Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
Gaucher disease (MIM 230800) is the most common storage disorder, caused by hereditary deficiency of the lysosomal enzyme of glucocerebrosidase (EC 3.2.1.45). Human glucocerebrosidase gene (GBA) is mapped to the 1q21 locus, it is 7.5 kb long and consists of 11 exons. According to human gene mutation...
Збережено в:
| Дата: | 2017 |
|---|---|
| Автори: | , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут молекулярної біології і генетики НАН України
2017
|
| Назва видання: | Вiopolymers and Cell |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/152889 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease / N.V. Olkhovych, A.M. Nedoboy, N.O. Pichkur, N.H. Gorovenko // Вiopolymers and Cell. — 2017. — Т. 33, № 1. — С. 34-47. — Бібліогр.: 26 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-152889 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1528892019-06-14T01:27:57Z Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease Olkhovych, N.V. Nedoboy, A.M. Pichkur, N.O. Gorovenko, N.H. Biomedicine Gaucher disease (MIM 230800) is the most common storage disorder, caused by hereditary deficiency of the lysosomal enzyme of glucocerebrosidase (EC 3.2.1.45). Human glucocerebrosidase gene (GBA) is mapped to the 1q21 locus, it is 7.5 kb long and consists of 11 exons. According to human gene mutation databases, there are over 300 currently described pathogenic GBA variants, most of them are related to the development of Gaucher disease. Aim. To identify rearrangements in the GBA gene which conditioned the development of Gaucher disease in Ukrainian patients, to compare their spectrum with the variants in patients from Slavonic and other European countries and to evaluate genotype-phenotype associations for this disease. Methods. The Sanger’s method of direct automated sequencing using ABI 3130 analyzer (Applied Biosystems). Results. We identified 96.8 % of mutant alleles in Ukrainian patients with Gaucher disease. Six new and previously not described rearrangements of the GBA gene were identified. Conclusion. The comparison of genotypes with the linical form of the disease demonstrated that our results agree with the currently recognized genotype-phenotype correlations, which allow predicting the type and clinical course of the Gaucher disease to some degree. Хвороба Гоше (MIM 230800) є найбільш поширеним захворюванням накопичення, яке спричинене спадковим дефіцитом лізосомного ферменту глюкоцереброзідази (EC 3.2.1.45). Ген глюкоцереброзідази (GBA) картований в локусі 1q21, його довжина 7,5 тис. п. н. і складається з 11 екзонів. За даними найбільших баз даних мутацій генів людини, існує більше 300 описаних в даний час патогенних варіантів гена GBA, більшість з них пов’язані з розвитком хвороби Гоше. Мета. Виявлення перебудов в гені GBA, які зумовили розвиток хвороби Гоше у хворих в Україні, порівняння їх частоти і спектру з варіантами у пацієнтів з інших європейських країн, а також оцінка генотип-фенотип асоціації для цього захворювання. Методи. Метод прямого автоматичного сиквенування за Сенгером на аналізаторі ABI 3130 (Applied Biosystems). Результати. Застосування різних молекулярних і генетичних підходів, включаючи пряме секвенування послідовності гена, дозволило нам ідентифікувати 96,8% мутантних алелів у українських пацієнтів з хворобою Гоше. Також були виявлені шість нових раніше не описаних перебудов послідовності гена GBA. Висновки. Порівняння виявлених у пацієнтів генотипів з клінічною формою захворювання показали, що отримані результати не суперечать сучасним визнаним генотип-фенотип кореляціям, які дозволяють певною мірою прогнозувати тип і клінічний перебіг хвороби Гоше. Болезнь Гоше (MIM 230800) является наиболее распространенным заболеванием накопления, которое вызвано наследственным дефицитом лизосомного фермента глюкоцереброзидазы (EC 3.2.1.45). Ген глюкоцереброзидазы (GBA) картирован в локусе 1q21, его длина 7,5 тыс. п. н. и состоит из 11 экзонов. По данным крупнейших баз данных мутаций генов человека, существует более 300 описанных в настоящее время патогенных вариантов гена GBA, большинство из них связаны с развитием болезни Гоше. Цель. Выявление перестроек в гене GBA, которые обусловили развитие болезни Гоше у больных в Украине, сравнение их частоты и спектра с вариантами у пациентов из других европейских стран, а также оценки генотип-фенотип ассоциации для этого заболевания. Методы. Метод прямого автоматического секвенирования по Сенгеру на анализаторе ABI 3130 (Applied Biosystems). Результаты. Применение различных молекулярных и генетических подходов, включая прямое секвенирование последовательности гена, позволило нам идентифицировать 96,8% мутантных аллелей у украинских пациентов с болезнью Гоше. Также были обнаружены шесть новых ранее не описанных перестроек последовательности гена GBA. Выводы. Сравнение выявленных у пациентов генотипов с клинической формой заболевания показали, что полученные результаты не противоречат современным признанным генотип-фенотипическим корреляциям, позволяющим в определенной степени прогнозировать тип и клиническое течение болезни Гоше. 2017 Article Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease / N.V. Olkhovych, A.M. Nedoboy, N.O. Pichkur, N.H. Gorovenko // Вiopolymers and Cell. — 2017. — Т. 33, № 1. — С. 34-47. — Бібліогр.: 26 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000940 http://dspace.nbuv.gov.ua/handle/123456789/152889 616-056.7-07 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Biomedicine Biomedicine |
| spellingShingle |
Biomedicine Biomedicine Olkhovych, N.V. Nedoboy, A.M. Pichkur, N.O. Gorovenko, N.H. Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease Вiopolymers and Cell |
| description |
Gaucher disease (MIM 230800) is the most common storage disorder, caused by hereditary deficiency of the lysosomal enzyme of glucocerebrosidase (EC 3.2.1.45). Human glucocerebrosidase gene (GBA) is mapped to the 1q21 locus, it is 7.5 kb long and consists of 11 exons. According to human gene mutation databases, there are over 300 currently described pathogenic GBA variants, most of them are related to the development of Gaucher disease. Aim. To identify rearrangements in the GBA gene which conditioned the development of Gaucher disease in Ukrainian patients, to compare their spectrum with the variants in patients from Slavonic and other European countries and to evaluate genotype-phenotype associations for this disease. Methods. The Sanger’s method of direct automated sequencing using ABI 3130 analyzer (Applied Biosystems). Results. We identified 96.8 % of mutant alleles in Ukrainian patients with Gaucher disease. Six new and previously not described rearrangements of the GBA gene were identified. Conclusion. The comparison of genotypes with the linical form of the disease demonstrated that our results agree with the currently recognized genotype-phenotype correlations, which allow predicting the type and clinical course of the Gaucher disease to some degree. |
| format |
Article |
| author |
Olkhovych, N.V. Nedoboy, A.M. Pichkur, N.O. Gorovenko, N.H. |
| author_facet |
Olkhovych, N.V. Nedoboy, A.M. Pichkur, N.O. Gorovenko, N.H. |
| author_sort |
Olkhovych, N.V. |
| title |
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease |
| title_short |
