TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia
Defects in the tumor suppressor gene TP53 are known to be important in chronic lymphocytic leukemia (CLL) and TP53 inactivation is associated with a particularly aggressive form of the disease. The single nucleotide polymorphism in the TP53 gene at codon 72 (rs1042522), results in amino acid substit...
Збережено в:
| Дата: | 2014 |
|---|---|
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2014
|
| Назва видання: | Experimental Oncology |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/145384 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia / N.I. Bilous, I.V. Abramenko, A.A. Chumak, I.S. Dyagil, Z.V. Martina // Experimental Oncology. — 2014. — Т. 36, № 4. — С. 258-261. — Бібліогр.: 30 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-145384 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1453842019-01-22T01:23:26Z TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia Bilous, N.I. Abramenko, I.V. Chumak, A.A. Dyagil, I.S. Martina, Z.V. Original contributions Defects in the tumor suppressor gene TP53 are known to be important in chronic lymphocytic leukemia (CLL) and TP53 inactivation is associated with a particularly aggressive form of the disease. The single nucleotide polymorphism in the TP53 gene at codon 72 (rs1042522), results in amino acid substitution influencing apoptotic potential of TP53 protein. The aim of the study was to evaluate the association of the TP53 codon 72 polymorphism and incidence of TP53 mutations in CLL patients. Methods: 261 CLL samples were analyzed by polymerase chain reaction and direct sequencing for TP53 mutations and single nucleotide polymorphism. Results: The 72Pro/Pro genotype was associated with an increased incidence of TP53 mutations in previously treated patients (OR = 2.503; 95% CI 1.142–5.487; р = 0.001). Conclusion: This study revealed that the TP53 codon 72 polymorphism may be used as a risk factor for incidence of TP53 mutations in CLL. Key Words: chronic lymphocytic leukemia, TP53 mutations, single nucleotide polymorphism. 2014 Article TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia / N.I. Bilous, I.V. Abramenko, A.A. Chumak, I.S. Dyagil, Z.V. Martina // Experimental Oncology. — 2014. — Т. 36, № 4. — С. 258-261. — Бібліогр.: 30 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/145384 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Original contributions Original contributions |
| spellingShingle |
Original contributions Original contributions Bilous, N.I. Abramenko, I.V. Chumak, A.A. Dyagil, I.S. Martina, Z.V. TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia Experimental Oncology |
| description |
Defects in the tumor suppressor gene TP53 are known to be important in chronic lymphocytic leukemia (CLL) and TP53 inactivation is associated with a particularly aggressive form of the disease. The single nucleotide polymorphism in the TP53 gene at codon 72 (rs1042522), results in amino acid substitution influencing apoptotic potential of TP53 protein. The aim of the study was to evaluate the association of the TP53 codon 72 polymorphism and incidence of TP53 mutations in CLL patients. Methods: 261 CLL samples were analyzed by polymerase chain reaction and direct sequencing for TP53 mutations and single nucleotide polymorphism. Results: The 72Pro/Pro genotype was associated with an increased incidence of TP53 mutations in previously treated patients (OR = 2.503; 95% CI 1.142–5.487; р = 0.001). Conclusion: This study revealed that the TP53 codon 72 polymorphism may be used as a risk factor for incidence of TP53 mutations in CLL. Key Words: chronic lymphocytic leukemia, TP53 mutations, single nucleotide polymorphism. |
| format |
Article |
| author |
Bilous, N.I. Abramenko, I.V. Chumak, A.A. Dyagil, I.S. Martina, Z.V. |
| author_facet |
Bilous, N.I. Abramenko, I.V. Chumak, A.A. Dyagil, I.S. Martina, Z.V. |
| author_sort |
Bilous, N.I. |
