Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine

Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine

Aim. To evaluate the average age of familial adenomatous polyposis (FAP) onset in both males, females and in their relatives, carriers or not carriers of the APC gene mutations, to estimate the anticipation in successive generations for early identification of the individuals in the risk group. Meth...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Datum:2017
Hauptverfasser: Lozynska, M.R., Lozynskyy, Y.S., Plawski, A., Pinyazhko, R.O., Prokopchuk, N.M., Fedota, O.M.
Format: Artikel
Sprache:English
Veröffentlicht: Інститут молекулярної біології і генетики НАН України 2017
Schriftenreihe:Вiopolymers and Cell
Schlagworte:
Biomedicine
Online Zugang:http://dspace.nbuv.gov.ua/handle/123456789/152908
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Zitieren:Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine / M.R. Lozynska, Y.S. Lozynskyy, A. Plawski, R.O. Pinyazhko, N.M. Prokopchuk, O.M. Fedota // Вiopolymers and Cell. — 2017. — Т. 33, № 2. — С. 102-115. — Бібліогр.: 46 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
id irk-123456789-152908
record_format dspace
spelling irk-123456789-1529082019-06-14T01:27:56Z Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine Lozynska, M.R. Lozynskyy, Y.S. Plawski, A. Pinyazhko, R.O. Prokopchuk, N.M. Fedota, O.M. Biomedicine Aim. To evaluate the average age of familial adenomatous polyposis (FAP) onset in both males, females and in their relatives, carriers or not carriers of the APC gene mutations, to estimate the anticipation in successive generations for early identification of the individuals in the risk group. Methods. The medical records, genealogical information were gathered and molecular genetic study of blood was carried out in 25 probands with adenomatous polyposis. FAP was confirmed in 44.0 % of probands. The probands with FAP had 36 affected relatives. The amplified frag-ments of the APC gene were screened for the mutations involving heteroduplex analysis and detection of single-stranded conformational polymorphism. The age of FAP onset was evaluated in probands and their relatives. The anticipation index (A) was calculated. Results. Among patients with FAP 61.7 % were males and 38.3 % were females. The age of FAP onset in males was 36.0 ± 1.4 years, while in females the disease manifested earlier – in 29.5 ± 2.4 years (p<0.01). The APC mutations, including four novel mutations, were found in 63.6 % of probands with FAP. The lowest age of polyposis onset was observed in carriers of the APC mutation c.3927_3931delAAAGA p.Q1309fs. The average age difference between FAP onset in the parents and their offspring was 12.0 ± 1.7 years. In 3 of 4 families with FAP and novel mutations of the APC gene predominance of males (12:4) and anticipation phenomenon were observed.The strongest age correlations of FAP onset were found in mother-offspring pairs and parents-son pairs. The statistically significant difference between the data confirmed more similarities of descendant, especially sons, with parents. Conclusions. There was no statistically significant differ-ence between average age of the disease onset in patients carriers of the APC mutations (33.1 ± 2.1 years) and in patients without the APC mutations studied by the traditional methods (33.7 ± 1.6 years). In offsprings with FAP the reduced age of disease onset compared to the parents was revealed irrespective of the presense of the APC mutations. The anticipation index in FAP was 18.0 %. Accounting anticipation allows estimating the approximate average age at FAP onset during genetic counseling, and therefore timely carries out targeted prevention. Мета. Визначити середній вік виникнення сімейного аденоматозного поліпозу (САП) у чоловіків, жінок, їх родичів, носіїв мутацій гена АРС, або ж у хворих без підтверджених мутацій цього гена, для оцінки антиципації у наступних поколіннях для раннього виявлення осіб групи ризику. Методи. Провели аналіз медичної документації, генеалогічної інформації та виконали молекулярно-генетичне дослідження крові в 25 пробандів із аденоматозним поліпозом. У 44,0 % пробандів було підтверджено САП. Пробанди мали 36 родичів із цим синдромом. Ампліфіковані фрагменти гена APC були скриновані на наявність мутацій з використанням гетеродуплексного аналізу й конформаційного поліморфізму однотиткової ДНК. Вік початку захворювання визначали в пробандів, їх родичів та рахували індекс антиципації (A). Результати. Серед пацієнтів із САП було 61,7 % чоловіків і 38,3 % жінок. Встановлено, що вік маніфестації синдрому в чоловіків становив 36,03 ± 1,44 років, а в жінок захворювання виникало раніше – у віці 29,5 ± 2,43 років (р<0,01). Мутації гена APC, включаючи 4 нові мутації, виявили в 63,6 % пробандів із САП. Найменший вік виникнення поліпозу спостерігали в носіїв мутації с.3927_3931delAAAGA p.Q1309fs гена АРС. Середня різниця у віці початку САП у батьків і їх потомства становила 12,0 ± 1,7 років. У 3 із 4 сімей із САП, члени яких були носіями нових мутацій, спостерігали переважання чоловічої статі (12:4) і явище антиципації, а один пробанд був носієм мутації, яка виникла de novo. Найсильнішу кореляцію за віком виникнення САП були знайдені в парах матері-нащадки і батьки-сини. Статистично значуща різниця між отриманими даними підтверджує більшу подібність нащадків, особливо синів, з батьками. Висновки. Між віком виникнення САП у пацієнтів, носіїв мутації гена АРС (33.1±2.1 років) і віком хворих, у яких не підтверджено мутацій цього гена за допомогою традиційних методів (33.7±1.6 років), не було виявлено статистично істотної різниці. Індекс антиципації (А) у пацієнтів із САП дорівнював 18,0 %. У нащадків із САП зменшення віку виникнення захворювання порівняно з батьками не залежало від наявності мутацій гена АРС. Облік антиципації дозволяє оцінити середній вік початку САП під час генетичного консультування, і, отже, своєчасно здійснювати цільову профілактику. Цель. Определить средний возраст начала семейного аденоматозного полипоза (САП) у мужчин, женщин, а также у родственников пробандов носителей мутаций гена АРС, или же у больных без подтвержденных мутаций этого гена, в последующих поколениях для оценки явления антиципации и для раннего выявления лиц групп риска. Методы. Провели анализ медицинской документации, генеалогической информации и выполнили молекулярно-генетическое исследование крови в 25 пациентов с аденоматозным полипозом. В 44,0 % пробандов с полипозом было подтверждено САП. Пробанды имели 36 родственников с этим синдромом. Амплифицированные фрагменты гена APC были скриновани на наличие мутаций с использованием гетеродуплексного анализа и конформационного полиморфизма однонитевой ДНК. Возраст начала заболевания определяли у пробандов, их родственников и вычисляли индекс антиципации (A). Результаты. Среди пациентов из САП было 61,7 % мужчин и 38,3 % женщин. Усновлено, что возраст начала синдрома в мужчин составлял 36,03 ± 1,44 лет, а у женщин заболевания возникало раньше – в возрасте 29,5 ± 2,43 лет (р<0,01). Мутации гена APC, включая 4 новые мутации, обнаружили в 63,6 % пробандов из САП. Наименьший возраст возникновения полипоза наблюдали у носителей мутации с.3927_3931delAAAGA p.Q1309fs гена АРС. Средняя разница в возрасте начала САП у родителей и их потомства составила 12,0 ± 1,7 лет. У 3 из 4 семей из САП, члены которых были носителями новых мутаций, наблюдали преобладание мужского пола (12:4) и явление антиципации, а один пробанд был носителем мутации, которая возникла de novo. Самую сильную корреляцию по возрасту возникновения САП было найдено в парах матери-потомки и родители-сыновья. Статистически значимая разница между полученными данными подтверждает большее сходство потомков, особенно сыновей, с родителями. Выводы. Между возрастом возникновения САП у пациентов, носителей мутаций гена АРС (33.1 ± 2.1 года), и возрастом больных, у которых не подтверждено мутаций этого гена с помощью традиционных методов (33.7 ± 1.6 года), не было выявлено статистически значимой разницы. Индекс антиципации у пациентов из САП равнялся 18,0 %. У потомков из САП уменьшение возраста возникновения заболевания по сравнению с родителями не зависело от наличия мутаций гена АРС. Учет антиципации позволяет оценить средний возраст начала САП при генетическом консультировании, и, следовательно, своевременно осуществлять целевую профилактику. 2017 Article Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine / M.R. Lozynska, Y.S. Lozynskyy, A. Plawski, R.O. Pinyazhko, N.M. Prokopchuk, O.M. Fedota // Вiopolymers and Cell. — 2017. — Т. 33, № 2. — С. 102-115. — Бібліогр.: 46 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000948 http://dspace.nbuv.gov.ua/handle/123456789/152908 616– 006.5/.55 – 031.81– 056.7/.76 – 02:616–053–055(477.83) en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection DSpace DC
language English
topic Biomedicine
Biomedicine
spellingShingle Biomedicine
Biomedicine
Lozynska, M.R.
