Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3
Aim: To investigate the influence of trichostatin A (TSA) on inhibition of cell proliferation and induction of apoptosis in human pancreatic cancer cells. Methods: MTT-based cytotoxicity assay was used to evaluate the cell viability after treatment with TSA. Cell cycle distribution and apoptosis wer...
Збережено в:
| Дата: | 2008 |
|---|---|
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2008
|
| Назва видання: | Experimental Oncology |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/139947 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 / S. Zhang, X. Cai, F. Huang, W. Zhong, Z. Yu // Experimental Oncology. — 2008. — Т. 30, № 4. — С. 265–268. — Бібліогр.: 32 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-139947 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1399472018-06-22T03:03:53Z Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 Zhang, S. Cai, X. Huang, F. Zhong, W. Yu, Z. Original contributions Aim: To investigate the influence of trichostatin A (TSA) on inhibition of cell proliferation and induction of apoptosis in human pancreatic cancer cells. Methods: MTT-based cytotoxicity assay was used to evaluate the cell viability after treatment with TSA. Cell cycle distribution and apoptosis were examined by means of flow cytometry. Expression of microRNA was determined with microRNA array. Expression of miR-200c and miR-21 was detected by Northern blotting. Results: TSA significantly inhibited the proliferation of BxPC-3 human pancreatic cancer cells in a time- and dose-dependent manner. BxPC-3 cells treated with TSA were arrested in G0/G1 phase and were characterized by increased apoptotic rate, accompanied by differential expression of microRNAs. Conclusions: The results suggest that TSA may activate expression of microRNAs that may act as tumor suppressor in human pancreatic cancer cell line BxPC-3. Цель: изучить влияние трихостатина A (TSA) на ингибирование пролиферации клеток и индукцию апоптоза в клеточной линии рака поджелудочной железы человека. Методы: для оценки жизнеспособности клеток после их обработки TSA применяли основанный на MTT цитотоксический тест. Распределение клеток по фазам клеточного цикла и процент апоптических клеток определяли с помощью проточной цитофлуориметрии. Экспрессию микроРНК изучали с использованием микроРНК-чипа. Экспрессия miR-200c и miR-21 исследована с помощью Нозерн-блот анализа. Результаты: TSA значительно ингибировал пролиферацию клеток линии рака поджелудочной железы человека BxPC-3, и этот процесс зависел от времени инкубации и концентрации препарата. Клетки BxPC-3, обработанные TSA, были остановлены в G0/G1-фазе клеточного цикла, увеличивалось количество апоптотических клеток, что сопровождалось изменением экспрессии микроРНК. Выводы: полученные результаты позволяют предположить, что TSA может активировать экспрессию микроРНК, которые в свою очередь выступают онкосупрессорами опухоли в клетках линии рака поджелудочной железы BxPC-3. 2008 Article Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 / S. Zhang, X. Cai, F. Huang, W. Zhong, Z. Yu // Experimental Oncology. — 2008. — Т. 30, № 4. — С. 265–268. — Бібліогр.: 32 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/139947 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Original contributions Original contributions |
| spellingShingle |
Original contributions Original contributions Zhang, S. Cai, X. Huang, F. Zhong, W. Yu, Z. Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 Experimental Oncology |
| description |