| title |
TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia |
| title_short |
TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia |
| title_full |
TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia |
| title_fullStr |
TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia |
| title_full_unstemmed |
TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia |
| title_sort |
tp53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia |
| publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| publishDate |
2014 |
| topic_facet |
Original contributions |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/145384 |
| citation_txt |
TP53 codon 72 single nucleotide polymorphism in chronic lymphocytic leukemia / N.I. Bilous, I.V. Abramenko, A.A. Chumak, I.S. Dyagil, Z.V. Martina // Experimental Oncology. — 2014. — Т. 36, № 4. — С. 258-261. — Бібліогр.: 30 назв. — англ. |
| series |
Experimental Oncology |
| work_keys_str_mv |
AT bilousni tp53codon72singlenucleotidepolymorphisminchroniclymphocyticleukemia AT abramenkoiv tp53codon72singlenucleotidepolymorphisminchroniclymphocyticleukemia AT chumakaa tp53codon72singlenucleotidepolymorphisminchroniclymphocyticleukemia AT dyagilis tp53codon72singlenucleotidepolymorphisminchroniclymphocyticleukemia AT martinazv tp53codon72singlenucleotidepolymorphisminchroniclymphocyticleukemia |
| first_indexed |
2025-07-10T21:33:16Z |
| last_indexed |
2025-07-10T21:33:16Z |
| _version_ |
1837297261297532928 |
| fulltext |
258 Experimental Oncology 36, 258–261, 2014 (December)
TP53 CODON 72 SINGLE NUCLEOTIDE POLYMORPHISM
IN CHRONIC LYMPHOCYTIC LEUKEMIA
N.I. Bilous*, I.V. Abramenko, A.A. Chumak, I.S. Dyagil, Z.V. Martina
SE “National Research Center for Radiation Medicine, National Academy of Medical Sciences
of Ukraine”, 53 Melnikov Str., Kyiv 04050, Ukraine
Defects in the tumor suppressor gene TP53 are known to be important in chronic lymphocytic leukemia (CLL) and TP53 inac-
tivation is associated with a particularly aggressive form of the disease. The single nucleotide polymorphism in the TP53 gene
at codon 72 (rs1042522), results in amino acid substitution influencing apoptotic potential of TP53 protein. The aim of the study
was to evaluate the association of the TP53 codon 72 polymorphism and incidence of TP53 mutations in CLL patients. Methods:
261 CLL samples were analyzed by polymerase chain reaction and direct sequencing for TP53 mutations and single nucleotide
polymorphism. Results: The 72Pro/Pro genotype was associated with an increased incidence of TP53 mutations in previously treated
patients (OR = 2.503; 95% CI 1.142–5.487; р = 0.001). Conclusion: This study revealed that the TP53 codon 72 polymorphism
may be used as a risk factor for incidence of TP53 mutations in CLL.
Key Words: chronic lymphocytic leukemia, TP53 mutations, single nucleotide polymorphism.
Chronic lymphocytic leukemia (CLL) is characte-
rized by a highly variable clinical course, ranging from
indolent cases to cases with aggressive and rapidly
progressing disease [1]. Several prognostic mar kers
have been identified, including different genomic
aberrations. Defects in the tumor suppressor gene
TP53 was found to be associated with particularly
poor prognosis. The TP53 protein plays a crucial role
in cellular response to DNA damage by induction
of apoptosis, cell cycle arrest and DNA repair, thus
maintaining genomic integrity and mediating the ac-
tion of DNA damaging chemotherapy, as well [2].
Inactivation of TP53 due to deletion of TP53 gene locus
(17p13), which in the majority of cases (over 80%)
is accompanied by mutation in the remaining TP53 al-
lele, or due to TP53 mutation alone have been associ-
ated with short survival and chemotherapy resistance
in a number of studies [3–7]. CLL patients with mutated
TP53 are considered a high-risk prognostic group, who
should be offered alternative therapy strategies, acting
independently of TP53 pathway [8, 9].