Lozynskyy, Y.S.
Plawski, A.
Pinyazhko, R.O.
Prokopchuk, N.M.
Fedota, O.M.
Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine
Вiopolymers and Cell
description Aim. To evaluate the average age of familial adenomatous polyposis (FAP) onset in both males, females and in their relatives, carriers or not carriers of the APC gene mutations, to estimate the anticipation in successive generations for early identification of the individuals in the risk group. Methods. The medical records, genealogical information were gathered and molecular genetic study of blood was carried out in 25 probands with adenomatous polyposis. FAP was confirmed in 44.0 % of probands. The probands with FAP had 36 affected relatives. The amplified frag-ments of the APC gene were screened for the mutations involving heteroduplex analysis and detection of single-stranded conformational polymorphism. The age of FAP onset was evaluated in probands and their relatives. The anticipation index (A) was calculated. Results. Among patients with FAP 61.7 % were males and 38.3 % were females. The age of FAP onset in males was 36.0 ± 1.4 years, while in females the disease manifested earlier – in 29.5 ± 2.4 years (p<0.01). The APC mutations, including four novel mutations, were found in 63.6 % of probands with FAP. The lowest age of polyposis onset was observed in carriers of the APC mutation c.3927_3931delAAAGA p.Q1309fs. The average age difference between FAP onset in the parents and their offspring was 12.0 ± 1.7 years. In 3 of 4 families with FAP and novel mutations of the APC gene predominance of males (12:4) and anticipation phenomenon were observed.The strongest age correlations of FAP onset were found in mother-offspring pairs and parents-son pairs. The statistically significant difference between the data confirmed more similarities of descendant, especially sons, with parents. Conclusions. There was no statistically significant differ-ence between average age of the disease onset in patients carriers of the APC mutations (33.1 ± 2.1 years) and in patients without the APC mutations studied by the traditional methods (33.7 ± 1.6 years). In offsprings with FAP the reduced age of disease onset compared to the parents was revealed irrespective of the presense of the APC mutations. The anticipation index in FAP was 18.0 %. Accounting anticipation allows estimating the approximate average age at FAP onset during genetic counseling, and therefore timely carries out targeted prevention.
format Article
author Lozynska, M.R.
Lozynskyy, Y.S.
Plawski, A.
Pinyazhko, R.O.
Prokopchuk, N.M.
Fedota, O.M.
author_facet Lozynska, M.R.
Lozynskyy, Y.S.
Plawski, A.
Pinyazhko, R.O.
Prokopchuk, N.M.
Fedota, O.M.
author_sort Lozynska, M.R.
title Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine
title_short Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine
title_full Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine
title_fullStr Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine
title_full_unstemmed Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine
title_sort familial adenomatous polyposis: age of onset and association with mutations of the apc gene in patients from west ukraine
publisher Інститут молекулярної біології і генетики НАН України
publishDate 2017
topic_facet Biomedicine
url http://dspace.nbuv.gov.ua/handle/123456789/152908
citation_txt Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine / M.R. Lozynska, Y.S. Lozynskyy, A. Plawski, R.O. Pinyazhko, N.M. Prokopchuk, O.M. Fedota // Вiopolymers and Cell. — 2017. — Т. 33, № 2. — С. 102-115. — Бібліогр.: 46 назв. — англ.
