Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress
Aim. The changes in expression of the HSP101, HSP60, and HSP17.8 genes in tissues of potato plants of varieties Lukyanovsky under in vitro heat treatment and infection with a ring rot pathogen Clavibacter michiganensis ssp. sepedonicus (Cms) were investigated. Methods. These changes were assessed at...
Gespeichert in:
| Datum: | 2018 |
|---|---|
| Hauptverfasser: | , , , |
| Format: | Artikel |
| Sprache: | English |
| Veröffentlicht: |
Інститут молекулярної біології і генетики НАН України
2018
|
| Schriftenreihe: | Вiopolymers and Cell |
| Schlagworte: | |
| Online Zugang: | http://dspace.nbuv.gov.ua/handle/123456789/154265 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress / V.N. Nurminsky, A.S. Stolbikov, A.V. Pomortsev, A.I. Perfileva // Вiopolymers and Cell. — 2018. — Т. 34, № 1. — С. 3-13. — Бібліогр.: 35 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-154265 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1542652019-07-07T12:00:41Z Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress Nurminsky, V.N. Stolbikov, A.S. Pomortsev, A.V. Perfileva, A.I. Genomics, Transcriptomics and Proteomics Aim. The changes in expression of the HSP101, HSP60, and HSP17.8 genes in tissues of potato plants of varieties Lukyanovsky under in vitro heat treatment and infection with a ring rot pathogen Clavibacter michiganensis ssp. sepedonicus (Cms) were investigated. Methods. These changes were assessed at the transcript and protein levels. Results. It was shown that under heat treatment at 39°C for 2 h, the maximum accumulation of HSP101 was observed. In control experiments, the plants of the two varieties showed neither synthesis of HSP101, HSP60 and HSP17.8 proteins nor expression of the HSP101, HSP60 and HSP17.8 genes. Infection without heat treatment induced HSP60 expression. Infection suppressed activation of HSP genes upon heat stress. Additionally, infection of potato plants by Cms caused an increase in transcription of PR-2 and PR-4 genes. Conclusions Мета. Дослідити зміну експресії білків теплового шоку БТШ101, БТШ 60 і БТШ 17.8 в тканинах картоплі сорту Лук’яновський in vitro при тепловому впливі та зараженні збудником кільцевої гнилі Clavibacter michiganensis ssp. sepedonicus (Cms). Методи. Зміну експресії вивчено на двох рівнях: кількості транскриптів та вмісту протеїну. Результати. Показано, що при тепловому впливі 39 оС протягом 2 годин in vitro спостерігається максимальне накопичення HSP101. В контрольних варіантах у рослин було не було відмічено ані синтезу білків HSP101, HSP60 й HSP17.8, ані утворення транскриптів генів HSP101, HSP60 та HSP17.8. Зараження без теплового впливу індукувало експресію білку HSP60 в рослинах сорту Лук’яновський. Зараження пригнічувало активацію експресії БТШ при тепловому стресі. При зараженні рослин картоплі Cms підвищувалась кількість транскриптів генів PR-2 та PR-4. Висновки. Цель. Исследовать изменение экспрессии БТШ101, БТШ60 и БТШ17.8 in vitro в тканях картофеля сорта Лукьяновский при тепловом воздействии и заражении возбудителем кольцевой гнили Clavibacter michiganensis ssp. sepedonicus (Cms). Методы. Изменение экспрессии изучено на двух уровнях: количества транскриптов и содержании белка. Результаты. Было показано, что при тепловом воздействии 39 оС 2 часа в картофеле наблюдается максимальное накопление HSP101. В контрольных вариантах у растений не было отмечено ни синтеза белков HSP101, HSP60 и HSP17.8, ни образования транскриптов генов HSP101, HSP60 и HSP17.8. Заражение без тепловой обработки индуцировало экспрессию белка HSP60 в растениях сорта Лукьяновский. Заражение подавляло активацию экспрессии БТШ при тепловом стрессе. При заражении растений картофеля Cms повышалось количество транскриптов генов PR-2 и PR-4. Выводы. 2018 Article Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress / V.N. Nurminsky, A.S. Stolbikov, A.V. Pomortsev, A.I. Perfileva // Вiopolymers and Cell. — 2018. — Т. 34, № 1. — С. 3-13. — Бібліогр.: 35 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.00096B http://dspace.nbuv.gov.ua/handle/123456789/154265 581.1 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Genomics, Transcriptomics and Proteomics Genomics, Transcriptomics and Proteomics |
| spellingShingle |