The TP53 gene aberrations are relatively infrequent
at stage of CLL diagnosis or at time of initial therapy,
ranging from 10% to 15% of cases. However, the inci-
dence rises up to 40–50% in group of patients previously
treated with chemotherapy and undergo refractory CLL
[10, 11]. Some known markers of unfavorable CLL prog-
nosis are reported as risk factors for TP53 aberrations —
an increased expression of CD38, ZAP-70, and unmu-
tated status of immunoglobulin heavy chain variable
region (IGHV) genes [12, 13]. Recently some preliminary
data were presented indicating the association between
TP53 mutations and single nucleotide polymorphism
(SNP) within the TP53 gene at codon 72 (rs1042522).
This polymorphism encodes either arginine (72Arg,
genotype CGC) or proline (72Pro, genotype CCC) and
significantly affects TP53 function. The 72Arg vari-
ant is more effective at inducing apoptosis than the
72Pro, while the 72Pro/Pro genotype was associated
with an increased expression of cell cycle arrest genes
[14]. Grossmann et al. and Dong et al. have found
an increased incidence of TP53 mutations and dele-
tions in CLL patients with the 72Pro/Pro genotype [15,
16]. The same association was found in patients with
non-melanoma skin cancer [17]. On the contrary, lung
cancer patients who were the 72Pro allele carriers had
significantly lower frequency of TP53 mutations in com-
parison with 72Arg homozygotes [18].
To further substantiate the role of the TP53 codon
72 polymorphism as a risk factor for TP53 mutations,
we have analyzed the TP53 mutational status in CLL
patients, carriers of different genotypes in relation
to clinical characteristics and some molecular pecu-
liarities of B-cell receptor of leukemic cells.
MATERIALS AND METHODS
The TP53 codon 72 SNP was analyzed in 261 con-
secutive patients with CLL, 198 males (75.5%) and
63 females (24.5%), median age of 58 years at CLL
diagnosis (range 29–86 years), referred to the State
Institution “National Research Centre for Radiation
Medicine, National Academy of Medical Sciences
of Ukraine”, Kyiv, Ukraine. All patients were inhabitants
of the central part of Ukraine. The study was approved
by the local Ethics Review Committee, and all patients
signed an informed consent form prior to participation
in the study. CLL was diagnosed on the basis of clini-
cal history, blood lymphocytosis lymphocyte mor-
phology, and immunophenotypic criteria. The stage
of the disease was assessed by Binet [19] and Rai
classification [20]. The treatment was initiated in ac-
cordance with the National Cancer Institute of USA
(NCI) criteria [21].
Submitted: October 23, 2014.
*Correspondence: Fax: (044) 483–06–37;
E-mail: nbilous@yahoo.com
Abbreviations used: CLL — chronic lymphocytic leukemia; IGHV —
immunoglobulin heavy chain variable region; SNP — single nucleo-
tide polymorphism.
Exp Oncol 2014
36, 4, 258–261
Experimental Oncology 36, 258–261, 2014 (December) 259
Genomic DNA was extracted from peripheral blood
mononuclear cells with the QIAamp Blood Mini Kit (Qia-
gen, Crawley, United Kingdom) according to the manu-
facturer’s protocol. At the time of blood samples col-
lection, 172 (65.9%) patients were either at diagnosis
or before the initial treatment (median of observation
was 41 months) and remained 89 of 261 (34.1%) patients
received therapy (median of observation was 75 months).
The IGHV gene mutational status was assessed by PCR
amplification followed by direct sequencing according
to the BIOMED-2 consortium rules [22], as described
above [23]. Sequences were analyzed using the IgBlast
and IMGT databases. The IGHV gene was considered un-
mutated when the identity to the corresponding germline
gene was more than or equal 98%.