series Вiopolymers and Cell
work_keys_str_mv AT lozynskamr familialadenomatouspolyposisageofonsetandassociationwithmutationsoftheapcgeneinpatientsfromwestukraine
AT lozynskyyys familialadenomatouspolyposisageofonsetandassociationwithmutationsoftheapcgeneinpatientsfromwestukraine
AT plawskia familialadenomatouspolyposisageofonsetandassociationwithmutationsoftheapcgeneinpatientsfromwestukraine
AT pinyazhkoro familialadenomatouspolyposisageofonsetandassociationwithmutationsoftheapcgeneinpatientsfromwestukraine
AT prokopchuknm familialadenomatouspolyposisageofonsetandassociationwithmutationsoftheapcgeneinpatientsfromwestukraine
AT fedotaom familialadenomatouspolyposisageofonsetandassociationwithmutationsoftheapcgeneinpatientsfromwestukraine
first_indexed 2025-07-14T04:22:23Z
last_indexed 2025-07-14T04:22:23Z
_version_ 1837594778349338624
fulltext 102 M. R. Lozynska, Y. S. Lozynskyy, A. Plawski © 2017 M. R. Lozynska et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Bio- polymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited UDC: 616– 006.5/.55 – 031.81– 056.7/.76 – 02:616–053–055(477.83) Familial adenomatous polyposis: age of onset and association with mutations of the APC gene in patients from West Ukraine M. R. Lozynska4, Y. S. Lozynskyy¹, A. Plawski², R. O. Pinyazhko¹, N. M. Prokopchuk4, O. M. Fedota3 ¹ Danylo Halytsky Lviv National Medical University 69, Pekarska Str., Lviv, Ukraine, 79010 ² Institute of Human Genetics of Polish Academy of Sciences 32, Strzeszynska Str., Poznan, Poland, 60-479 3 V. N. Karazin Kharkiv National University 4, Svobody Sq., Kharkiv, Ukraine, 61077 4 State Institution "Institute of Hereditary Pathology, NAMS of Ukraine" 31a, M. Lysenko Str., Lviv, Ukraine, 79008 maria_lozynska@ukr.net Aim. To evaluate the average age of familial adenomatous polyposis (FAP) onset in both males, females and in their relatives, carriers or not carriers of the APC gene mutations, to estimate the anticipation in successive generations for early identification of the individuals in the risk group. Methods. The medical records, genealogical information were gathered and molecular genetic study of blood was carried out in 25 probands with adenomatous polyposis. FAP was confirmed in 44.0 % of probands. The probands with FAP had 36 affected relatives. The am- plified fragments of the APC gene were screened for the mutations involving heteroduplex analysis an d detection of single-stranded conformational polymorphism, heteroduplex analy- sis, and also high resolution melting analysis. The age of FAP onset was evaluated in probands and their relatives. The anticipation index (A) was calculated. Results. Among patients with FAP 61.7 % were males and 38.3 % were females. The age of FAP onset in males was 36.0 ± 1.4 years, while in females the disease manifested earlier – in 29.5 ± 2.4 years (p<0.01). The APC mutations, including four novel mutations, were found in 63.6 % of probands with FAP. The lowest age of polyposis onset was observed in carriers of the APC mutation с.3927_3931delAAAGA p.Q1309fs. The average age difference between FAP onset in the parents and their offspring was 12.0 ± 1.7 years. In 3 of 4 families with FAP and novel muta- tions of the APC gene predominance of males (12:4) and anticipation phenomenon were ob- served.The strongest age correlations of FAP onset were found in mother-offspring pairs and parents-son pairs. The statistically significant difference between the data confirmed more similarities of descendant, especially sons, with parents. Conclusions. There was no statisti- ISSN 1993-6842 (on-line); ISSN 0233-7657 (print) Biopolymers and Cell. 2017. Vol. 33. N 2. P 102–115 doi: http://dx.doi.org/10.7124/bc.000948 103 FAP: age of onset and association with mutations of the APC gene for assessment of the genetic anticipation cally significant difference between average age of the disease onset in patients carriers of the APC mutations (33.1 ± 2.1 years) and in patients without the APC mutations studied by the traditional methods (33.7 ± 1.6 years). In offsprings with FAP the reduced age of disease onset compared to the parents was revealed irrespective of the presense of the APC mutations. The anticipation index in FAP was 18.0 %. Accounting anticipation allows estimating the ap- proximate average age at FAP onset during genetic counseling, and therefore timely to carry out targeted prevention. K e y w o r d s: anticipation, APC mutations, age of FAP onset in males and females, familial adenomatous polyposis. Introduction The most common аdenomatous polyposis disorders include familial adenomatous pol- yposis (FAP), attenuated FAP (AFAP), and other multiple colorectal adenomatous syn- dromes – MUTYH-associated polyposis (MAP), NTHL1-associated polyposis (NAP) and polymerase proofreading-associated po- ly posis (PPAP). Genetical and clinical mani- festations of the polyposis syndromes vary, and cases with clinical diagnosis of FAP «might molecularly be presented by different diagnosis» [1, 2]. A classic FAP (MIM No. 175000) is an autosomal dominantly inherited disease characterized by the development of hundreds to thousands of colorectal adenoma- tous polyps after the first decade of life and affects both genders. FAP is an orphan dis- ease: estimates of the prevalence of syndrome vary from 1:6,850 to 1:31,250 live births and account for 0.2 %–1.0 % of all colorectal can- cer (CRC) [3–4]. The risk of CRC is virtually 100 % by the 50 years for the classic form of this syndrome. FAP is the second most com- mon inherited CRC syndrome. Many FAP patients show extracolonic tumors (hepato- blastoma, cancer of thyroid glands and brain, desmoid and pancreatic tumors), which can contribute to morbidity and mortality [4–5]. The average age of onset for FAP is 35.9 (22–63) years [6]. Most classic FAP cases arise as a consequence of a germline hetero- zygous mutation in the adenomatous polypo- sis coli gene (APC), a tumor suppressor gene located on chromosome 5 (5q21). The coding region is divided into 15 exons and encodes a large protein (309 kilo-Daltons) [7]. The APC gene plays several important roles in cells, influen cing cell adhesion, cytoskeleton and cell cycle [8]. Since the first description in 1986 by Herrera L. et al., over 1000 muta- tions have been found, which are inserted into the international reference database. About 25 % of people with FAP do not have any family history of the disease and harbour a de novo mutation in the APC gene without any clinical or genetic evidence of FAP in the family [9, 10]. Conventional techniques leave approximately 30 % of families with classical FAP and approximately 90 % of AFAP fami- lies APC mutation–negative [11]. There re- mains a high proportion of APC mutation negative patients even after extensive sear ches for new causative genes. 