Aim: To investigate the influence of trichostatin A (TSA) on inhibition of cell proliferation and induction of apoptosis in human pancreatic cancer cells. Methods: MTT-based cytotoxicity assay was used to evaluate the cell viability after treatment with TSA. Cell cycle distribution and apoptosis were examined by means of flow cytometry. Expression of microRNA was determined with microRNA array. Expression of miR-200c and miR-21 was detected by Northern blotting. Results: TSA significantly inhibited the proliferation of BxPC-3 human pancreatic cancer cells in a time- and dose-dependent manner. BxPC-3 cells treated with TSA were arrested in G0/G1 phase and were characterized by increased apoptotic rate, accompanied by differential expression of microRNAs. Conclusions: The results suggest that TSA may activate expression of microRNAs that may act as tumor suppressor in human pancreatic cancer cell line BxPC-3. |
| format |
Article |
| author |
Zhang, S. Cai, X. Huang, F. Zhong, W. Yu, Z. |
| author_facet |
Zhang, S. Cai, X. Huang, F. Zhong, W. Yu, Z. |
| author_sort |
Zhang, S. |
| title |
Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 |
| title_short |
Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 |
| title_full |
Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 |
| title_fullStr |
Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 |
| title_full_unstemmed |
Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 |
| title_sort |
effect of trichostatin a on viability and microrna expression in human pancreatic cancer cell line bxpc-3 |
| publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| publishDate |
2008 |
| topic_facet |
Original contributions |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/139947 |
| citation_txt |
Effect of trichostatin a on viability and microRNA expression in human pancreatic cancer cell line BxPC-3 / S. Zhang, X. Cai, F. Huang, W. Zhong, Z. Yu // Experimental Oncology. — 2008. — Т. 30, № 4. — С. 265–268. — Бібліогр.: 32 назв. — англ. |
| series |
Experimental Oncology |
| work_keys_str_mv |
AT zhangs effectoftrichostatinaonviabilityandmicrornaexpressioninhumanpancreaticcancercelllinebxpc3 AT caix effectoftrichostatinaonviabilityandmicrornaexpressioninhumanpancreaticcancercelllinebxpc3 AT huangf effectoftrichostatinaonviabilityandmicrornaexpressioninhumanpancreaticcancercelllinebxpc3 AT zhongw effectoftrichostatinaonviabilityandmicrornaexpressioninhumanpancreaticcancercelllinebxpc3 AT yuz effectoftrichostatinaonviabilityandmicrornaexpressioninhumanpancreaticcancercelllinebxpc3 |
| first_indexed |
2025-07-10T09:26:32Z |
| last_indexed |
2025-07-10T09:26:32Z |
| _version_ |
1837251533889077248 |
| fulltext |
Experimental Oncology 30, 265–268, 2008 (December) 265
Pancreatic cancer is one of the most aggressive hu
man cancers. Advanced pancreatic cancer is associa
ted with a poor prognosis although surgical resection or
radiotherapy is potentially curative for localized disease.
5year survival rates for patients with pancreatic cancer
are less than 5% and the median survival time is less
than 6 months [1]. Multimodality treatments, including
surgery, chemotherapy, and postoperative radiation
therapy, have resulted in only an incremental increase in
survival. Novel therapeutic approaches that can change
the course of the disease are urgently needed.
Histone deacetylase (HDAC) inhibitors seem to be
a new class of anticancer agents. In numerous cancers,
alterations in histone acetyl transferase (HAT) or HDAC
activity occur and overactivation of the HDAC enzymes re
sults in histone hypoacetylation. By altering the acetylation
status of an array of substrates, inclu ding histones, trans
cription factors, and chaperone proteins, HDAC inhibitors
have been shown to induce growth arrest, differentiation,
and/or apoptosis of proliferating cancer cells [2–4].
Trichostatin A (TSA), the most common HDAC inhibitor,
has been shown to have antitumor effects on pancreatic
cancer, either alone or in combination with gemcitabine.