TP53 gene mutation analysis was performed for
exons 3–10 in the majority of cases (245/261), and for
exons 5–9 (region, where the vast majority of muta-
tions are located), in 16 cases. Study was done by PCR
amplification followed by direct sequencing with Big-
Dye Term v3.1 cycle sequencing chemistry (Applied
Biosystems Foster City, CA). Data were compared
with reference TP53 gene sequence NC_000017.10,
and mutations were validated using the International
Agency for Research on Cancer (IARC) TP53 Mu-
tation Database (www.p53.iarc.fr) [24]. For exons
3–10 analysis five fragments were amplified, spanning
3–4, 5–6, 7, 8–9 and 10 exons. Primers were kindly
designed by Dr. V. Saenko (Atomic Bomb Disease
Institute, Nagasaki University), all primer sequences
are available on demand. PCR was performed using
10 ng of DNA in a 25 μL reaction mixture containing
0.3 μM of each primer, 1.5 mM MgCl2, 0,8 mM dNTPs,
and 0.125 U of AmpliTaqGold DNA polymerase (Applied
Biosystems, Foster City, CA, USA), or 0.25 U of KOD-
Plus-Neo DNA polymerase (Toyobo, Osaka, Japan).
PCR conditions were optimized for each primer pair.
In cases, where exons 5–9 only were analyzed, PCR
primers and reaction conditions according to IARC
protocol, 2010 were used (www.p53.iarc.fr). Primers
and length of amplified fragments are listed in Table 1.
PCR was performed with 50 ng of DNA in a total volume
of 25 μL reaction mixture consisting of 0.4 μM of each
primer, 1.5 mM MgCl2, 0.8 mM dNTPs, 0.125 U of Am-
pliTaqGold DNA polymerase (Applied Biosystems,
Foster City, CA, USA). PCR conditions were as follows:
initial denaturation step of 3 min at 95 °C, 20 cycles
of 30 s at 95 °C, 45 s at 63 °C (reducing at 0.5 °C every
3 cycles) and 45 s at 72 °C, with following 30 cycles
of 30 s at 95 °C, 45 s at 60 °C and 45 s at 72 °C.
Table 1. Primer sequences used for the TP53 gene mutation analysis
( exons 5–9)
Region
amplified Forward primer (5´ 3´) Reverse primer (5´ 3´)
Ampli-
con
size
Exons 5–6 TGTTCACTTGTGCCCTGACT TTAACCCCTCCTCCCAGAGA 467 bp
Exon 7 AGGCGCACTGGCCTCATCTT TGTGCAGGGTGGCAAGTGGC 177 bp
Exons 8–9 TTGGGAGTAGATGGAGCCT AGTGTTAGACTGGAAACTTT 445 bp
The TP53 codon 72 SNP was assessed by analysis
of exon 4 fragment sequences (Fig. 1), or by PCR-re-
striction fragment length polymorphism (RFLP) method
according to Hirata et al. [25] in that cases, where exons
5–9 only were analyzed. For genotyping by RFLP me-
thod PCR was carried out using 50 ng of DNA in a total
volume of 20 μL consisting of 0.5 μM each forward pri-
mer (5´-TCTGGGAAGGGACAGAAGATGAC-3´) and re-
verse primer (5´-TTGCCGTCCCAAGCAATGGATGA-3´),
1.5 mM MgCl2, 0.8 mM dNTPs, 1.25 unit Taq DNA
polymerase (Thermo Scientific). The PCR conditions
were as follows: initial denaturation step of 3 min
at 95 °C, 35 cycles of 30 s at 95 °C, 30 s of annealing
at 57 °C, and 30 s of extension at 72 °C. The amplified
199-bp fragments were digested with BstUI (Thermo
Scientific) by the manufacturers’ protocols. The di-
gested PCR products were resolved on 3% agarose
gel containing ethidium bromide and visualized under
UV light. The presence of the TP53 72G allele re-
sulted in the digestion of the amplicon to 113 bp and
86 bp products, the presence of 72C allele displayed
as non-digested 199-bp product (Fig. 2).