25 % of APC muta- tion negative samples were found to harbour pathogenic mutations in MUTYH [12, 13]. Differential diagnoses include other disorders causing multiple polyps (such as Peutz- Jeghers syndrome, familial juvenile polyps or 104 M. R. Lozynska, Y. S. Lozynskyy, A. Plawski et al. hyperplastic polyposis, hereditary mixed pol- yposis syndromes). In patients with FAP the first symptoms are often manifested in puberty. These include dyspepsia with frequent liquid defecation, ab- dominal pain, anemia, metabolic disorders leading to a delay in physical develop- ment [14]. The earlier FAP is manifested, the severer is its course, and the sooner decom- pensation state follows [15]. The overall sex ratio among affected individuals was 55 %:45 % (male:female) with similar ratios in the APC positive and APC negative groups (57 %:43 % and 51 %:49 %, respectively) [6]. However, a mutation of the APC gene is stable, and the site of mutation determines the sever- ity or associated features of FAP with strong parent-child correlation [16]. In families with FAP a phenomenon of ge- netic anticipation was observed, in which the age of onset of a disorder reduced and/or the severity of the phenotype increased in succes- sive generation [17]. For along time, geneti- cists were skeptical on the real existence of the phenomenon. Clinical anticipation for dis- eases onset has been reported since the 19th century. Nowadays, this phenomenon has a molecular genetic evidence. In 1991 the tri- nucleotide expansion mechanism was first identified in a group of inherited neuromuscu- lar disorders [18]. This phenomenon is com- monly encountered in human dominant type hereditary disorders, such as Von Hippel- Lindau [19] and Li-Fraumeni syndromes [20]. The evidence for genetic anticipation has been described in some cancer genetic syndromes like breast cancer [21], pancreatic cancer [22], ovarian cancer [23], CRC [24], leukemia [25], lymphoma [26], melanoma [27]. In 1994, Shibata et al. were the first to suggest that younger onset of cancer observed in consecu- tive generations of Lynch families could be explained by the accumulation of mismatch repair slippage events due to the diminished DNA mismatch repair proficiency. A few years later, the same group using a mathematical model hypothesized that the number of muta- tions accumulated in a tumor was dependent on the mutation rate and the number of cell division [28]. According to the modern con- cepts, an increased risk of a variety of tumors and genetic anticipation are associated with the telomere length changes [29–30]. The aim of the study was to evaluate the average age of FAP onset of males and females and in their relatives, carriers or not carriers of the APC gene mutations, in successive ge- ne ra tions to estimate the anticipation for early identification of the individuals in the risk group. Methods In the period from 2002 to 2015 year the me- di cal records and genealogical information from 25 probands with adenomatous polypo- sis were analyzed. FAP was confirmed in 10 (40.0 %) probands with adenomatous polypo- sis and a family history of the disease or a family history of the malignant tumors associ- ated with the syndrome (CRC, gastric cancer or pancreatic cancer). One proband (the APC mutation carrier) from the FAP group had neither clinical nor genetic evidence of FAP in family members, so we assumed she carried the de novo mutation of the APC gene. The probands with FAP had 36 affected relatives. The individuals with 100 or more adenoma- tous polyps as well as those with fewer than 105 FAP: age of onset and association with mutations of the APC gene for assessment of the genetic anticipation 100 adenomatous polyps and a family history of FAP are clinically diagnosed as FAP ac- cording to the diagnostic criteria. The genea- logical information in 3–4 generations was collected using a single registration of pro- bands according to the appropriate ethical requirements. The mode of inheritance of the diseases was determined using the clinical, genealogical, laboratory and literature (OMIM) database. The age of FAP onset was evaluated in the probands and in their rela- tives. The patients were residents of five re- gions of Ukraine: Lviv, Ivano-Frankivsk, Ternopil, Volyn and Chernivtsi. The molecular genetic study in 25 probands with adenomatous polyposis and in 4 their relatives was carried out. Genomic DNA was isolated from peripheral blood using a salting- out method [31]. Before blood sampling for molecular genetic studies, the informed con- sent to perform such analysis was obtained from patients. The primers, described by Prosser et al., were used including individual exonic splicing sites. DNA samples of all the patients tested for the presence of small mutations using screen- ing methods such as strand conformational polymorphism methods (SSCP), heteroduplex analysis (HD), and also high resolution melting (HRM). Our study included patients whose gene fragments (or entire genes) had under- gone large rearrangements as well as those in which small mutations had been detected. We screened the APC gene fragments that encompassed exons 5–8, exons 10–14, and the fragment from A to L of exon 15 for mu- tations with heteroduplex analysis (HD) and single strand conformational polymorphism methods (SSCP) [32]. Parameters influencing SSCP analysis: DNA amplification, denatur- ation, and the electrophoretic conditions. Another important aspect of SSCP analysis is the visualization of the single-stranded DNA fragments. In brief, after electrophoresis, the PAAG are first fixed with 10 % acetic acid for approximately 30 min at room temperature and subsequently washed with water. Depen- ding on the concentration of silver nitrate, incubation with the silver nitrate solution can last for approximately 60 min (in a 0.001 % AgNO3, 0.036 % formaldehyde solution). This incubation step is performed in the dark, while avoiding any contamination with pro- tein-containing solution. Subsequently, the PAAG are washed with water and color de- velopment is performed by incubating the gel for 5 to 10 min with a color development solution (containing 2.5 % Na2CO3, 0.036 % formaldehyde, and 0.002 % sodium thiosul- fate). Color development can be stopped with a solution containing a chelating agent (such as 1.5 % EDTA). Gels can be subsequently fixed with 30 % ethanol and 4 % glycerol. The stained gels are transferred to a vacuum dryer and are immobilized to a porous paper. Results are can be analyzed by means of an image analysis system. All mutations were verified by the DNA sequence determination from both the 5` and 3` directions. PCR was carried out in the same way as for the SSCP/HD analyses using the same PCR primers. The DNA fragments that showed heteroduplex in HD analysis or ad- ditional patterns in SSCP analysis were se- quenced by direct PCR product sequencing and analysed with ALF Express (Amersham Pharmacia Biotech, Uppsala, Sweden) accor- ding to the manufacturer’s specifications [33]. 