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease |
| title_full |
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease |
| title_fullStr |
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease |
| title_full_unstemmed |
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease |
| title_sort |
analysis of mutations in gba gene in ukrainian patients with gaucher disease |
| publisher |
Інститут молекулярної біології і генетики НАН України |
| publishDate |
2017 |
| topic_facet |
Biomedicine |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/152889 |
| citation_txt |
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease / N.V. Olkhovych, A.M. Nedoboy, N.O. Pichkur, N.H. Gorovenko // Вiopolymers and Cell. — 2017. — Т. 33, № 1. — С. 34-47. — Бібліогр.: 26 назв. — англ. |
| series |
Вiopolymers and Cell |
| work_keys_str_mv |
AT olkhovychnv analysisofmutationsingbageneinukrainianpatientswithgaucherdisease AT nedoboyam analysisofmutationsingbageneinukrainianpatientswithgaucherdisease AT pichkurno analysisofmutationsingbageneinukrainianpatientswithgaucherdisease AT gorovenkonh analysisofmutationsingbageneinukrainianpatientswithgaucherdisease |
| first_indexed |
2025-07-14T04:21:30Z |
| last_indexed |
2025-07-14T04:21:30Z |
| _version_ |
1837594723126083584 |
| fulltext |
34
N. V. Olkhovych, A. M. Nedoboy, N. O. Pichkur
© 2017 N. V. Olkhovych et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Bio-
polymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium,
provided the original work is properly cited
UDC 616-056.7-07
Analysis of mutations in GBA gene in Ukrainian patients
with Gaucher disease
N. V. Olkhovych1, A. M. Nedoboy2, N. O. Pichkur2, N. H. Gorovenko1
1 State Institute of Genetic and Regenerative Medicine, NAMS of Ukraine
67, Vyshhorodska Str., Kyiv, Ukraine, 04114
2 National Children's Specialized Hospital Okhmatdyt, Ministry of Health of Ukraine
28/1, Chornovola Str., Kyiv, Ukraine, 01135
nolhovich@gmail.com
Gaucher disease (MIM 230800) is the most common storage disorder, caused by hereditary
deficiency of the lysosomal enzyme of glucocerebrosidase (EC 3.2.1.45). Human glucocerebro-
sidase gene (GBA) is mapped in locus lq21, it is 7.5 kb long and consists of 11 exons. According
to the data of the largest human gene mutation databases, there are over 300 currently described
pathogenic variants of GBA gene, most of them are related to the development of Gaucher
disease. Aim. To identify rearrangements in the GBA gene which conditioned the development
of Gaucher disease in Ukrainian patients, to compare their spectrum with the variants in patients
from Slavonic and other European countries and to evaluate genotype-phenotype associations
for this disease. Methods. The Sanger’s method of direct automated sequencing using ABI
3130 analyzer (Applied Biosystems). Results. The application of different molecular and
genetic approaches, including direct sequencing of gene sequence, allowed us to identify 96.8 %
of mutant alleles in Ukrainian patients with Gaucher disease. Also six new and previously not
described rearrangements of the GBA gene sequence were identified. Conclusion. The com-
parison of genotypes with clinical form of the disease, identified in patients, demonstrated that
our results do not contradict the current recognized genotype-phenotype correlations, which
allow predicting the type and clinical course of the Gaucher disease to some degree.
K e y w o r d s: Gaucher disease, GBA gene.
Introduction
Gaucher disease (MIM 230800) is the most
common storage disorder, caused by hereditary
deficiency of the lysosomal enzyme of gluco-
cerebrosidase (EC 3.2.1.45) [1]. In clinical
terms, Gaucher disease is divided into three
types depending on the presence and rate of
neurological manifestation progress [2]. Type
I Gaucher disease (non-neuronopathic) is the
most common form, characterized by the ab-
sence of neurological symptoms. The main
Biomedicine ISSN 1993-6842 (on-line); ISSN 0233-7657 (print)
Biopolymers and Cell. 2017. Vol. 33. N 1. P 34–47
doi: http://dx.doi.org/10.7124/bc.000940
35
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
clinical features of this type of disorder are
hepatosplenomegaly, pancytopenia and bone
system abnormalities in rather a wide spectrum
of severity – from asymptomatic cases to ear-
ly and short manifestation with fatal outcome
during the first years of life. Type II Gaucher
disease (acute neuronopathic) is the rarest
form, the main symptom of which, in addition
to organomegaly, is early and rapid develop-
ment of severe neurological damage, fatality
in utero or during infancy. Type III Gaucher
disease (chronic neuronopathic) is a transient
form which covers all patients with organo-
megaly and any neurological signs, manifes ted
after the second year of life.
The human glucocerebrosidase gene (GBA)
is mapped in locus lq21, it is 7.5 kb long and
consists of 11 exons. The pseudogene GBAP,
remarkable for almost 96 % homology to the
functional gene, is located 16 kb downstream [3].
The region, surrounding the GBA gene, contains
seven other genes and pseudogenes (MTX1,
MTX1P1, THBS3, MUC1, PROPIN1, COTE1,
CLK2), which may be involved in the process
of forming different fusion or recombinant vari-
ants with the GBA gene during the crossing-over
of this chromosome region [4].
According to the data of the largest human
gene mutation databases (dbSNP, 1000
Genomes, HGMD), there are over 300 cur-
rently described pathogenic variants of the
GBA gene, most of them are related to the
development of Gaucher disease. As for other
pathological variants, there are some large
described insertions/deletions, including the
deletion of the whole gene [5], as well as a
considerable number of complex alleles (rec-
alleles), which were formed due to the cross-
ing-over between the functional gene GBA and
surrounding genetic structures, most frequent-
ly the pseudogene GBAP.
Similar to most hereditary human diseases,
Gaucher disease is remarkable for considerable
variability of the frequencies of pathological
variants of the gene in different populations.
For instance, the population of Ashkenazi Jews
is notable for a very high frequency of several
variants – p.N409S, p.L483P, c.84dupG,
IVS2(+1)A, RecNciI and RecTL, which to-
gether comprise about 90 % of all mutant al-
leles, with a single replacement p.N409S re-
markable for over 70 % mutant alleles [6]. At
the same time, these pathological variants in
non-Jewish patients account for the total of no
more than 60 % of mutant alleles, and the fre-
quency of replacement p.N409S is in the range
of 10–50 % depending on the population [5].
There have been studies of the spectrum of
pathological variants of the GBA gene in patients,
suffering from Gaucher disease, in many
European countries [7–15]. This information is
of great relevance for understanding the origin
and distribution of the pathological variants of
this disease as well as for the evaluation of geno-
type-phenotype correlations among patients.
The aim of our work was to identify patho-
logical variants in the GBA gene which caused
the development of Gaucher disease in Ukrainian
patients, to compare their spectrum with the
variants in the patients from Slavonic and other
European countries and to evaluate the geno-
type-phenotype associations for this disease.