Fig. 1. Sequencing data of observed CLL patients' samples for
TP53 exon 4 analysis (region of TP53 codon 72 SNP location):
GG (Arg/Arg), CG (Arg/Pro), CC (Pro/Pro) genotypes
1 2 3 4 5 6 7 8 9 10 11 50 bp
— 200 bp
— 100 bp
— 50 bp
Fig. 2. Results of TP53 codon 72 polymorphism detection
by polymerase chain reaction and digestion with BstUI in ob-
served CLL patients: Line 1, 3, 4, 6, 7 and 8 — Arg/Arg genotype
(86 bp and 113 bp bands); line 2, 9, 10 and 11 — Arg/Pro genotype
(86 bp, 113 bp and 199 bp bands); line 5 — Pro/Pro genotype
(199 bp band); 50 bp DNA size markers
Statistics were performed using the SPSS
16.0 software package (SPSS, Chicago, IL).
TP53 rs1042522 polymorphism was tested for devia-
tion from the Hardy — Weinberg equilibrium by com-
paring the observed and expected genotype frequen-
cies using the χ2 test with one degree of freedom. Data
shown are the means plus or minus standard devia-
tions, and medians. The χ2 test for categorical variables
was used to compare characteristics between diffe-
rent subgroups of patients. The relative significance
of different factors on TP53 mutation occurrence was
evaluated by univariate and multivariate analysis. All
tests were two-sided and considered to be statistically
significant with a p-value of < 0.05.
RESULTS AND DISCUSSION
Analysis of the TP53 codon 72 polymorphism in 261 CLL
patients resulted in frequencies of 0.68 and 0.32 for
the G and C allele, respectively (Arg/Arg — 124 cases,
47.5%; Arg/Pro — 109 cases, 41.8%; Pro/Pro — 28 cases,
260 Experimental Oncology 36, 258–261, 2014 (December)
10.7%). Genotype frequencies did not differ sig-
nificantly from those predicted by Hardy — Weinberg
equilibrium (χ2 = 1.29; p = 0.273). These results are
comparable with data from CLL group presented
by Sturm et al. [26] (Arg/Arg — 57.3%; Arg/Pro —
36.1%; Pro/Pro — 6.6%).
TP53 mutations were found in 21 of 261 patients
(8%) in this study. Most of mutations were detected
in the DNA-binding domain (exons 5–8), namely,
in exon 5 (4 patients), exon 6 (5 patients), exon 7 (4 pa-
tients), and exon 8 (3 patients). In three patients TP53 mu-
tations were detected in exon 9 (C-terminal region)
and in two patients — in exon 4 (proline rich region).
Of the 28 cases homozygous for the 72Pro allele,
7 cases (25%) carried mutation in the TP53 gene.
In contrast, of the 124 cases which were homozy-
gous for the 72Arg allele, 6 cases only (4.8%) had
the TP53 mutation (Table 2). Thus, TP53 mutations
were significantly more often found in CLL patients
carriers of Pro/Pro genotype (p = 0.002).
Table 2. TP53 mutations in relation to the TP53 codon 72 genotypes and
previous therapy
CLL patients The frequency of TP53 mutations, cases (%) p valueArg/Arg Arg/Pro Pro/Pro
All patients, n=261 6 of 124 (4.8) 8 of 109 (7.3) 7 of 28 (25.0) 0.002
Untreated, n=172 5 of 85 (5.9) 2 of 70 (2.9) 0 of 17 (0.0) 0.427
Treated, n=89 1 of 39 (2.6) 6 of 39 (15.4) 7 of 11 (63.6) 0.0001
Previously treated patients showed a higher
frequency of TP53 mutations in comparison with
untreated patients (p = 0.001). Time to treatment
(p = 0.446), duration of therapy (p = 0.997) did not
differ significantly in carriers of different TP53 co-
don 72 genotypes. The incidence of TP53 mutations
among previously treated patients was also higher
in carriers of the Pro/Pro genotype comparing to carri-
ers of the other genotypes (p = 0.0001), and in carriers
of the Pro allele comparing to carriers of the Arg/Arg
genotype (13 of 50 patients, 26.0% and 1 of 39 pa-
tients, 2.6%, correspondingly; p = 0.003). At the same
time, among untreated patients the distribution
of TP53 mutations did not differ in carriers of different
genotypes (p = 0.427) and in carriers of the Pro allele
in comparison with carriers of the Arg/Arg genotype
(2 of 87 patients, 2.3% and 5 of 85 patients, 5.9%,
correspondingly; p = 0.234). The risk of TP53 mu-
tations occurrence among pretreated patients was
increased in carriers of the Pro allele (Odds ratio,
OR = 1.317; 95% confidence interval, CI 1.109–1.564)
and in carriers of the Pro/Pro genotype (OR = 2.503;
95% CI 1.142–5.487).