These effects may result from alteration of the transcrip
tional profile where genes such as p21, which promotes
cell cycle arrest, are upregulated, whereas genes, such
as 5’nucleotidase UMPH (uridine monophosphate phos
phohydrolase) type α gene, which prevents the formation
of the active forms of gemcitabine, are downregulated
[5–9]. However, until now, therapy with HDAC inhibi
tors has been based on classic proteincoding tumor
suppressor genes, and only a few genes were found to
be affected. Thus, to explore additional mechanisms of
HDAC inhibitors influence, changes of the microRNAs
(miRNAs) expression profile in pancreatic cancer cell line
BxPC3 following treatment with TSA were examined.
miRNAs are ~22 nucleotide (nt) noncoding RNAs
that regulate gene expression by translational repression
when partially complementary sequences are present in
the 3’untranslated regions (3’UTR) of the target mRNAs
or by directing mRNA degradation. miRNAs are ex
pressed in a tissuespecific manner and are considered
to play important roles in cell proliferation, apoptosis, and
differentiation [10–13]. Moreover, altered expression of
miRNAs has been shown to be associated with many
human diseases including cancer. Aberrant miRNAs
expression in pancreatic cancer contributes to tumor
cell proliferation and survival [14–17]. In this study, we
examined whether the HDAC inhibitor TSA can affect
cell growth, apoptosis and alter expression of miRNAs
in pancreatic cancer cell line BxPC3.
MATERIALS AND METHODS
Materials. The human BxPC3 cell line was ob
tained from the American Type Culture Collection
(Manassas, VA). TSA was purchased from Sigma, USA,
dissolved in absolute ethanol and stored at –20 °С.
Cell culture. BxPC3 cells were cultured in RPMI
1640 supplemented with 20 mM glutamine, 10% fetal
bovine serum, 100 IU/mL penicillin, and 100 µg/mL
streptomycin, and were incubated at 37 °C in a humidi
fied incubator with 5% CO2.
Cell viability assay. Cell viability was assessed by
the MTTbased cytotoxicity assay. BxPC3 cells were
trypsinized and seeded in 96well plates at a density of
2 × 103 cells/well and cultured overnight. Cells were then
treated with different concentrations of TSA (0.1, 0.5, 1.0,
2.0 µmol/L) or control (0.1% ethanol) for 24–72 h. At the
completion of incubation, media was replaced with fresh
complete media (100 µl). 4 h before the end of the incuba
tion period, 20 µl of PBS contai ning MTT (5 mg/mL) were
EFFECT OF TRICHOSTATIN A ON VIABILITY AND microRNA
EXPRESSION IN HUMAN PANCREATIC CANCER CELL LINE BxPC-3
S. Zhang1, *, X. Cai2, F. Huang1, W. Zhong1, Z. Yu1
1Department of Gastroenterology, the Second Affiliated Hospital, Sun Yat-sen University,
Guangzhou 510120, China
2Department of Internal Medicine, the Affiliated Cancer Hospital, Guangzhou Medical College,
Guangzhou 510095, China
Aim: To investigate the influence of trichostatin A (TSA) on inhibition of cell proliferation and induction of apoptosis in human pancreatic
cancer cells. Methods: MTT-based cytotoxicity assay was used to evaluate the cell viability after treatment with TSA. Cell cycle distribution
and apoptosis were examined by means of flow cytometry. Expression of microRNA was determined with microRNA array. Expression
of miR-200c and miR-21 was detected by Northern blotting. Results: TSA significantly inhibited the proliferation of BxPC-3 human
pancreatic cancer cells in a time- and dose-dependent manner. BxPC-3 cells treated with TSA were arrested in G0/G1 phase and were
characterized by increased apoptotic rate, accompanied by differential expression of microRNAs. Conclusions: The results suggest that
TSA may activate expression of microRNAs that may act as tumor suppressor in human pancreatic cancer cell line BxPC-3.
Key Words: pancreatic cancer, trichostatin A, microRNA.
Received: July 10, 2008.
*Correspondence: Fax: +86-20-81332244
E-mail: shinengz@hotmail.com
Abbreviations used: HAT — histone acetytransferase; HDAC — his-
tone deacetylase; HDACIs — histone deacetylase inhibitors; PI —
propidium iodide; TSA — trichostatin A; miRNAs — microRNAs;
UMPH — uridine monophosphate phosphohydrolase.