Materials and Methods
Patients
The genotype was analyzed in 63 patients of
age from 6 months to 65 years from different
36
N. V. Olkhovych, A. M. Nedoboy, N. O. Pichkur et al.
regions of Ukraine, who were diagnosed with
Gaucher disease during the period from 2001
to 2016, based on the complex of clinical
(anemia, thrombocytopenia, hepatospleno-
megaly), morphological (Gaucher-like cells
in the bone marrow biopsy sample) and bio-
chemical (glucocerebrosidase activity defi-
ciency in blood leukocytes) data. As the
Center of Orphan Diseases of NCSH
OKHMATDYT of the Ministry of Health of
Ukraine is the only institution in Ukraine to
conduct biochemical and molecular-genetic
testing of Gaucher patients, the group of pa-
tients, examined by us, may be deemed as the
representative group of Ukrainian population.
The control group to analyze the pathogenic-
ity of new mutations was formed from the
blood samples of 50 vo lun teer donors aged
from 18 to 60 years without any clinical signs
of lysosomal pathology. All patients (patients’
parents) and volunteer donors gave their in-
formed consent to the use of their biomate-
rial for the study. The work has been ap-
proved by the Ethics Committee of SI IGRM
NAMS of Ukraine.
Screening of major mutations
Genomic DNA was isolated from peripheral
blood samples, obtained from EDTA, using
commercial sets NucleoSpin®Blood (Ma-
cherey-Nagel, Germany) according to the
manufacturer’s instructions. Missense re-
placements p.N409S and p.L483P were de-
termined by the method of nested PCR and
subsequent RFLP-analysis as described pre-
viously [16]. The identification of the men-
tioned mutations was conducted using re-
striction endonucleases Xho1 and Msp1
(MBI Fermentas).
Sequencing of GBA gene
Due to the availability of highly homologous
pseudogene GBAP, the exon amplification of
the GBA gene was conducted using the tech-
nology of nested PCR, the first stage of which
involved the primers, specific for the se-
quence of the functional gene (GenBank
Accession No. AH006907.2). The sequence
of primers, which were used for each stage
of nested PCR, is presented in Table 1. The
design of primers was independently elabo-
rated using Primer3 software, web-version
4.0.0 (http://bioinfo.ut.ee/primer3/), the syn-
thesis of primers was ordered in Apply
Biosystems (USA).
The first stage of nested PCR envisaged
obtaining PCR products of 1–4 exons using
primers 1F and 4R (product 1873 bp), 4–8
exons using primers 4F and 8R (product
3777 bp) and 8–11 exons using primers 8F and
11BR (product 2267 bp). At the second stage
of nested PCR the fragments of the coding part
of the GBA gene exons were obtained along
with 5’- and 3’-non-translating regions and
intron/exon boundary, using exon-specific
primers (Table 1). The purification of PCR
products was conducted using the commercial
kits NucleoSpin® Gel and PCR Clean-up
(Macherey-Nagel, Germany) according to the
manufacturer’s instructions.
The identification of sequence variants of
the GBA gene was conducted by the method
of Sanger’s direct automatic sequencing using
ABI Prism 3130 (Applied Biosystems, USA)
and BigDye Terminator sequencing kit
(Applied Biosystems, USA) according to the
manufacturer’s protocol. All the identified re-
arrangements were confirmed by sequencing
using both forward- and reverse-primers. The
http://bioinfo.ut.ee/primer3/
37
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
analysis of sequencing results was made using
programs Chromas and BLAST (http://www.
ncbi.nlm.nih.gov/blast). The electronic data-
bases of known pathogenic variants – dbSNP,
1000 Genomes, HGMD – were used to char-
acterize the identified rearrangements. The
analysis of pathogenicity of new variants was
made using programs PolyPhen2 (http://genet-
ics.bwh.harvard.edu/pph2), SNPs3D (http://
www.snps3d.org) and Provean (http://provean.
jcvi.org/index.php). The description of rear-
rangements in the GBA gene was based on the
nomenclature, recommended by the Human
Genome Variation Society (HGVS ver-
sion 15.11, 2016), with the consideration of
the first 39 amino acids of preprotein [17, 18].
To facilitate the comparison of the obtained
results against the previous publications, the
first mention of the rearrangement was made
with the indication of the traditional name in
brackets, without the consideration of 39 ami-
no acids of preprotein.
Results
Our examination involved 63 patients from 63
families with confirmed diagnosis of Gaucher
disease from all the regions of Ukraine, includ-
ing 57 patients, clinically classified as type I
Gaucher disease (type I GD), 2 patients with
type II Gaucher disease (type II GD), and
4 patients with type III Gaucher disease
(type III GD). The severity degree of the clin-
ical course was determined according to the
severity index (SSI), suggested by Zimran
et al. [19]. Table 2 presents the summarized
clinical and molecular-genetic characteristics
of the patients, examined by us. Three families
had two sick siblings each, but only one sibling
from each family was used in calculations of
allele frequencies.
A total of 124 out of 126 (98.4 %) mutant
alleles of the GBA gene were identified. If two
previously described rearrangements were
identified in a patient, it was assumed that they
were in trans-position, which was confirmed
by the analysis of parents, if available. The
biological material of parents was unavailable
Table 1. The design of primers for the GBA gene
analysis
Ex
on
Type
of
primer
The sequence of primer
(5’-3’)