106 M. R. Lozynska, Y. S. Lozynskyy, A. Plawski et al. C-HRM primers We designed sets of primers for a simultane- ous amplification of a reference fragment (with an unchanged number of copies) and a target fragment (with APC gene fragments as its template). Designed primers for the APC gene (fragments of exons 9, 14 and 15) in- clude large rearrangements and also small sequence changes detected in our group of patients. Primers were designed using the Primer3plus (www.bioinformatics.nl/primer- 3plus/) software. The melting temperature of all primers was in the range of 58.0–62.3 °C (Table 1). Subsequently, the primer pairs were se- lected for a multiplex reaction, with one of the products including the target fragment of the studied gene and the second one as a reference. Amplicons were paired in respect of their mel- ting temperature ranges (no overlaps between the amplicons) and lack of non-specific inte- rac tions between primers that could impair the amplification efficiency. Assay design: the products were amplified using the type-it HRM kit (Qiagen) on the DNA templates at a concentration of 50 ng/μl diluted in AE buffer (Qiagen). The analysis was performed on a Rotor-Gene® Q equipment (Qiagen). PCR reactions were carried out for the 30 cycles (with a 5 min preincubation at 95 °C) of 95 °C for 10 s, 55 °C for 30 s and 72 °C for 10 s, the products were then melted and PCR was continued to the 40th cycle in the same conditions followed by another mel- ting process. The first melting analysis was performed from 70 °C to 90 °C by raising the temperature by 0.3° at each step after which the second one, designed to detect small changes in the sequence, was carried out with higher resolution raising the temperature by 0.1° at each step. Anticipation index (A) was calculated using the formula: А=(Р-D)/(Р+D), P – age of disease onset in one parent, D – age of disease onset in offsprings [34]. Statistical analysis had been carried out us- ing Shapiro-Wilk test for normality, Student’s t Test and Spearman correlation. Results and Discussion The characteristics of probands and their rela- tives with FAP by gender and age at polyposis onset are shown in table 2. Table 1. Sets of primers Studied exon Pr od uc t l en gt h (b p) Forward primer Tm (°C) Final concen- tration (nM) Reverse primer Tm (°C) Fi na l c on ce n- tra tio n (n M ) 9 Target amplicon 249 GCCCACAGGTGGAAATGG 62.3 172 GAATGATGTTGTGGAGTGCTG 59.2 172 14 Target amplicon 239 GAAGTTAATGAGAGACAAATTCCA 58.0 172 TCCGTAATATCCCACCTCCA 60.1 172 15 Target amplicon 180 TCTGCTGCCCATACACATTC 59.7 688 GGATTCAATCGAGGGTTTCA 59.9 688 http://www.bioinformatics.nl/primer3plus/ http://www.bioinformatics.nl/primer3plus/ 107 FAP: age of onset and association with mutations of the APC gene for assessment of the genetic anticipation Table 2. The characteristics of probands and their relatives with familial adenomatous polyposis by the gender and the age of polyposis onset Probands Gender of probands Age (years) Number of the relatives of probands Age of polyposis onset in the relatives of probands (years) males females 1. A f 24 – – – 2. B f 28 1 0 46 3. C f 32 5 3 41, 32, 42, 33, 32, 45*, 40*, 19* 4. D f 26 2 0 28, 43 5. E f 15 1 1 40,16* 6. F f 32 4 1 43, 33, 26, 32, 45* 7. G f 36 3 1 24, 32, 40,18* 8. H f 44 1 0 ? 9. I f 29 3 2 32, 35, 30, 31*, 31* 10. J m 36 5 1 48, 45, 32, 41, 19, 20* 11. K m 48 2 0 40, (?) Total 9 females/2 males 31.8 27 9 27 males / 9 females Note. * – marked females, (?) – the age of polyposis onset is uknnown. Among the patients with FAP 29 (61.7 %) were males and 18 (38.3 %) were females, whereas women dominated among probands with polyposis (Table 2). The age of patients ranged from 15 to 48 years. The age of FAP onset in males was 36.0 ± 1.4 years of age, whereas in females disease manifested earlier – at 29.5 ± 2.4 years of age (t = 2.69, p<0.01). The average age of FAP onset was 32 (15–48) years and was low- er compared to the data given in the literature 36 (22–63) years [6]. The APC mutations, including four novel mutations, were found in 7 (63.6 %) probands with FAP and 6 of them were females of 7 families with FAP (table 3). Other 4 (16.0 %) probands with familial anamnesis of polyposis and cancer had no mutations. Among mutation carriers were 8 females and 3 males (probands and their relatives). The lowest age of polypo- sis onset was observed in carriers of the APC mutation с.3927_3931delAAAGA p.Q1309fs. The mutation leads to premature termination of the APC gene protein product [35, 36]. This deletion is one of the most frequent APC mu- tations in Europe [14, 33]. In most cases the mutation in codon 1309 leads to early onset of the disease accompanied by hundreds of pol- yps at a young age, early occurrence of CRC and extracolonic manifestations [14]. There was no statistically significant diffe- ren ce between average age of the disease onset in patients carriers of the APC mutations (33.1 ± 2.1 years) and in patients without the APC mutations identified by traditional me- thods (33.7 ± 1.6 years). In 3 of 4 families with FAP and novel mutations of the APC gene (probands 4D, 6F, 10J, table 2, 2) predomi- 108 M. R. Lozynska, Y. S. Lozynskyy, A. Plawski et al. nance of males with FAP (12:4) and anticipa- tion phenomenon were observed. One proband (1A) with the APC gene mutation had neither clinical nor genetic evidence of FAP in family members, so she was supposed to carry the de novo mutation. The example of anticipation in the family with the novel с.3343delA p. R1114fs APC mutation is shown in Fig. 1 (patient 10J, table 2, 2). Six relatives of the proband had FAP and 5 of them were males. Both earlier FAP onsets, the increased sever- ity in offsprings, and the predominance of males among patients were observed in this affected family. The example of anticipation in the family pedigree without the APC mutations confirmed by traditional methods is shown in Fig. 2 (pa- tient 3C, table 2). Table 3. The APC mutations in families with familial adenomatous polyposis and the average age of the syndrome onset within the families P ro ba nd s № of exons Mutations The evarage age of FAP onset in patients within the family (*) Number of patients with FAP within the family Number of patients those identified mutations within the family A 15 с.3931_3946delATTGGAACTAGGTCG 24,0 1 1 B 5 c.532-1G>A ** 39,5 2 1 D 11–14 deletion of exons 36,5 ± 6,7 3 1 E 15 с.3927_3931delAAAGA p.Q1309fs 23,7 ± 8,1 3 2 F 15 с.2021Т>TAG 35,8 ± 3,6 5 2 H 6 c.697С>Т ** 44,0 2 1 J 15 с.3343delA p.R1114fs 34,0 ± 4,7 7 3 Note. * – The average age of FAP onset in all affected individuals within the family; ** – splice site mutations. Cur- sive marked mutations were not found in other ethnic groups. Fig. 1. Pedigree of the proband and his relatives with FAP carriers of АРС с.3343delA p.R1114fs muta- tion. 109 FAP: age of onset and association with mutations of the APC gene for assessment of the genetic anticipation Fig. 2. Pedigree of the proband and her relatives with APC mutation- negative case of polyposis Eight relatives of the proband had FAP. It is widely accepted that the methods used to identify mutations fail to detect certain muta- tions because of the factors such as polymor- phisms in the sequences to which PCR primers bind that leads to allele dropout, or due to somatic mosaicism or because the mutations occur in the regions not targeted by the cur- rently used methods. Castellsagué et al. [37] and Spier et al. [38] reported the occurrence of imbalanced allele-specific expression of APC in 8 %–9 % of the APC mutation-nega- tive polyposis