To estimate the impact of some clinical and biologi-
cal factors on the incidence of TP53 mutations we used
univariate Cox regression analysis. Clinical data at diag-
nosis were available for the most of CLL cases. Several
factors were included: age of patients (cut-off point
at 65 years), gender, Binet stage at diagnosis, initial
WBC count (cut-off point at 100•109/L), IGHV mutati-
onal status, previous treatment, TP53 codon 72 geno-
type. As shown in Table 3, the 72Pro/Pro genotype,
previous treatment and Binet stage B only correlated
significantly with the occurrence of TP53 mutations.
Multivariate Cox regression analysis confirmed an in-
dependent significance of abovementioned factors for
TP53 mutations occurrence.
Table 3. Significance of some clinical and biological factors for occurrence
of TP53 mutations under univariate and multivariate Cox regression analysis
Factors N
Univariate
analysis
Multivariate
analysis
TP53 muta-
tions, n (%) p value p value
Age (years)
> 65 62 9.7 (6) 0.629 0.344< 65 194 7.7 (15)
Sex
Male 195 9.6 (19) 0.102 0.741Female 63 3.2 (2)
Binet stage at diagnosis
A 133 4.5 (6)
0.076 −B 97 13.4 (13)
C 31 6.5 (2)
Binet stage at diagnosis
B 97 13.4 (13) 0.011 0.023A + C 164 4.9 (8)
Initial WBC counts, · 109/L
> 100 30 10.0 (3) 0.703 0.509< 100 226 8.0 (18)
IGHV genes
M 92 5.4 (5) 0.346 0.396UM 161 8.7 (14)
TP53 codon 72 genotypes
Pro/Pro 28 25.0 (7) 0.001 0.001Arg/Arg+Arg/Pro 231 6.1 (14)
Treatment
Untreated 172 4.1 (7) 0.001 0.001Treated 89 15.7 (14)
Thus, our data are in agreement with results
of Grossmann et al. [15] and Dong et al. [16], who
have found an increased incidence of TP53 mutations
in CLL patients, carriers of the 72Pro/Pro genotype.
However, we found that the frequency of TP53 muta-
tions in 72Pro homozygotes was increased only after
previous treatment.
The TP53 codon 72 alleles encode an arginine
amino acid with a positive-charged basic side chain
and a proline residue with a nonpolar-aliphatic side
chain, which have different biochemical properties and
different binding to components of the transcriptional
machinery [27]. On the other hand, it is known that
purine analogues and alkylating agents induce a TP53-
dependent gene expression response [28, 29], and
the occurrence of TP53 gene alterations in CLL patients
is associated with previous chemotherapy by these
drugs [30]. It is possible, that some conformational fea-
tures of TP53 protein and TP53-containing complexes
in carriers of the Pro/Pro genotype contribu te to the de-
velopment of TP53 mutations under drug-induced high
expression of this gene. Another possible explanation
of our findings may by related to different functional
properties of TP53 polymorphic variants. The 72Arg
is more effective at inducing apoptosis than the 72Pro
variant, while the Pro/Pro genotype is associated with
an increased expression of cell cycle arrest genes [14].
Preferential cell cycle arrest and slowing apoptosis may
contribute to an inadequate repair of DNA damages
under action of genotoxic stimulus and accumulation
of cells with TP53 mutations.