Tm,
°C
The
product
size, bp
1
F аacagatgagaggaagccaat* 57.9
509
R tctgtgccttgctcaaagag 59.3
2
F gtgggccttgtcctaatgaa 60.3
372
R aacaaaatcctcaccccaaa 62.9
3
F ctcggcctcctaaagtgcta 59.6
552
R gtagcaggcctgaggacatc 59.8
4
F taaccattacacccctcacc* 57.2
507
R caccactgcactcctgtctc* 59.4
5
F aacccaggagcccaagttc 61.4
494
R gttcagccattagcctccac 69.7
6
F gacattttgtcccctgctgt 60.0
533
R ctgatggagtgggcaagatt 60.0
7
F aggctgttctcgaactcctg* 59.6
598
R aggggaatggtgctctagga 61.0
8
F aaaaatctccccaaacctctc* 58.6
585
R atcatggttccccagagttg 59.8
9
F cccacatgtgacccttacct 59.7
354
R gttccaccctgaacaccttc 59.4
10
F agcctctgcaggagttatgg 59.5
477
R agagtgtgatcctgccaagg 60.3
11a
F gctctgctgttgtggtcgt 60.0
498
R gtttccaaagcaagcagcac 61.0
11b
F tgactaaagagggcacagca 59.6
592
R gtcctcacgctcccaagact 61.8
* Primers specific to the sequence of the functional GBA gene
http://www.ncbi.nlm.nih.gov/blast
http://www.ncbi.nlm.nih.gov/blast
http://genetics.bwh.harvard.edu/pph2/
http://genetics.bwh.harvard.edu/pph2/
http://www.snps3d.org/
http://www.snps3d.org/
http://provean.jcvi.org/index.php
http://provean.jcvi.org/index.php
38
N. V. Olkhovych, A. M. Nedoboy, N. O. Pichkur et al.
N
D
is
ea
se
ty
pe
A
ge
o
f
m
an
ife
st
at
io
n,
ye
ar
s
Genotype
SS
I
sc
or
e
1 allele 2 allele
1 I 3 N409S RecNciI 7
2 I 3 del55 L483P+RecG 6
3 I 9 N409S N409S 6
4 I 55 N409S R159W 6
5 I 1 S390I L483P 7
6 I 3 N409S N409S 6
7 I 3 N409S RecC 2 8
8 I 3 ? Rec G 7
9 I 10 N409S L483P 7
10 I 4 R87W RecC 2 7
11 I 3 R202* L483P+RecG 6
12 I 18 N409S N409S 6
13 I 0,5 L483P RecNciI 8
14 I 19 N409S c1324_1326delATT 6
15 I 45 N409S N409S 4
16 I 5 R502C L483P 11
17 I 3 ? Rec G 8
18 I 6 N409S L483P+RecG 6
19 I 7 R87W c901delC 4
20 I 3 N409S W223R 9
21 I 40 F167L Q453R 7
22 I 15 N409S R159W 8
23 I 1 I200S L483P 5
24 I 5 N409S R202* 6
25 I 3 N409S L327P 7
26 I 20 N409S P430A 8
27 I 2 N409S L483P 7
28 I 0,5 R202* G241R 8
29 I 25 N409S L483P 6
30 I 16 N409S RecC 2 6
31 II 0,5 84GG P430A 26
32 I 12 N409S R535C 7
N
D
is
ea
se
ty
pe
A
ge
o
f
m
an
ife
st
at
io
n,
ye
ar
s
Genotype
SS
I
sc
or
e
1 allele 2 allele
33 I 21 N409S R159W 5
34 I 15 N409S L483P 11
35 I 20 N409S L483P 7
36 I 3 G416S G416S 6
37 I 5 N409S L483P 6
38 I 2 N409S RecC 2 5
39 I 6 N409S L483P 6
40 I 15 N409S R159W 5
41 I 10 N409S L483P 7
42 I 3 N409S P217S 8
43 I 15 N409S N131I 6
44 I 3 N409S L483P 5
45 I 45 N409S L483P 5
46 I 5 N409S RecNciI 8
47 I 5 N409S RecNciI 6
48 I 15 N409S RecC 6
49 III 5 R159W+
G241R D448H 26
50 III 1 G416S c999G-A 37
51 I 0,5 V414L RecC 13
52 I 6 N409S L483P 6
53 I 6 N409S L483P 13
54 III 3 N277S Y244* 25
55 I 12 N409S A423D 8
56 I 42 L483P RecC 2 4
57 III 0,5 G416S c203dupC 26
58 I 5 N409S N409S 6
59 I 5 N409S R159W 6
60 I 4 N409S R202* 6
61 II 0,5 G241R A423D 26
62 I 5 G416S G416S 8
63 I 4 N409S L483P 7
Table 2. The genotype and phenotype of Gaucher patients from Ukraine
39
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
for patients No. 4, 15, 21, 45 and 56. New
variants were identified while obtaining the
identical results of sequencing two indepen-
dent PCR products and confirmed by the anal-
ysis of parents.
In total, 32 different pathogenic variants of
the GBA gene were identified. As expected,
the most common variant was a single nucle-
otide replacement in exon 9 p.N409S
(N370S) – it was found in 45 out of 124 al-
leles, which amounted to 36.3 %. Five patients
had this replacement in homozygous state, and
35 – in heterozygous state.
The second most frequent pathogenic vari-
ant of the GBA gene was the missense replace-
ment in exon 10 p.L483P (L444P), it was
identified as an individual mutation in 18 al-
leles out of 124, which amounted to 14.5 %.
This replacement was not identified in homo-
zygous state in any case. Three other patients
had the p.L483P replacement as part of the
most common recombinant allele RecNciI,
which is the result of the conversion of a frag-
ment of exon 10 of the functional gene and a
pseudogene, and which, in addition to replace-
ment p.L483p, also carries two replacements
p.A495P (A456P) and p.V499V (V460V) in
cis-position, remarkable for the pseudogene
sequence. Additionally, it was established that
three patients had replacement p.L483P in cis-
position with single nucleotide replacements
c.*92G>A and c.*102T>C, localized in 3’-non-
translating region (3’UTR) of the GBA gene.
These replacements were also notable for the
sequence of pseudogene GBAP, thus, there is
high probability of these patients to have the
recombination between a gene and a pseudo-
gene in the site of intron 10 – 3’UTR, de-
scribed as RecG allele [5].
The third most frequent variant (6 out of
124 alleles, 4.8 %) was found to be a missense
replacement in exon 5 p.R159W (R120W),
which was identified in six patients: in five – in
the compound with p.N409S, and in one pa-
tient with type III GD in the compound with
a missense replacement in exon 6 p.G241R
(G202R). The same number of alleles (6 out
of 124, 4.8 %) had a missense replacement in
exon 9 p.G416S (G377S), which was identified
in four patients: two had it in a homozygous
state and two – in the compound with another
single nucleotide rearrangement.
Additionally, our studies identified previ-
ously described missense replacement p.G241R
(G202R) – in three alleles (2.4 %), missense
replacements p.R87W (R48W) and p.A423D
(A384D) – in two alleles each (1.6 % each),
missense replacements p.I200S (I161S), p.P217S
(P178S), p.N227S (N188S), p.W223R (W184R),
p.L327P (L288P), p.Q453R (Q414R), p.D448H
(D409H), p.V414L (V375L), p.R502C (R463C)
and p.R535C (R496C) – in one allele each
(0.8 % each). It was established that four alleles
(3.2 %) had a nonsense replacement in exon 6
p.R202* (R163*) in a heterozygous state.
Other single nucleotide rearrangements, identi-
fied in single cases, were the duplications of
c.84dupG and c.203dupC, as well as a three-
nucleotide deletion without any shift in the read-
ing frame c.1324_1326delATT and deletion
c.1265_1319del55 in exon 9.
It was observed that there was rather a high
prevalence of recombinant alleles among our
examined patients with the involvement of the
functional gene GBA and pseudogene GBAP.