Exp Oncol 2008
30, 4, 265–268
ORIgINAL CONTRIBUTIONS
266 Experimental Oncology 30, 265–268, 2008 (December)
added to each well. Following this, the plates were centri
fuged at 200 × g for 5 min and media was removed. The
precipitate was then resuspended in 150 µl of DMSO. The
absorbance was measured on a plate reader at 570 nm.
Each experiment was performed in triplicates.
Cell cycle analysis. For cell cycle assay, BxPC3
cells (at least 1 × 106 cells) treated with TSA at concen
tration of 1.0 µmol/L or 0.1% ethanol for 24 h were har
vested and washed with PBS, and fixed in 90% ethanol
for 1 h at – 20 °C. Prior to analysis, the cells were washed
and resuspended in PBS, and incubated with 1 g/L of
RNase I and 20 g/L of propidium iodide (PI) at 37 °C for
30 min. Fluorescence was quantified on a flow cytometry,
and the percentage of cells in each phase was calculated
using ModFit software (BD Biosciences).
Apoptosis assessment by Annexin V staining. An
nexin VFITC kit (Jingmei Biotech) was used to measure
the percentage of apoptotic cells induced by 1.0 µmol/L
TSA. After 24 h incubation, cells were harvested and
washed with PBS at 4 °C and then resuspended in 100 µl
of the staining solution containing 5 µl Annexin VFITC
and 10 µl PI. After incubation at room temperature for
15 min, stained cells were analyzed by flow cytometry.
miRNA microarray analysis. miRNA expression
profiling was carried out according to the manufacturer’s
introduction. In brief, miRNA was isolated from untreated
cells and cells treated with 1.0 µmol/L TSA for 6 h using
mirVana miRNA isolation kit according to manufacturer’s
instructions (Ambion). Purified miRNA was labeled with
Cy3 and then hybridized to the miRNA microarray chip
containing 576 human miRNA probes. Each probe on the
microarray slide is printed in duplicate with positive and
negative controls. Following hybridization, the slides were
washed, dried and scaned on a LuxScan 10K/A Scanner
(CapitalBio Corp., China). Database calculations were
done and expression maps were generated with Signifi
cance Analysis of Microarrays (SAM) for Excel.
Northern blotting. To verify the reliability of the
expression changes detected by the profiling analysis
using the microRNA array, Northern blotting with the same
RNA samples that had been used for the microarray was
performed for the elective number of microRNAs. RNA
samples (20 µg each) were separated on 15% denaturing
polyacrylamide gel and then electroblotted onto a Zeta
Probe G1 Blotting Membrane (BioRad). Following trans
fer, the membrane was dried and UV crosslinked. The
probes were prepared using the StatFne Oligonucleo tide
Labeling System (Integrated DNA Technologies) accor
ding to the manufacturer’s protocol. The blots were hy
bridized at 50 °C in a buffer containing 5 × SSC, 20 mmol/L
Na2PO4 (pH 7.2) 7% SDS, 1 × SSC/1% SDS buffer for
16 h. The probe sequences are as follows: miR200c
5’ACATCGTTACCAGACAGTGTTA3’, miR21 5’TCAA
CATCAGTCTGATAAGCTA3’. U6 RNA (5’GCAGGGGC
CATGCTAATCTTCTCTGTATCG3’) was used to normalize.
Statistical analysis. SPSS statistical software (ver
sion 12.0) was used for analysis. Statistical significance
was determined using the analysis of variance (ANOVA).
Data are expressed as mean ± standard deviation (SD).
A Pvalue < 0.05 was considered statistically significant.
RESULTS
TSA inhibited pancreatic cancer cell viabi lity. To
examine the antiproliferative effect of TSA on BxPC3
pancreatic cancer cells, we treated the cells with TSA
at concentrations from 0.1 µmol/L to 2.0 µmol/L for
24–72 h. As shown in Fig.1, TSA significantly inhibited
the viability of BxPC3 cells significantly in a time and
dosedependent manner. Inhibition of cell viability was
observed even at the lowest concentration. Exposure
to TSA for 72 h at the concentration of 2.0 µmol/L
caused a 72.6% (± 0.2) decrease of cell viability.