cases, indicating that the under- lying mutations were not detected by standard mutation detection techniques. Some of these cases carried pathogenic deep intronic variants predicted to activate cryptic splice sites [38], whereas others carried mutations in the pro- moter region of APC [39]. In offsprings with FAP the reduced age of disease onset compared to parents was re- vealed irrespective of the presense of the APC mutations. Analysis of the age of FAP onset in the probands and their affected relatives is shown in Table 4. In most couples “parents-offspring” with FAP in offspring, the disease begins at an ear- lier age comparing to the parents with statisti- cally significant difference. The average dif- ference of the age of FAP onset and index of anticipation in the parents and their offspring are shown in Table 5. The average age difference between the FAP onset in the parents and their offspring was 12.0 ± 1.7 years. The number of father- daughter pairs and father-son pairs was greater than the number of mother-daughter pairs and mother-son pairs. The anticipation index (A) in FAP was 18.0%. This index ranges from 12.0% in pairs father-son to 25.0 % – in pairs father-daughter in different family couples. The highest values of anticipation index (A) in the FAP were in father-daughter pairs. The anticipation phenomenon in FAP was shown by any parent-child pairing methods for the 110 M. R. Lozynska, Y. S. Lozynskyy, A. Plawski et al. deceased in literature data: in the patients over 5 years of age, the mean age at death was 50.9 years for the parent, 42.3 years for the proband, and 33.3 years for the child genera- tions, respectively, p<0.001 [17]. The correlation coefficients for the age of FAP onset in parents and offspring are shown in Table 6. The strongest age correlations of FAP onset were found in mother-offspring (mother- Table 6. The correlation coefficients between the age values of familial adenomatous polyposis onset in relatives of probands Family couples n r t р Mother-daughter 2 1 – – Mother-son 2 1 – – Mother-offspring 4 0.80±0.42 1.912 <0.05 Father-daughter 8 –0.01±41 –0.036 >0.05 Father-son 8 0.57±0.34 1.702 <0.01 Father-offspring 16 0.36±0.25 1.466 <0.01 Parents-daughter 10 0.04±0.35 0.113 >0.5 Parents -son 10 0.58±0.29 2.013 <0.01 Parents-offspring 20 0.44±0.21 2.059 <0.01 Note. n – number of pairs; r-correlation coefficients; t – Student test; p – value level of significance. Table 5. The average difference of the age of familial adenomatous polyposis onset and the anticipation index in parents and their offspring Family couples The average difference of the age of FAP onset (years) Anticipation index, (%) n d ± sd А ± sа Parents-offspring 20 12.0±1.7 18.0±3.1 Parents- daughter 10 13.5±2.6 23.2±3.2 Parents -son 10 8.5±2.3 13.7±3.4 Father-daughter 8 15.8±3.2 25.0±0.1 Father-son 8 9.3±2.7 12.0±0.1 Father-offspring 16 12.5±2.0 18.0±3.6 Mother-daughter 2 8.5±4.5 16.0±9.5 Mother-son 2 11.0±6.0 14.0±5.5 Mother-offspring 4 9.8±4.0 15.0±4.5 Note. n – the number of pairs of relatives, d ± sd – the average age of FAP onset and its statistical error, А ± sa – the average age of anticipation and its sta- tistical error. Table 4. The average age of familial adenomatous polyposis onset in family couples Family couples n The average age of FAP onset, x±sx р parents offsprings Parents-offspring 20 40.8±1.6 28.8±1.9 < 0.001 Parents-daughter 10 39.1±1.9 24.8±2.1 < 0.001 Parents -son 10 42.4±2.4 32.8±2.7 < 0.01 Mother- daughter 2 32.5±0.5 24.0±5.0 < 0.05 Mother -son 2 42.5±10.5 31.5±4.5 < 0.01 Father- daughter 8 40.8±2.0 25.0±2.4 < 0.001 Father-son 8 42.4±2.3 33.1±3.3 < 0.05 Mother-offspring 4 37.5±5.2 27.8±3.5 > 0.05 Father-offspring 16 41.6±1.5 29.1±2.2 < 0.001 Note. n – the number of pairs of relatives, x±sx – the average age of FAP onset and its statistical error, p – statistical significance. 111 FAP: age of onset and association with mutations of the APC gene for assessment of the genetic anticipation daughter and mother-son) pairs and parents- son pairs. The statistically significant differ- ence between the data confirmed more simi- larities of descendant, especially sons, with parents. L.Roger et al. [40] suggest that the occur- rence of the anticipation phenomenon is as- sociated with the erosion of telomeres. The erosion of telomeres, mainly because of cell proliferation, may be accelerated by specific alterations in the genes involved in CRC, such as the APC gene [24]. Telomere/telomerase interplay is an important mechanism involved in both genomic stability and cellular replica- tive potential, and its dysfunction plays a key role in the oncogenetic process [30]. There is general agreement that the shortening of telo- meres plays a role in the early steps of CRC carcinogenesis by promoting chromosomal instability (CIN). The APC mutation and acti- vation of the Wnt pathway in colonic epithe- lial cells with long telomeres give rise to ade- nomas with long telomeres; these telomeres are stable and not prone to fusion [41]. The APC gene mutation in cells with short telomeres gives rise to adenomas with short telomeres that have a propensity to undergo fusion; the resulting CIN leads to the large- scale genomic rearrangements that can drive the progression to malignancy. These data therefore indicate that telomere erosion pre- cedes the initiation of colorectal adenomage- ne sis, and this may provide a mechanism con- tributing to the age-associated profile of colorectal carcinomas [40]. In vitro, hormones and growth factors affect telomerase activity. The sex hormones directly increase the telo- merase reverse transcriptase (TERT) transcrip- tion and the telomerase activity in human cells [42, 43]. Natural and synthetic androgens can restore telomerase activity to normal levels in the cells in patients with TERT and TERC mutations can be directly activated by the tu- mor-suppressor protein c-Myc [44]. The rate of terminal restriction fragment length shorten- ing per year in men was found to be signifi- cantly greater than that in women [45]. An estrogen-responsive element is present in TERT, so the hormone can stimulate telome- rase [46]. This might reduce the shortening of a telomere. Accounting anticipation has prognostic value, since it allows estimating an approxi- mate average age of FAP onset during the genetic counseling providing timely targeted prevention. Due to autosomal dominant in- heritance and high penetrance of FAP, the probands and their first degree relatives should be screened regularly by geneticist and on- cologist. The cancer prevention and maintain- ing a good quality of life are the main goals of management and regular and systematic follow-up and supportive care should be of- fered to all patients. REFERENCES 1. Urso EDL, Delaini GG, Campi M, Bacchelli C, Pucciarelli S. Colorectal polyposis: clinical presen- tation and surgical treatment. Colorectal Disease. 2014;17(1):61–6. 2. Talseth-Palmer BA. The genetic basis of colonic adenomatous polyposis syndromes. Hered Cancer Clin Pract. 2017;15:5. 3. Valle L. Genetic predisposition to colorectal cancer: where we stand and future perspectives. World J Gastroenterol. 