For instance, in addition to the abovementioned
seven patients with alleles RecNciI and RecG,
five patients with a complex of six replace-
40
N. V. Olkhovych, A. M. Nedoboy, N. O. Pichkur et al.
ments of pseudogene origin in cis-position in
exon 6 (p.W223R, p.N227R, p.V230G,
p.S235P, p.G241R, p.F252I) were identified,
which may correspond to the described recom-
binant allele RecC with the conversion of a site
between intron 5 and exon 7 (g.4179_5042con)
[5]. It was found that two more patients had
cis-position of the abovementioned six replace-
ments of pseudogene origin in exon 6 and re-
placements p.R159W in exon 5. This combina-
tion may correspond to the described recombi-
nant allele RecC5a with the conversion of a
site between intron 4 and exon 6
(g.3941_4430con) [5]. Furthermore, two pa-
tients had the single nucleotide replacements
c.*92G>A and c.*102T>C, localized in 3’-non-
translating region (3’UTR) of the GBA gene.
These replacements were also notable for the
sequence of pseudogene GBAP, thus, there is
high probability of these patients to have the
recombination between a gene and a pseudo-
gene in the site of intron 11 – 3’UTR [5].
Therefore, the total frequency of recombinant
alleles was 12.9 %. Notably, the final confirma-
tion of the availability and localizations of
recombinant alleles requires additional studies.
Six pathogenic rearrangements, which have
not been previously described, are identified
in the GBA gene – four missense replacements:
p.N131I in exon 4, p.F167L in exon 5, p.S390I
in exon 8 and p.P430A in exon 9; a nonsense
replacement p.Y244* in exon 6 and a single
nucleotide deletion c.901delC in exon 7. The
pathogenicity of the identified rearrangements
was confirmed in silico using programs
PolyPhen2, SNPs3D and Provean (Table 3).
None of the mentioned rearrangements was
found in the database of 1000 Genomes or in
50 samples of donor blood, examined by us.
The paternal analysis demonstrated that re-
placements p.S390I and p.Y244* were inher-
ited by probands from fathers, whereas rear-
rangements p.N131I and c.901delC were in-
herited by probands from mothers. The pater-
nal analysis of rearrangements p.F167L and
p.P430A was not conducted due to the unavail-
ability of the parental biological material of
the probands.
Unfortunately, genotypes of two patients
(patients 8 and 17) are yet to be determined
completely. It was identified that patient 8 had
a previously non-described missense replace-
ment p.P94S in exon 3 of the GBA gene, which
was evaluated as a polymorphic variant during
the pathogenicity check (Table 4). However,
we have no possibility to detect the second
pathogenic alleles in these patients due to a
lack of material.
Table 3. The analysis of pathogenicity of new mutations in the GBA gene
Rearrangements Score
Conclusion
protein cDNA PolyPhen21 SNPs3D2 Provean3
p.P94S c.402C>T 0.001 1.86 -0.555 benign
p.N131I c.514A>T 1.000 -1.07 -7.134 deleterious
p.F167L c.621T>C 0.990 -2.36 -5.350 deleterious
p.S390I c.1291G>T 0.997 0.21 -2.800 deleterious
p.P430A c.1410C>G 1.000 -2.82 -7.516 deleterious
1 ΔPSIC ≤ 0,5 – benign; 2 SVM score > 0,5 – benign; 3 Provean score > -2,5 – benign.
41
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
Discussion
Our examination of 63 independent
Ukrainian patients suffering from Gaucher
disease identified a total of 32 pathogenic rear-
rangements: 22 one nucleotide substitutions,
2 of which were nonsense replacements, 2 du-
plications, 3 deletions, 1 splicing mutation and
4 recombinant rearrangements.
Replacement p.N409S is known to belong
to so called “mild” variants of the gene and is
almost not found in patients with neurological
disorders [5]. In the group of Ukrainian pa-
tients replacement p.N409S was also found
only in patients with type I GD – 41 of them
carried this replacement in at least one allele,
which amounted to 71.9 % of all the patients
with type I GD (Table 4). Moreover, the data,
obtained by us, confirm the conclusions of
other researchers on the mitigating impact of
replacement p.N409S [6]. For instance, the
availability of this replacement in patients 24
and 60, regardless of the availability of zero-
mutation p.R202* in another allele, condi-
tioned type I (non-neuronopathic) clinical
course of medium severity (Table 2). Three
patients, who had the identified recombinant
alleles in the compound with replacement p.
N409S which impairs the structure and func-
D
is
ea
se
ty
pe
Genotype
Number of
genotypes/
total number
of investigated
patients
(frequences)
I
p.N409S/p.N409S 5/63 (7.9 %)
p.N409S/p.L483P 13/63 (20.6 %)
p.N409S/p.R159W 5/63 (7.9 %)
p.N409S/RecNciI 3/63(4.8 %)
p.N409S/RecC5a 3/63 (4.8 %)
p.N409S/p.R202* 2/63 (3.2 %)
p.N409S/p.A423D 1/63 (1.6 %)
p.N409S/c.1324_1326delATT 1/63 (1.6 %)
p.N409S/p.L327P 1/63 (1.6 %)
p.N409S/p.N131I 1/63 (1.6 %)
p.N409S/p.P217S 1/63 (1.6 %)
p.N409S/p.W223R 1/63 (1.6 %)
p.N409S/p.P430A 1/63 (1.6 %)
p.N409S/p.R535C 1/63 (1.6 %)
p.N409S/RecC 1/63 (1.6 %)
p.N409S/p.L483P+RecG 1/63 (1.6 %)
p.L483P/p.I200S 1/63 (1.6 %)
p.L483P/RecC5a 1/63 (1.6 %)
D
is
ea
se
ty
pe
Genotype
Number of
genotypes/
total number
of investigated
patients
(frequences)
I
p.L483P/p.R502C 1/63 (1.6 %)
p.L483P/p.S390I 1/63 (1.6 %)
del55/p.L483P+RecG 1/63 (1.6 %)
p.F167L/p.Q453R 1/63 (1.6 %)
p.G416S/p.G416S 2/63 (3.2 %)
p.R202*/p.L483P+RecG 1/63 (1.6 %)
p.R202*/p.G241R 1/63 (1.6 %)
p.R87W/RecC5а 1/63 (1.6 %)
p.R87W/c.901delC 1/63 (1.6 %)
p.V414L/RecC 1/63 (1.6 %)
p.L483P/RecNciI 1/63 (1.6 %)
RecG/? 2/63 (3.2 %)
II
c.84dupG/p.P430A 1/63 (1.6 %)
p.G241R/p.A423D 1/63 (1.6 %)
III
p.D448H/[p.R159W+p.G241R] 1/63 (1.6 %)
p.G416S/c.999G-A 1/63 (1.6 %)
p.N227S/p.Y244* 1/63 (1.6 %)
p.G416S/c203dupC 1/63 (1.6 %)
Table 4. The genotype frequencies in Gaucher patients from Ukraine
42
N. V. Olkhovych, A. M. Nedoboy, N. O. Pichkur et al.
tion of the GBA gene considerably, underwent
also a protective impact of the mentioned re-
placement, which conditioned the development
of type I (non-neuronopathic) Gaucher disease.