0
20
40
60
80
100
24 48 72 96
Time (h)
Ce
ll
gr
ow
th
in
hi
bi
tio
n
(%
)
0.1 µmol/L
0.5 µmol/L
1.0 µmol/L
2.0 µmol/L
Fig. 1. The cell viability curve of pancreatic cancer cells BxPC3
treated with TSA. BxPC3 cells were treated with TSA at various con
centrations for 24–72 h and cell viability was measured with MTT. TSA
inhibited cell viability in a dose or timedependent manner, n = 3
Induction of cell cycle arrest and apoptosis by
TSA. Cell cycle analysis showed that 24 h after the
treatment of BxPC3 cells with 1.0 µmol/L TSA, 19%
increase of cells in the G0/G1 phase (P < 0.05, Table 1)
was observed, indicating arrest of the cells at the G0/G1
transition. The flow cytometry analysis with Annexin
VFITC and PI staining showed that TSA induced the
apoptosis of BxPC3 cells. The apoptosis rate was in
creased significantly up to 25% in BxPC3 cells treated
with 1.0 µmol/L TSA vs 5% in the control cells (Fig. 2).
Table 1. Effect of TSA (1.0 µmol/L) on the cell cycle distribution of
BxPC-3 cells (%, mean ± SD)
Groups Cell cycle distribution
G0/G1 S G2/M
Blank 42.5 ± 2.2 33.2 ± 1.9 24.3 ± 3.1
Ethanol 47.3 ± 3.4 27.4 ± 2.3 25.3 ± 1.3
TSA 61.8 ± 2.5* 24.9 ± 4.2 13.3 ± 1.8
Notes: Experiment was carried out in triplicates (106 cells per each sample).
Mean ± SD, *P < 0.05 vs Blank or Ethanol.
Fig. 2. TSA induced cell apoptosis in pancreatic cancer cells
BxPC3. 24 h after treatment, cell apoptosis was detected using
FCM. a, Mock cells; b, Cells treated with ethanol control; c, Cells
treated with 1.0 µmol/L TSA. AnnexinVFITC and PI staining showed
that TSA caused an apoptosis effect. The percentage rate of apop
tosis was significantly increased to 25% in BxPC3 cells treated with
1.0 µmol/L TSA, compared with 5% in control (P < 0.001)
Alteration of miRNAs levels following treatment
with TSA. To assess the response of miRNAs to TSA,
the expression profile of miRNAs from the pancreatic
cancer cell line BxPC3 treated for 6 h with 1.0 µmol/L
TSA was determined by miRNA microarray analysis. Hi
Experimental Oncology 30, 265–268, 2008 (December) 267
erarchical clusterings of miRNAs expression in the TSA
treated and untreated cells are shown in Fig. 3. Upon
TSA treatment, the expression levels of BxPC3 miRNAs
were altered: 24 miRNAs were downregulated and
5 miRNAs were upregulated. To validate these miRNA
microarray results, Northern analysis for several of the
most abundantly expressed miRNAs was performed. As
could be seen from Fig. 4, Northern blots showed the
upregulation of miR200c and the downregulation of
miR21 after TSA treatment of the cells confirming the
miRNA microarray result for these miRNAs.
Fig. 3. Hierarchically clustered (average linkage) heat map of
TSAinduced changes in miRNA expression in BxPC3 cells.
Lane 1–2, untreated; Lane 3–4, TSAtreated. Red, significantly
higher in treated cells; green, significantly lower in treated cells
in comparison with untreated cells
Fig. 4. Northern blots validating array results for miR200c,
which is upregulated, and miR21, which is downregulated.