2014;20(29):9828–49. 4. Bülow S, Faurschou Nielsen T, Bülow C, Bisga- ard ML, Karlsen L, Moesgaard F. The incidence rate of familial adenomatous polyposis. Results from 112 M. R. Lozynska, Y. S. Lozynskyy, A. Plawski et al. the Danish Polyposis Register. Int J Colorectal Dis. 1996;11(2):88–91. 5. de la Chapelle A. Genetic predisposition to colorec- tal cancer. Nat Rev Cancer. 2004;4(10):769–80. 6. Acar T, Kumkumolu Y. Our surgical experience on familial adenomatous polyposis. Surgical Chroni- cles. 2015; 20(1):217–20. 7. Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, Joslyn G, Stevens J, Spirio L, Robertson M, Sargeant l, Krapcho K, Wolff E, Burt R, Hughes J.P., Warrington J, McPher- son J, Wasmuth J, Le Paslier D, Abderrahim H, Cohen D, Leppert M, White R. Identification and characterization of the familial adenomatous pol- yposis coli gene. Cell. 1991;66(3):589–600. 8. Kita K, Wittmann T, Nathke IS, Waterman-Sto- rer CM. Adenomatous Polyposis Coli on microtu- bule plus ends in cell extensions can promote mi- crotubule net growth with or without EB1. Mol Biol Cell. 2006; 17(5): 2331–45. 9. Gayther SA, Wells D, SenGupta SB, Chapman P, Neale K, Tsioupra K, Delhanty JD. Regionally clus- tered APC mutations are associated with a severe phenotype and occur at a high frequency in new mutation cases of adenomatous polyposis coli. Hum Mol Genet. 1994;3(1):53–6. 10. Zhang Y, Lu G, Hu Q, Wang X, Li C, Mao Y, Cui M. A de novo germline mutation of APC for inheritable colon cancer in a Chinese family using multigene next generation sequencing. Biochem Biophys Res Commun. 2014;447(3):503–7. 11. Moisio AL, Järvinen H, Peltomäki P. Genetic and clin- ical characterisation of familial adenomatous polyposis: a population based study. Gut. 2002;50(6): 845–50. 12. Papp J, Kovacs ME, Matrai Z, Orosz E, Kásler M, Børresen-Dale AL, Olah E. Contribution of APC and MUTYH mutations to familial adenomatous polyposis susceptibility in Hungary. Fam Cancer. 2016;15(1):85–97. 13. Lucci-Cordisco E, Risio M, Venesio T, Genuardi M. The growing complexity of the intestinal polyposis syn- dromes. Am J Med Genet A. 2013;161A(11):2777–87. 14. Delaini GG, Skřička T, Colucci G. Intestinal polyps and polyposis. From genetics to treatment and fol- low up. Italia: Springer-Verlag, 2009: 246 p. 15. Heinimann K, Müllhaupt B, Weber W, Attenhofer M, Scott RJ, Fried M, Martinoli S, Müller H, Dobbie Z. Phenotypic differences in familial adenomatous polyposis based on APC gene mutation status. Gut. 1998;43(5):675–9. 16. Young J, Simms LA, Tarish J, Buttenshaw R, Knight N, Anderson GJ, Bell A, Leggett B. A fam- ily with attenuated familial adenomatous polyposis due to a mutation in the alternatively spliced region of APC exon 9. Hum Mutat. 1998;11(6):450–5. 17. Iwama T, Utsunomiya J. Anticipation phenomenon in familial adenomatous polyposis:an analysis of its origin. World J Gastroenterol. 2000; 6(3): 335–8. 18. McInnis MG. Anticipation: an old idea in new genes. Am J Hum Genet. 1996;59(5):973–9. 19. Ning XH, Zhang N, Li T, Wu PJ, Wang X, Li XY, Peng SH, Wang JY, Chen JC, Gong K. Telomere shortening is associated with genetic anticipation in Chinese Von Hippel-Lindau disease families. Can- cer Res. 2014;74(14):3802–9. 20. Tabori U, Nanda S, Druker H, Lees J, Malkin D. Younger age of cancer initiation is associated with shorter telomere length in Li-Fraumeni syndrome. Cancer Res. 2007;67(4):1415–8. 21. Hsu L, Zhao LP, Malone KE, Daling JR. Assessing changes in ages at onset over successive generation: an application to breast cancer. Genet Epidemiol. 2000;18(1):17–32. 22. McFaul CD, Greenhalf W, Earl J, Howes N, Neop- tolemos JP, Kress R, Sina-Frey M, Rieder H, Hahn S, Bartsch DK. European Registry of Hereditary Pan- creatitis and Familial Pancreatic Cancer (EURO- PAC); German National Case Collection for Famil- ial Pancreatic Cancer (FaPaCa). Anticipation in familial pancreatic cancer. Gut. 2006;55(2):252–8. 23. Goldberg JM, Piver MS, Jishi MF, Blumenson L. Age at onset of ovarian cancer in women with a strong family history of ovarian cancer. Gynecol Oncol. 1997;66(1):3–9. 24. Bertorelle R, Rampazzo E, Pucciarelli S, Nitti D, De Rossi A. Telomeres, telomerase and colorectal cancer. World J Gastroenterol. 2014;20(8):1940–10. 25. Horwitz M, Goode EL, Jarvik GP. Anticipation in familial leukemia. Am J Hum Genet. 1996; 59(5): 990–998. 113 FAP: age of onset and association with mutations of the APC gene for assessment of the genetic anticipation 26. Wiernik PH, Wang SQ, Hu XP, Marino P, Paietta E. Age of onset evidence for anticipation in familial non-Hodgkin's lymphoma. Br J Haematol. 2000; 108(1):72–9. 27. Goldstein AM, Clark WH Jr, Fraser MC, Tucker MA. Apparent anticipation in familial melanoma. Mela- noma Res. 1996;6(6):441–6. 28. Shibata D, Peinado MA, Ionov Y, Malkhosyan S, Perucho M. Genomic instability in repeated se- quences is an early somatic event in colorectal tu- morigenesis that persists after transformation. Nat Genet. 1994;6(3):273–81. 29. Bozzao C, Lastella P, Stella A. Anticipation in lynch syndrome: where we are where we go. Curr Geno- mics. 2011;12(7):451–65. 30. Seguí N, Pineda M, Guinó E, Borràs E, Navarro M, Bellido F, Moreno V, Lázaro C, Blanco I, Capellá G, Valle L. Telomere length and genetic anticipation in Lynch syndrome. PLoS One. 2013;8(4):e61286. 31. Makuch GW, Zastavna DV, Tyrkus MN, et al. Pat. 32044 Ukraine, IPC G01N33/49 (2006.01) Method of DNA isolation from peripheral blood leukocytes. patent owner SI "Institute of Hereditary Pathology of National Academy of Medical Sci- ences." N u200801896; appl. 14.02.2008; publ.25.04.2008, Bull. N8/2008. 32. Plawski A, Jura J, Slomski R. Wykrywanie mutacji punktowych w genie supresorowym APC czlowieka metod heterodupleksów. Przyklady analiz DNA, 2001: 80–9. 33. Plawski A, Lubinski J, Banasiewicz T, et al. Muta- tions in the APC gene were found in 42 (35 %) Polish families with FAP, and 22 types of mutation in the APC gene were identified. J Med Genet. 2004; 41: e11. 34. Atramentova LA, Belyaeva LV. Correlation between family and age of manifestation of lung and colon cancer. Genetika. 2003; 39(12):1702–9. 35. Sieber OM, Tomlinson IP, Lamlum H. The adeno- matous polyposis coli (APC) tumour suppressor- -genetics, function and disease. Mol Med Today. 2000;6(12):462–9. Review. Erratum in: Mol Med Today 2001;7(1):40. 36. Aretz S, Uhlhaas S, Caspari R, Mangold E, Pagen- stecher C, Propping P, Friedl W. Frequency and parental origin of de novo APC mutations in famil- ial adenomatous polyposis. Eur J Hum Genet. 2004;12(1):52–8. 37. Castellsagué E, González S, Guinó E, Stevens KN, Borràs E, Raymond VM, Lázaro C, Blanco I, Gru- ber SB, Capellá G. Allele-specific expression of APC in adenomatous polyposis families. Gastroen- terology. 2010;139(2):439–47, 447.e1. 38. Spier I, Horpaopan S, Vogt S, Uhlhaas S, Morak M, Stienen D, Draaken M, Ludwig M, Holinski-Fe- der E, Nöthen MM, Hoffmann P, Aretz S. Deep intronic APC mutations explain a substantial pro- portion of patients with familial or early-onset adenomatous polyposis. Hum Mutat. 2012;33(7): 1045–50. 