Similar to most populations, replacement
p.L483P was ranked the second most frequent
among our patients – 14.5 % (18/124) alleles
contained this replacement as an individual
mutation, and 5.6 % more (7/124) – as a con-
stituent of recombinant alleles of distal regions
of the GBA gene. Traditionally, the replacement
p.L483P is classified as “severe”, it is often
associated with the availability of neurological
disorders in patients, especially in homozygous
state [5]. No homozygote p.L483P/p.L483P
was identified in the Ukrainian patients. 17 out
of 18 carriers of replacement p.L483P, as an
individual mutation, had type I (non-neurono-
pathic) Gaucher disease i.e. they had no neu-
rological disorders. The severity of this replace-
ment in 13 of them was mitigated by replace-
ment p.N409S in the second allele, in two – by
the presence of missense replacements p.I200S
and p.R502C, also remarkable just for non-
neuronopathic type of the disease [5]. One
patient had replacement p.L483P, identified in
the compound with RecC5a allele which was
described predominantly for patients with
type I Gaucher disease [5, 15].
Two homozygous carriers of replacement
p.G416S were identified among the examined
patients, both had type I (non-neuronopathic)
Gaucher disease, which is in agreement with
the data of other authors about “mild” nature
of this replacement [20]. In two more patients,
this variant was identified in the compound
with another single nucleotide rearrangement –
one had cytosine duplication in exon 3 of the
gene (c.203dupC) which conditions the shift
in the reading frame, and another had the re-
placement of guanine for adenine in the last
triplet of exon 7, which does not result in the
amino acid replacement, but impairs the splic-
ing site. Therefore, both rearrangements are
“severe” by their phenotypic manifestation. It
is noteworthy that there was no mitigating ef-
fect from “mild” replacement p.G416S on the
impact of “severe” rearrangement in both pa-
tients who had type III (chronic neuronopa thic)
Gaucher disease (patients 50 and 57).
Replacement p.R159W is rather common
for European populations and is usually char-
acterized as “mild” by its phenotypic manifes-
tation [5]. Among the Ukrainian patients this
variant was identified in 5 patients with type I
(non-neuronopathic) Gaucher disease in the
compound with p.N409S and in one patient
with type III chronic neuronopathic disease
(patient 49) in the composition of a complex
allele [p.R159W+p.G241R] and replacement
p.D448H in the second allele.
While analyzing the phenotype of patients
with identified recombinant alleles in the GBA
gene, it should be noted that genotype-pheno-
type correlation in them is ambiguous. On the
one hand, it was predictable that all patients
with genotype p.N409S/RecNciI would have
type I (non-neuronopathic) Gaucher disease.
A patient with genotype p.L483P/RecNciI (pa-
tient 13) was notable for early manifestation
and severe clinical course of the disease, which
conditioned the fatal outcome after a hemor-
rhage, resistant to treatment, at the age of four,
regardless of conducted enzyme-replacement
therapy. The absence of neurological symp-
toms in this patient at diagnostics was the
reason why this case was classified as type I
(non-neuronopathic) Gaucher disease.
43
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
However, the “severity” of both mutations and
early death allow for an assumption that there
was no sufficient time for manifestation of the
neurological symptoms in this patient], thus,
this case may be considered to be type III
(chronic neuronopathic) Gaucher disease.
Most described cases of the recombinant
alleles, involving exons 5–7 of the GBA gene
(RecC and RecC5a), were observed in the
patients with no neurological disorders that
was also demonstrated by us. It is notable the
identification of genotype p.V414L/RecC in
the patient with early severe clinical course of
Gaucher disease without any neurological dis-
orders but with hepatic gaucheroma and fatal
outcome at the age of 6 (patient 51). Taking
into consideration the published data about the
clinical course in the patients, homozygous by
the missense replacement p.V414L, this vari-
ant should be related to “mild” ones by its
phenotypic manifestation [21]. Therefore, in
combination with allele RecC, which is also
mainly observed in the patients with type I
Gaucher disease, it could be expected that the
patient 51 has either mild or medium degree
of clinical course severity. Such contradiction
requires detailed study to identify the genetic,
epigenetic, and environmental factors, impact-
ing the phenotypic manifestation of a specific
genotype.
The results of genotyping other patients
with neuronopathic types of Gaucher disease
are in some agreement with the published data.
Both mutations, identified in the patient 61
with type II acute neuronopathic disease (gen-
otype p.G241R/p.A423D), described before,
are remarkable for neuronopathic forms of
Gaucher disease [22]. The duplication of gua-
nine c.84dupG in exon 2 of the GBA gene,
identified in a patient with type II (acute neu-
ronopathic) Gaucher disease, was also de-
scribed as a “severe” form according to its
phenotypic manifestation and is notable for
neuronopathic forms of the disease. As seen
from the published data, the phenotypic man-
ifestation of missense replacement p.N227S
depends on the rearrangement in the second
allele. The combination of this variant with
“mild” mutations, such as p.N409S, leads to
the development of type I Gaucher disease,
whereas the combination with “severe” muta-
tions, such as Rec-alleles or p.L483P, leads to
the occurrence of neuronopathic types of the
disease [5]. Therefore, the nonsense replace-
ment p.Y244*, identified in the compound with
p.N227S in patient 54, conditioned the deve-
lop ment of type III (chronic neuronopathic)
Gaucher disease.
The analysis in silico of new rearrange-
ments in the GBA gene, described by us,
demonstrated that nonsense replacement
p.Y244* and missense replacement p.P430A
might impair the structure and function of the
gene product the most. The nonsense replace-
ment p.Y244* is responsible for it due to the
occurrence of a stop-codon in exon 6 and, as
a result, the formation of a shortened gene
product, which lost over half of amino acid
residues and, first and foremost, the active
site of the enzyme (E379) [23]. The effect of
missense replacement p.P430A is due to the
fact that amino acid residue P430 is localized
in the loop, contacting with β8-strand of the
first domain TIM barrel in GBA molecule.
This loop is localized on the upper surface of
the active site and contacts the substrate mol-
ecule, which makes any replacements in this
region critical for normal functioning of the
44
N. V. Olkhovych, A. M. Nedoboy, N. O. Pichkur et al.
active site of the enzyme [24]. Notably, in
1998 Cormand et al. described another re-
placement of proline 430 – p.P430L in two
patients with type I Gaucher disease [25].
However, in both patients this replacement
was in the compound with p.N409S, which,
taking into consideration the mitigating nature
of this variant, made it impossible to evaluate
the correlation of replacement p.P430L and
the patients’ phenotype. Replacement p.
P430A was identified by us in two patients
– in the patient 26 with type I Gaucher dis-
ease, conditioned by the presence of replace-
ment p.N409S in the second allele, and in the
patient 31 with type II Gaucher disease, with
the duplication c.84dupG in the second allele.
The development of severe acute neurono-
pathic form of the disease in patient 31 (gen-
otype p.P430A/c.84dupG) confirms that the
replacement of proline 430 is a zero-mutation,
conditioning a considerable loss in the enzy-
matic activity of glucocerebrosidase.