Blots were normalized with a probe for U6. Lane 1–2, untreated;
Lane 3–4, TSAtreated
DISCUSSION
Accumulating evidence is showing that the HADCs
play an important role in the carcinogenesis, and HADCIs
emerge as a new class of potential anticancer drugs,
because they can induce the growth inhibition, cell cycle
arrest and apoptosis in cancer cell as well as increase the
sensitivity of cancer cell to chemotherapy and ionizing
radiation. The mechanism of HDACIs action, however,
can vary from cell line to cell line [18–21]. Mechanistic
understanding of the antitumor programs initiated by
HDACIs through the transcriptional regulation of key cel
lular genes, at both transcript and protein levels, remains
a challenging problem.
TSA has been reported to have growth inhibition
effect on pancreatic cancer cells, but the exact mecha
nisms have not been well studied. The present studies
have shown that TSA has a dramatic effect on the vi
ability and apoptosis of pancreatic cancer cells.
Several investigators have reported that epigenetic
mechanisms such as DNA methylation and histone modi
fications, can affect the expression of miRNAs [22–25].
LAQ824, one of HDACIs, can lead to a rapid change in
miRNA expression profile in breast cancer cell line SKBr3
[26]. In particular, miR127, which can downregulate
BCL6, was found to be remarkably upregulated in cancer
cell lines after the treatment with 5AzaCdR, a potent DNA
methylation inhibitor, and 4phenylbutyric acid, a histone
deacetylase inhibitor [27]. It was demonstrates that epige
netic drugs may exert their antitumor effects on two fronts:
they not only turn on the tumorsuppressor genes that
were aberrantly silenced epigenetically, but they also turn
on tumorsuppressor miRNAs that downregulate target
oncogenic mRNAs. In contrast to these investigations,
Diederichs et al. [28] did not find significant alterations in
miRNA expression patterns following either DNA demethy
lation or HDAC inhibitor treatment in A549 lung cancer cells.
In our experiment, using miRNA microarray analysis,
we found that 6 h treatment of cells with TSA induced
altered expression of miRNAs: 29 miRNAs including
miR21, 181b, 181d, 221, 126, 375, let7a, and let7c
were significantly downregulated and miR200c, 100,
34a, 146a, and 146b were upregulated. By Northern
blot analysis we showed that miR200c was upregulated
and miR21 was downregulated following TSA treatment.
miR21 is found to be antiapoptotic, and it is upregulated
in hepatocellular cancer [29], breast cancer [30], and
glioblastomas [31]. Considering the expression changes
of miR21 associated with TSA, we postulate that the post
transcriptional effects of HDACIs may play an important
role in mediating their anticancer activity. Park et al [32]
have demonstrated that increasing miR200 levels may
induce mesenchymaltoepithelial transition and reduce
the aggressiveness in human cancer cell lines.
In conclusion, the results of this study show that
TSA is a potent HDACI that is effective in inhibiting
the growth of pancreatic cancer cells in vitro. miRNA
expression profiling of pancreatic cancer cell line
treated with TSA should provide valuable information
for further research on the therapeutic potential of
histone modifications and miRNAs.
ACKNOWLEDgEMENTS
This project was supported by the Natural Scien
ce Foundation of Guangdong Province, China
(No. 04009381, No. 8151008901000139).
REFERENCES
1. Schneider G, Siveke JT, Eckel F, Schmid RM. Pancrea tic
cancer: basic and clinical aspect. Gastroenterology 2005; 128:
1606–25.
268 Experimental Oncology 30, 265–268, 2008 (December)
2. Egger G, Liang G, Aparicio A, Jones PA. Epigenetics in human
disease and prospects for epigenetic therapy. Nature 2004; 429: 457–63.
3. Shankar S, Srivastava RK. Histone deacetylase inhibitors:
mechanisms and clinical significance in cancer: HDAC inhibitor-
induced apoptosis. Adv Exp Med Biol 2008; 615: 261–98.