In summary, our preliminary data suggested that CLL
patients with the Pro/Pro genotype are a risk group for de-
velopment of TP53 mutations under modern treatment.
Experimental Oncology 36, 258–261, 2014 (December) 261
REFERENCES
1. Chiorazzi N, Rai KR, Ferrarini M. Chronic Lympho-
cytic Leukemia. N Engl J 2005; 352: 804–15.
2. Pozzo F, Dal Bo M, Peragine N, et al. Detection
of TP53 dysfunction in chronic lymphocytic leukemia
by an in vitro functional assay based on TP53 activation
by the non-genotoxic drug Nutlin-3: a proposal for clinical
application. J Hematol Oncol 2013; 6: 83–94.
3. Dohner H, Fischer K, Bentz M, et al. p53 gene deletion
predicts for poor survival and non-response to therapy with purine
analogs in chronic B-cell leukemias. Blood 1995; 85: 1580–9.
4. Gonzalez D, Martinez P, Wade R, et al. Mutational
status of the TP53 gene as a predictor of response and survival
in patients with chronic lymphocytic leukemia: results from
the LRF CLL4 trial. J Clin Oncol 2011; 29: 2223–9.
5. Zenz T, Krober A, Scherer K, et al. Monoallelic
TP53 inactivation is associated with poor prognosis in chronic
lymphocytic leukemia: results from a detailed genetic charac-
terization with long-term follow-up. Blood 2008; 112: 3322–9.
6. Rossi D, Cerri M, Deambrogi C, et al. The prognostic
value of TP53 mutations in chronic lymphocytic leukemia is in-
dependent of Del17p13: implications for overall survival and
chemorefractoriness. Clin Cancer Res 2009; 15: 995–1004.
7. Dicker F, Herholz H, Schnittger S, et al. The detection
of TP53 mutations in chronic lymphocytic leukemia indepen-
dently predicts rapid disease progression and is highly correlated
with a complex aberrant karyotype. Leukemia 2009; 23: 117–24.
8. Hallek M, Cheson BD, Catovsky D, et al. Guidelines
for the diagnosis and treatment of chronic lymphocytic leu-
kemia: A report from the International Workshop on Chronic
Lymphocytic Leukemia updating the National Cancer Institute-
Working Group 1996 guidelines. Blood 2008; 111: 5446–56.
9. Stilgenbauer S, Zenz T. Understanding and managing
ultra high-risk chronic lymphocytic leukemia. Hemato logy
2010; 2010: 481–8.
10. Dohner H, Stilgenbauer S, Benner A, et al. Genomic
aberrations and survival in chronic lymphocytic leukemia.
N Engl J Med 2000; 343: 1910–6.
11. Zenz T, Habe S, Denzel T, et al. Detailed analysis
of p53 pathway defects in fludarabine-refractory chronic lym-
phocytic leukemia (CLL): dissecting the contribution of 17p
deletion, TP53 mutation, p53-p21 dysfunction, and miR34a
in a prospective clinical trial. Blood 2009; 114: 2589–97.
12. Rassenti LZ, Jain S, Keating M J, et al. Relative value
of ZAP-70, CD38, and immunoglobulin mutation status
in predicting aggressive disease in chronic lymphocytic leu-
kemia. Blood 2008; 112: 1923–30.
13. Krober A, Bloehdorn J, Hafner S, et al. Additional ge-
netic high-risk features such as 11q deletion, 17p deletion, and
V3–21 usage characterize discordance of ZAP-70 and VH muta-
tion status in chronic lymphocytic leukemia. J Clin Onc 2006;
24: 969–75.
14. Malcikova J, Pavlova S, Kozubik KS, Pospisi-
lova S. TP53 mutation analysis in clinical practice: lessons from
chronic lymphocytic leukemia. Hum Mutat 2014; 56: 663–71.