It is probable that missense replacement
p.F167L might also impact the functional ac-
tivity of GBA. Phenylalanine 167 is one of
seven aromatic amino acids, forming a chain
on one side of the active site pocket of a GBA
molecule and is involved into the substrate
recognition [27]. Leucine is not an aromatic
amino acid, thus the replacement of phenyl-
alanine with leucine leads to the impairment
in the aromatic chain structure and therefore
to the impairment of spatial organization of
the active site pocket of the enzyme, which
may have negative impact on the catalytic
activity of glucocerebrosidase. Unfortunately,
we were unable to evaluate phenotype-geno-
type association of this replacement because
it was identified in the compound with “mild”
replacement p.Q453R, which conditioned type
I Gaucher disease in the patient 21.
Replacements p.N131I and p.S390I, de-
scribed by us, influence amino acid residues,
localized in domain III, the catalytic domain
of GBA molecule, but do not participate di-
rectly in the recognition and binding of the
substrate or activator of saposin C [23, 24].
This is the most likely factor, conditioning the
“mild” impact of conformational changes in
GBA molecule, caused by these replacements,
on its catalytic activity. This is also confirmed
by the clinical data of the patients, described
by us, – replacement p.N131I in the compound
with p.N409S led to the development of type
I Gaucher disease with late manifestation (pa-
tient 43, the first symptoms were identified at
the age of 15), and replacement p.S390I miti-
gated the impact of “severe” replacement p.
L483P in patient 5 and caused the development
of type I Gaucher disease, albeit of medium
severity with early manifestation (first symp-
toms at the age of 1 year), but without neuro-
logical disorders.
Therefore, the application of different mo-
lecular and genetic approaches, including di-
rect gene sequencing, allowed us to identify
96.8 % of mutant alleles in Ukrainian patients
with Gaucher disease. Also six new and previ-
ously not described rearrangements of the GBA
gene sequence were identified. The comparison
of genotypes with clinical form of the disease,
identified in patients, demonstrated that at
present there are recognized genotype-pheno-
type correlations for this disease, which allow
predicting the type and clinical course of the
disease to some degree. In most patients, de-
scribed by us, the combination of genotype
and phenotype corresponded to the data of
45
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
numerous previous studies. The information
about clinical signs of the disease in patients
with new, previously not described mutations,
allowed us to complement current information
about genotype-phenotype correlations for
Gaucher disease. However remarkably, there
is considerable heterogeneity in the clinical
course of the disease even among people with
a similar genotype. This depends on different
factors, influencing the realization of genetic
information in a certain individual – the avail-
ability of complex alleles, the influence of
adjacent or modifying genes, the impact of
environmental factors, etc. These factors im-
pact the possibilities of the clinical prognosis
and require additional studies.
Therefore, the determination of molecular
and genetic nature of a disease in a specific
patient is the mandatory information, which
allows confirming the diagnosis, predicting the
clinical course of the disease and envisaging
the response to specific therapy.
REREFERCES:
1. Lysosomal storage disorders: a practical guide. Eds:
Mehta A, Winchester B. London: Wiley-Blackwell,
2012; 208 p.
2. Beutler E, Grabowski GA. Gaucher disease. In: The
metabolic & molecular bases of inherited diseases.
Eds. Scriver CR, Beaudet AL, Sly WS, Valle D.
New York: McGraw-Hill, 2009; 3668 p.
3. Horowitz M, Wilder S, Horowitz Z, Reiner O, Gel-
bart T, Beutler E. The human glucocerebrosidase
gene and pseudogene: structure and evolution. Ge-
nomics. 1989;4(1):87–96.
4. Winfield SL, Tayebi N, Martin BM, Ginns EI, Sid-
ransky E. Identification of three additional genes
contiguous to the glucocerebrosidase locus on chro-
mosome 1q21: implications for Gaucher disease.
Genome Res. 1997;7(10):1020–6.
5. Hruska KS, LaMarca ME, Scott CR, Sidransky E.
Gaucher disease: mutation and polymorphism spec-
trum in the glucocerebrosidase gene (GBA). Hum
Mutat. 2008;29(5):567–83.
6. Beutler E, Gelbart T. Erroneous assignment of Gau-
cher disease genotype as a consequence of a complete
gene deletion. Hum Mutat. 1994;4(3):212–6.
7. Koprivica V, Stone DL, Park JK, Callahan M,
Frisch A, Cohen IJ, Tayebi N, Sidransky E. Analysis
and classification of 304 mutant alleles in patients
with type 1 and type 3 Gaucher disease. Am J Hum
Genet. 2000;66(6):1777–86.
8. Hatton CE, Cooper A, Whitehouse C, Wraith JE.
Mutation analysis in 46 British and Irish patients with
Gaucher’s disease. Arch Dis Child. 1997;77(1):17–22.
9. Germain DP, Puech JP, Caillaud C, Kahn A, Poe-
naru L. Exhaustive screening of the acid beta-glu-
cosidase gene, by fluorescence-assisted mismatch
analysis using universal primers: mutation profile
and genotype/phenotype correlations in Gaucher
disease. Am J Hum Genet. 1998;63(2):415–27.
10. Erdos M, Hodanova K, Taskó S, Palicz A, Stol-
naja L, Dvorakova L, Hrebicek M, Maródi L. Ge-
netic and clinical features of patients with Gau-
cher di sea se in Hungary. Blood Cells Mol Dis.
2007;39(1):119–23.
11. Malini E, Grossi S, Deganuto M, Rosano C, Pari-
ni R, Dominisini S, Cariati R, Zampieri S, Bembi B,
Filocamo M, Dardis A. Functional analysis of
11 novel GBA alleles. Eur J Hum Genet. 2014;22(4):
511–6.
12. Alfonso P, Aznarez S, Giralt M, Pocovi M, Giral-
do P; Spanish Gaucher’s Disease Registry.. Muta-
tion analysis and genotype/phenotype relationships
of Gaucher disease patients in Spain. J Hum Genet.
2007;52(5):391–6.
13. Hodanová K, Hrebícek M, Cervenková M, Mrázo vá L,
Vepreková L, Zemen J. Analysis of the beta-glucocer-
ebrosidase gene in Czech and Slovak Gaucher patients:
mutation profile and description of six novel mutant
alleles. Blood Cells Mol Dis. 1999;25(5–6):287–98.
14. Mattošová S, Chandoga J, Hlavatá A, Saligová J,
Maceková D. Spectrum of GBA mutations in patients
with Gaucher disease from Slovakia: identification of five
novel mutations. Isr Med Assoc J. 2015;17(3):166–70.
46
N. V. Olkhovych, A. M. Nedoboy, N. O. Pichkur et al.
15. Tylki-Szymañska A, Keddache M, Grabowski GA.
Characterization of neuronopathic Gaucher disease
among ethnic Poles. Genet Med. 2006;8(1):8–15.