4. Liu T, Kuljaca S, Tee A, Marshall GM. Histone deacetylase
inhibitors: multifunctional anticancer agents. Cancer Treat Rev
2006; 32: 157–65.
5. Gahr S, Ocker M, Ganslmayer M, et al. The combination
of the histone-deacetylase inhibitor trichostatin A and gemcitabine
induces inhibition of proliferation and increased apoptosis in pan-
creatic carcinoma cells. Int J Oncol 2007; 31: 567–76.
6. Donadelli M, Costanzo C, Beghelli S, et al. Synergistic inhibi-
tion of pancreatic adenocarcinoma cell growth by trichostatin A and
gemcitabine. Biochim Biophys Acta 2007; 1773: 1095–106.
7. Piacentini P, Donadelli M, Costanzo C, et al. Trichostatin A
enhances the response of chemotherapeutic agents in inhibi ting pan-
creatic cancer cell proliferation. Virchows Arch 2006; 448: 797–804.
8. Moore PS, Barbi S, Donadelli M, et al. Gene expression
profiling after treatment with the histone deacetylase inhibitor
trichostatin A reveals altered expression of both pro- and anti-
apoptotic genes in pancreatic adenocarcinoma cells. Biochim
Biophys Acta 2004; 1693: 167–76.
9. Donadelli M, Costanzo C, Faggioli L, et al. Trichostatin A, an
inhibitor of histone deacetylases, strongly suppresses growth of pan-
creatic adenocarcinoma cells. Mol Carcinog 2003; 38: 59–69.
10. Calin GA, Croce CM. MicroRNA signatures in human
cancers. Nat Rev Cancer 2006; 6: 857–66.
11. Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modu-
late hematopoietic lineage differentiation. Science 2004; 303: 83–6.
12. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism,
and function. Cell 2004; 116: 281–97.
13. Ambros V. The functions of animal microRNAs. Nature
2004; 431: 350–5.
14. Bloomston M, Frankel WL, Petrocca F, et al. MicroRNA
expression patterns to differentiate pancreatic adenocarcinoma from
normal pancreas and chronic pancreatitis. JAMA 2007; 297: 1901–8.
15. Szafranska AE, Davison TS, John J, et al. MicroRNA ex-
pression alterations are linked to tumorigenesis and non-neoplastic
processes in pancreatic ductal adenocarcinoma. Oncogene 2007;
26: 4442–52.
16. Lee EJ, Gusev Y, Jiang J, et al. Expression profiling identi-
fies microRNA signature in pancreatic cancer. Int J Cancer 2007;
120: 1046–54.
17. Jiang J, Lee EJ, Gusev Y, Schmittgen TD. Real-time expres-
sion profiling of microRNA precursors in human cancer cell lines.
Nucleic Acids Res 2005; 33: 5394–403.
18. Habold C, Poehlmann A, Bajbouj K, et al. Trichostatin A
causes p53 to switch oxidative-damaged colorectal cancer cells from
cell cycle arrest into apoptosis. J Cell Mol Med 2008; 12: 607–21.
19. Li GC, Zhang X, Pan TJ, et al. Histone deacetylase inhibitor
trichostatin A inhibits the growth of bladder cancer cells through
induction of p21WAF1 and G1 cell cycle arrest. Int J Urol 2006;
13: 581–6.
20. Strait KA, Dabbas B, Hammond EH, et al. Cell cycle
blockade and differentiation of ovarian cancer cells by the histone
deacetylase inhibitor trichostatin A are associated with changed in
p21, Rb, and Id proteins. Mol Cancer Ther 2002; 1: 1181–90.
21. El-Khoury V, Breuzard G, Fourré N, Dufer J. The histone
deacetylase inhibitor trichostatin A downregulates human MDR1
(ABCB1) gene expression by a transcription-dependent mecha-
nism in a drug-resistant small cell lung carcinoma cell line model.