15. Grossmann V, Artusi V, Schnittger S, et al.
The TP53 codon 72 polymorphism is associated with TP53 mu-
tations in chronic lymphocytic leukemia. ASH-2011. Oral and
Poster Abstracts Session 2011; 641: 1178.
16. Dong H, Fang C, Wang L, et al. TP53 Pro72 allele poten-
tially increases the poor prognostic significance of TP53 mutation
in chronic lymphocytic leukemia. Med Oncol 2014; 31: 908–11.
17. Almquist LM, Karagas MR, Christensen BC, et al.
The role of TP53 and MDM2 polymorphisms in TP53 muta-
genesis and risk of non-melanoma skin cancer. Carcinogenesis
2011; 32: 327–30.
18. Lind H, Ekstrom PO, Ryberg D, et al. Frequency
of TP53 mutations in relation to Arg72Pro genotypes in non
small cell lung cancer. Cancer Epidemiol Biomarkers Prev
2007; 16: 2077–81.
19. Binet JL, Auguier A, Dighiero G, et al. A new prognos-
tic classification of chronic lymphocytic leukemia derived from
a multivariate survival analysis. Cancer 1981; 48: 198–205.
20. Rai KR, Sawitzky A, Cronkite EP, et al. Clinical staging
of chronic lymphocytic leukemia. Blood 1975; 46: 219–34.
21. Hallek M, Cheson BD, Catovsky D, et al. International
Workshop on Chronic Lymphocytic Leukemia. Guidelines
for the diagnosis and treatment of chronic lymphocytic leu-
kemia: a report from the International Workshop on Chronic
Lymphocytic Leukemia updating the National Cancer Institute-
Working Group 1996 guidelines. Blood 2008; 111: 5446–56.
22. van Dongen JJ, Langerak AW, Bruggemann M, et al.
Design and standardization of PCR primers and protocols
for detection of clonal immunoglobulin and T-cell receptor
gene recombinations in suspect lymphoproliferations: report
of the BIOMED-2 Concerted Action BMH4-CT98–3936.
Leukemia 2003; 17: 2257–317.
23. Abramenko I, Bilous N, Chumak A, et al. Chronic
lymphocytic leukemia patients exposed to ionizing radiation
due to the Chernobyl NPP accident – with focus on immuno-
globulin heavy chain gene analysis. Leuk Res 2008; 32: 535–45.
24. Pospisilova S, Gonzalez D, Malcikova J, et al. Euro-
pean Research Initiative on CLL (ERIC). ERIC recommen-
dations on TP53 mutation analysis in chronic lymphocytic
leukemia. Leukemia 2012; 26: 1458–61.
25. Hirata H, Hinoda Y, Kikuno N, et al. MDM2 SNP309
polymorphism as risk factor for susceptibility and poor progno-
sis in renal cell carcinoma. Clin Cancer Res 2007; 13: 4123–9.
26. Sturm I, Bosanquet AG, Hummel M, et al. In B-CLL,
the codon 72 polymorphic variants of p53 are not related to drug
resistance and disease prognosis. Cancer 2005; 5: 105–9.
27. Grochola LF, Zeron-Medina J, Meriaux S,
Bond GL. Single-nucleotide polymorphisms in the p53 signa-
ling pathway. Cold Spring Harb Perspect Biol 2010;13: a001032.
28. Rosenwald A, Chuang E, Davis R et al. Fludarabine treat-
ment of patients with chronic lymphocytic leukemia induced a p53-
dependent gene expression response. Blood 2004; 104: 1428–34.
29. Begleiter A, Mowat M, Israels LG, Johnston JB. Chlo-
rambucil in chronic lymphocytic leukemia: mechanism of ac-
tion. Leuk Lymphoma 1996; 23: 187–201.
30. Sturm I, Bosanquet AG, Hermann S, et al. Mutation
of p53 and consecutive selective drug resistance in B-CLL oc-
curs as a consequence of prior DNA-damaging chemotherapy.
Cell Death Differ 2003; 10: 477–84.
Copyright © Experimental Oncology, 2014
|