16. Boukina TM, Tsvetkova IV. Distribution of mutations
of acid b-d-glucosidase gene (GBA) among 68 rus-
sian patients with Gaucher’s disease. Biochemistry
(Moscow) Suppl Ser B: Biomed Chem. 2008;2(1):
105–10.
17. Horovenko NH, Ol’khovych NV, Nedoboĭ AM, Pi-
chkur NO. [Detection of the frequencies of GBA
gene major mutations in patients with Gaucher
disease in Ukraine]. Tsitol Genet. 2007;41(4):41–7.
18. Miocić S, Filocamo M, Dominissini S, Montalvo AL,
Vlahovicek K, Deganuto M, Mazzotti R, Cariati R,
Bembi B, Pittis MG. Identification and functional
characterization of five novel mutant alleles in 58
Italian patients with Gaucher disease type 1. Hum
Mutat. 2005;25(1):100.
19. den Dunnen JT, Dalgleish R, Maglott DR, Hart RK,
Greenblatt MS, McGowan-Jordan J, Roux AF,
Smith T, Antonarakis SE, Taschner PE. HGVS Rec-
ommendations for the Description of Sequence Vari-
ants: 2016 Update. Hum Mutat. 2016;37(6):564–9.
20. Zimran A, Kay A, Gelbart T, Garver P, Thurston D,
Saven A, Beutler E. Gaucher disease. Clinical, lab-
oratory, radiologic, and genetic features of 53 pa-
tients. Medicine (Baltimore). 1992;71(6):337–53.
21. Amaral O, Marcão A, Sá Miranda M, Desnick RJ,
Grace ME. Gaucher disease: expression and char-
acterization of mild and severe acid beta-glucosidase
mutations in Portuguese type 1 patients. Eur J Hum
Genet. 2000;8(2):95–102.
22. Cormand B, Grinberg D, Gort L, Fiumara A, Baro-
ne R, Vilageliu L, Chabás A. Two new mild homo-
zygous mutations in Gaucher disease patients:
clinical signs and biochemical analyses. Am J Med
Genet. 1997;70(4):437–43.
23. Stone DL, Tayebi N, Orvisky E, Stubblefield B,
Madike V, Sidransky E. Glucocerebrosidase gene
mutations in patients with type 2 Gaucher disease.
Hum Mutat. 2000;15(2):181–8.
24. Dvir H, Harel M, McCarthy AA, Toker L, Silman I,
Futerman AH, Sussman JL. X-ray structure of hu-
man acid-beta-glucosidase, the defective enzyme in
Gaucher disease. EMBO Rep. 2003;4(7):704–9.
25. Atrian S, López-Viñas E, Gómez-Puertas P, Cha-
bás A, Vilageliu L, Grinberg D. An evolutionary and
structure-based docking model for glucocerebrosi-
dase-saposin C and glucocerebrosidase-substrate
interactions – relevance for Gaucher disease. Pro-
teins. 2008;70(3):882–91.
26. Cormand B, Grinberg D, Gort L, Chabás A, Vilage-
liu L. Molecular analysis and clinical findings in the
Spanish Gaucher disease population: putative hap-
lotype of the N370S ancestral chromosome. Hum
Mutat. 1998;11(4):295–305.
Аналіз мутацій в гені GBA у пацієнтів
з хворобою Гоше в Україні
Н. В. Ольхович, А. М. Недобой, Н. О. Пічкур,
Н. Г. Горовенко
Хвороба Гоше (MIM 230800) є найбільш поширеним
захворюванням накопичення, яке спричинене спадко-
вим дефіцитом лізосомного ферменту глюкоцеребро-
зідази (EC 3.2.1.45). Ген глюкоцереброзідази (GBA)
картований в локусі 1q21, його довжина 7,5 тис.п.н. і
складається з 11 екзонів. За даними найбільших баз
даних мутацій генів людини, існує більше 300 описаних
в даний час патогенних варіантів гена GBA, більшість
з них пов’язані з розвитком хвороби Гоше.
Мета. Виявлення перебудов в гені GBA, які зумовили
розвиток хвороби Гоше у хворих в Україні, порівняння
їх частоти і спектру з варіантами у пацієнтів з інших
європейських країн, а також оцінка генотип-фенотип
асоціації для цього захворювання. Методи. Метод
прямого автоматичного сиквенування за Сенгером на
аналізаторі ABI 3130 (Applied Biosystems). Результа
ти. Застосування різних молекулярних і генетичних
підходів, включаючи пряме секвенування послідовнос-
ті гена, дозволило нам ідентифікувати 96,8 % мутант-
них алелів у українських пацієнтів з хворобою Гоше.
Також були виявлені шість нових раніше не описаних
перебудов послідовності гена GBA. Висновки.
Порівняння виявлених у пацієнтів генотипів з клініч-
ною формою захворювання показали, що отримані
результати не суперечать сучасним визнаним генотип-
фенотип кореляціям, які дозволяють певною мірою
прогнозувати тип і клінічний перебіг хвороби Гоше.
К л юч ов і с л ов а: хвороба Гоше, ген GBA.
47
Analysis of mutations in GBA gene in Ukrainian patients with Gaucher disease
Анализ мутаций в гене GBA у пациентов
с болезнью Гоше в Украине
Н. В. Ольхович, А. Н. Недобой, Н. А. Пичкур,
Н. Г. Горовенко
Болезнь Гоше (MIM 230800) является наиболее рас-
пространенным заболеванием накопления, которое
вызвано наследственным дефицитом лизосомного
фермента глюкоцереброзидазы (EC 3.2.1.45). Ген
глюкоцереброзидазы (GBA) картирован в локусе
1q21, его длина 7,5 тис.п.н. и состоит из 11 экзонов.
По данным крупнейших баз данных мутаций генов
человека, существует более 300 описанных в насто-
ящее время патогенных вариантов гена GBA, боль-
шинство из них связаны с развитием болезни Гоше.
Цель. Выявление перестроек в гене GBA, которые
обусловили развитие болезни Гоше у больных в
Украине, сравнение их частоты и спектра с вариан-
тами у пациентов из других европейских стран, а
также оценки генотип-фенотип ассоциации для это-
го заболевания. Методы. Метод прямого автомати-
ческого сиквенирования по Сенгеру на анализаторе
ABI 3130 (Applied Biosystems). Результаты.
Применение различных молекулярных и генетиче-
ских подходов, включая прямое секвенирование
последовательности гена, позволило нам идентифи-
цировать 96,8 % мутантных аллелей у украинских
пациентов с болезнью Гоше. Также были обнаруже-
ны шесть новых ранее не описанных перестроек
последовательности гена GBA. Выводы. Сравнение
выявленных у пациентов генотипов с клинической
формой заболевания показали, что полученные ре-
зультаты не противоречат современным признанным
генотип-фенотипическим корреляциям, позволяю-
щим в определенной степени прогнозировать тип и
клиническое течение болезни Гоше.
К л юч е в ы е с л ов а: болезнь Гоше, ген GBA.
Received 01.12.2016
|