40. Roger L, Jones RE, Heppel NH, Williams GT, Samp- son JR, Baird DM. Extensive telomere erosion in the initiation of colorectal adenomas and its asso- ciation with chromosomal instability. J Natl Cancer Inst. 2013;105(16):1202–11. 41. Hoffmeyer K, Raggioli A, Rudloff S, Anton R, Hier- holzer A, Del Valle I, Hein K, Vogt R, Kemler R. Wnt/β-catenin signaling regulates telomerase in stem cells and cancer cells. Science. 2012;336(6088): 1549–54. 42. Calado RT, Yewdell WT, Wilkerson KL, Regal JA, Kajigaya S, Stratakis CA, Young NS. Sex hormones, acting on the TERT gene, increase telomerase activ- ity in human primary hematopoietic cells. Blood. 2009;114(11):2236–43. 43. Nanni S, Narducci M, Della Pietra L, Moretti F, Grasselli A, De Carli P, Sacchi A, Pontecorvi A, Farsetti A. Signaling through estrogen receptors modulates telomerase activity in human prostate cancer. J Clin Invest. 2002;110(2):219–27. 44. Wu KJ, Grandori C, Amacker M, Simon-Vermot N, Polack A, Lingner J, Dalla-Favera R. Direct activa- tion of TERT transcription by c-MYC. Nat Genet. 1999;21(2):220–4. 45. Newbold RF. The significance of telomerase activa- tion and cellular immortalization in human cancer. Mutagenesis. 2002;17(6):539–50. 46. Kyo S, Takakura M, Kanaya T, Zhuo W, Fujimoto K, Nishio Y, Orimo A, Inoue M. Estrogen activates telomerase. Cancer Res. 1999;59(23):5917–21. 114 M. R. Lozynska, Y. S. Lozynskyy, A. Plawski et al. Сімейний аденоматозний поліпоз: зв’язок між віком виникнення і мутаціями гена АРС для оцінки генетичної антиципації в пацієнтів західних областей України М. Р. Лозинська, Ю. С. Лозинський, А. Плавскі, Р. О. Піняжко, Н. М. Прокопчук, О. М. Федота Мета. Визначити середній вік виникнення сімейно- го аденоматозного поліпозу (САП) у чоловіків, жі- нок, їх родичів, носіїв мутацій гена АРС, або ж у хворих без підтверджених мутацій цього гена, для оцінки антиципації у наступних поколіннях для раннього виявлення осіб групи ризику. Методи. Провели аналіз медичної документації, генеалогіч- ної інформації та виконали молекулярно-генетичне дослідження крові в 25 пробандів із аденоматозним поліпозом. У 44,0 % пробандів було підтверджено САП. Пробанди мали 36 родичів із цим синдромом. Ампліфіковані фрагменти гена APC були скринова- ні на наявність мутацій з використанням конформа- ційного поліморфізму однониткової ДНК, гетероду- плексного аналізу, а також аналізу кривих плавлен- ня ампліконів із високою роздільною здатністю. Вік початку захворювання визначали в пробандів, їх родичів та рахували індекс антиципації (A). Результати. Серед пацієнтів із САП було 61,7 % чоловіків і 38,3 % жінок. Встановлено, що вік ма- ніфестації синдрому в чоловіків становив 36,03 ± 1,44 років, а в жінок захворювання виника- ло раніше – у віці 29,5 ± 2,43 років (р<0,01). Мутації гена APC, включаючи 4 нові мутації, виявили в 63,6 % пробандів із САП. Найменший вік виник- нення поліпозу спостерігали в носіїв мутації с.3927_3931delAAAGA p.Q1309fs гена АРС. Середня різниця у віці початку САП у батьків і їх потомства становила 12,0 ± 1,7 років. У 3 із 4 сімей із САП, члени яких були носіями нових мутацій, спостері- гали переважання чоловічої статі (12:4) і явище антиципації, а один пробанд був носієм мутації, яка виникла de novo. Найсильнішу кореляцію за віком виникнення САП були знайдені в парах матері-на- щадки і батьки-сини. Статистично значуща різниця між отриманими даними підтверджує більшу поді- бність нащадків, особливо синів, з батьками. Висновки. Між віком виникнення САП у пацієнтів, носіїв мутації гена АРС (33.1±2.1 років) і віком хворих, у яких не підтверджено мутацій цього гена за допомогою традиційних методів (33.7±1.6 років), не було виявлено статистично істотної різниці. Індекс антиципації (А) у пацієнтів із САП дорівню- вав 18,0 %. У нащадків із САП зменшення віку виникнення захворювання порівняно з батьками не залежало від наявності мутацій гена АРС. Облік антиципації дозволяє оцінити середній вік початку САП під час генетичного консультування, і, отже, своєчасно здійснювати цільову профілактику. К л юч ов і с л ов а: антиципація, мутації гена APC, вік початку виникнення САП у чоловіків і жінок, сі- мейний аденоматозний поліпоз. Семейный аденоматозный полипоз: связь между возрастом возникновения и спектром мутаций гена АРС для оценки генетической антиципации у пациентов западных областей Украины М. Р. Лозинская, Ю. С. Лозинский, А. Плавски, Р. А. Пиняжко, Н. М. Прокопчук, О. М. Федота Цель. Определить средний возраст начала семейного аденоматозного полипоза (САП) у мужчин, женщин, а также у родственников пробандов носителей мутаций гена АРС, или же у больных без подтвержденных мутаций этого гена, в последующих поколениях для оценки явления антиципации и для раннего выявления лиц групп риска. Методы. Провели анализ медицин- ской документации, генеалогической информации и выполнили молекулярно-генетическое исследование крови в 25 пациентов с аденоматозным полипозом. В 44,0 % пробандов с полипозом было подтверждено САП. Пробанды имели 36 родственников с этим син- дромом. Амплифицированные фрагменты гена APC были скринированы на наличие мутаций с использо- ванием конформационного полиморфизма одноните- вой ДНК, гетеродуплексного анализа, а также анализа кривых плавления ампликонов с высокой раздельной способностью. Возраст начала заболевания определя- ли у пробандов, их родственников и вычисляли индекс антиципации (A). Результаты. Среди пациентов из САП было 61,7 % мужчин и 38,3 % женщин. Усновлено, что возраст начала синдрома в мужчин составлял 115 FAP: age of onset and association with mutations of the APC gene for assessment of the genetic anticipation 36,03 ± 1,44 лет, а у женщин заболевания возникало раньше – в возрасте 29,5 ± 2,43 лет (р<0,01). Мутации гена APC, включая 4 новые мутации, обнаружили в 63,6 % пробандов из САП. Наименьший возраст воз- никновения полипоза наблюдали у носителей мутации с.3927_3931delAAAGA p.Q1309fs гена АРС. Средняя разница в возрасте начала САП у родителей и их по- томства составила 12,0 ± 1,7 лет. У 3 из 4 семей из САП, члены которых были носителями новых мута- ций, наблюдали преобладание мужского пола (12:4) и явление антиципации, а один пробанд был носителем мутации, которая возникла de novo. Самую сильную корреляцию по возрасту возникновения САП было найдено в парах матери-потомки и родители-сыновья. Статистически значимая разница между полученными данными подтверждает большее сходство потомков, особенно сыновей, с родителями. Выводы. Между возрастом возникновения САП у пациентов, носителей мутаций гена АРС (33.1 ± 2.1 года), и возрастом боль- ных, у которых не подтверджено мутаций этого гена с помощью традиционных методов (33.7 ± 1.6 года), не было выявлено статистически значимой разницы. Индекс антиципации у пациентов из САП равнялся 18,0 %. У потомков из САП уменьшение возраста возникновения заболевания по сравнению с родителя- ми не зависело от наличия мутаций гена АРС. Учет антиципации позволяет оценить средний возраст на- чала САП при генетическом консультировании, и, следовательно, своевременно осуществлять целевую профилактику. К л юч е в ы е с л ов а: антиципация, мутации гена APC, возраст начала САП у мужчин и женщин, семей- ный аденоматозный полипоз. Received 15.12.2016

Ähnliche Einträge