Br J Cancer 2007; 97: 562–73.
22. Yang N, Coukos G, Zhang L. MicroRNA epigenetic altera-
tions in human cancer: one step forward in diagnosis and treatment.
Int J Cancer 2008; 122: 963–8.
23. Chuang JC, Jones PA. Epigenetics and microRNAs. Pediatr
Res 2007; 61: 24R–29R.
24. Saito Y, Jones PA. Epigenetic activation of tumor suppressor
microRNAs in human cancer cells. Cell Cycle 2006; 5: 2220–2.
25. Yu WP, Scott SA, Dong WF. Induction of ID1 expression
and apoptosis by the histone deacetylase inhibitor (trichostatin A) in
human acute myeloid leukaemic cells. Cell Prolif 2008; 41: 86–97.
26. Scott GK, Mattie MD, Berger CE, et al. Rapid alteration
of microRNA levels by histone deacetylase inhibition. Cancer Res
2006; 66: 1277–81.
27. Saito Y, Liang G, Egger G, et al. Specific activa-
tion of microRNA-127 with downregulation of the pro-
to-oncogene BCL6 by chromatin-modifying drugs
in human cancer cells. Cancer Cell 2006; 9: 435–43.
28. Diederichs S, Haber DA. Sequence variations of microRNAs
in human cancer: alterations in predicted secondary structure do
not affect processing. Cancer Res 2006; 66: 6097–104.
29. Meng F, Henson R, Wehbe-Janek H, et al. MicroRNA-21
regulates expression of the PTEN tumor suppressor gene in human
hepatocellular cancer. Gastroenterology 2007; 133: 647–58.
30. Si ML, Zhu S, Wu H, et al. miR-21-mediated tumor
growth. Oncogene 2007; 26: 2799–803.
31. Chan JA, Krichevsky AM, Kosik KS. MicroRNA-21 is
an antiapoptotic factor in human glioblastoma cells. Cancer Res
2005; 65: 6029–33.
32. Park SM, Gaur AB, Lengyel E, et al. The miR-200 fami ly
determines the epithelial phenotype of cancer cells by targe ting the
E-cadherin repressors and ZEB2. Genes Dev 2008; 22: 894–907.
ВЛИЯНИЕ ТРИХОСТАТИНА А НА ВЫЖИВАЕМОСТЬ КЛЕТОК РАКА
ПОДЖЕЛУДОЧНОЙ ЖЕЛЕЗЫ BxPC-3 И ЭКСПРЕССИЮ микроРНК
Цель: изучить влияние трихостатина A (TSA) на ингибирование пролиферации клеток и индукцию апоптоза в клеточной линии
рака поджелудочной железы человека. Методы: для оценки жизнеспособности клеток после их обработки TSA применяли
основанный на MTT цитотоксический тест. Распределение клеток по фазам клеточного цикла и процент апоптических клеток
определяли с помощью проточной цитофлуориметрии. Экспрессию микроРНК изучали с использованием микроРНК-чипа.
Экспрессия miR-200c и miR-21 исследована с помощью Нозерн-блот анализа. Результаты: TSA значительно ингибировал
пролиферацию клеток линии рака поджелудочной железы человека BxPC-3, и этот процесс зависел от времени инкубации
и концентрации препарата. Клетки BxPC-3, обработанные TSA, были остановлены в G0/G1-фазе клеточного цикла, увели-
чивалось количество апоптотических клеток, что сопровождалось изменением экспрессии микроРНК. Выводы: полученные
результаты позволяют предположить, что TSA может активировать экспрессию микроРНК, которые в свою очередь вы-
ступают онкосупрессорами опухоли в клетках линии рака поджелудочной железы BxPC-3.
Ключевые слова: рак поджелудочной железы, трихостатин A, микроРНК.
Copyright © Experimental Oncology, 2008
|