M, et al. c-Myc inhibits
TP53INP1 expression via promoter methylation in esophageal
carcinoma. Biochem Biophys Res Commun 2011; 405: 278–84.
7. Bonazzi VF, Irwin D, Hayward NK. Identification of can-
didate tumor suppressor genes inactivated by promoter methyla-
tion in melanoma. Genes Chromosomes Cancer. 2009; 48:10–21.
Copyright © Experimental Oncology, 2012
|