Genomics, Transcriptomics and Proteomics Genomics, Transcriptomics and Proteomics Nurminsky, V.N. Stolbikov, A.S. Pomortsev, A.V. Perfileva, A.I. Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress Вiopolymers and Cell |
| description |
Aim. The changes in expression of the HSP101, HSP60, and HSP17.8 genes in tissues of potato plants of varieties Lukyanovsky under in vitro heat treatment and infection with a ring rot pathogen Clavibacter michiganensis ssp. sepedonicus (Cms) were investigated. Methods. These changes were assessed at the transcript and protein levels. Results. It was shown that under heat treatment at 39°C for 2 h, the maximum accumulation of HSP101 was observed. In control experiments, the plants of the two varieties showed neither synthesis of HSP101, HSP60 and HSP17.8 proteins nor expression of the HSP101, HSP60 and HSP17.8 genes. Infection without heat treatment induced HSP60 expression. Infection suppressed activation of HSP genes upon heat stress. Additionally, infection of potato plants by Cms caused an increase in transcription of PR-2 and PR-4 genes. Conclusions |
| format |
Article |
| author |
Nurminsky, V.N. Stolbikov, A.S. Pomortsev, A.V. Perfileva, A.I. |
| author_facet |
Nurminsky, V.N. Stolbikov, A.S. Pomortsev, A.V. Perfileva, A.I. |
| author_sort |
Nurminsky, V.N. |
| title |
Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress |
| title_short |
Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress |
| title_full |
Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress |
| title_fullStr |
Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress |
| title_full_unstemmed |
Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress |
| title_sort |
expression of pr genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress |
| publisher |
Інститут молекулярної біології і генетики НАН України |
| publishDate |
2018 |
| topic_facet |
Genomics, Transcriptomics and Proteomics |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/154265 |
| citation_txt |
Expression of PR genes and genes of heat shock proteins of potato plants in vitro under infection with ring rot and heat stress / V.N. Nurminsky, A.S. Stolbikov, A.V. Pomortsev, A.I. Perfileva // Вiopolymers and Cell. — 2018. — Т. 34, № 1. — С. 3-13. — Бібліогр.: 35 назв. — англ. |
| series |
Вiopolymers and Cell |
| work_keys_str_mv |
AT nurminskyvn expressionofprgenesandgenesofheatshockproteinsofpotatoplantsinvitrounderinfectionwithringrotandheatstress AT stolbikovas expressionofprgenesandgenesofheatshockproteinsofpotatoplantsinvitrounderinfectionwithringrotandheatstress AT pomortsevav expressionofprgenesandgenesofheatshockproteinsofpotatoplantsinvitrounderinfectionwithringrotandheatstress AT perfilevaai expressionofprgenesandgenesofheatshockproteinsofpotatoplantsinvitrounderinfectionwithringrotandheatstress |
| first_indexed |
2025-07-14T05:55:16Z |
| last_indexed |
2025-07-14T05:55:16Z |
| _version_ |
1837600622214381568 |
| fulltext |
3
V. N. Nurminsky, A. S. Stolbikov, A. V. Pomortsev
© 2018 V. N. Nurminsky et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Bio
polymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium,
provided the original work is properly cited
UDC 581.1
Expression of PR genes and genes of heat shock proteins in potato
plants in vitro under infection with ring rot and heat stress
V. N. Nurminsky, A. S. Stolbikov, A. V. Pomortsev, A. I. Perfileva
Siberian Institute of Plant Physiology and Biochemistry, Siberian Branch of the Russian Academy of Sciences
132, Lermontova Str., Irkutsk, Russian Federation, 664033
alla.light@mail.ru
Aim. The changes in expression of the HSP101, HSP60, and HSP17.8 genes in tissues of
potato plants of varieties Lukyanovsky under in vitro heat treatment and infection with a ring
rot pathogen Clavibacter michiganensis ssp. sepedonicus (Cms) were investigated. Methods.
These changes were assessed at the transcript and protein levels. Results. It was shown that
under heat treatment at 39 °C for 2 h, the maximum accumulation of HSP101 was observed.
In control experiments, the plants of the two varieties showed neither synthesis of HSP101,
HSP60 and HSP17.8 proteins nor expression of the HSP101, HSP60 and HSP17.8 genes.
Infection without heat treatment induced HSP60 expression. Infection suppressed activation
of HSP genes upon heat stress. Additionally, infection of potato plants by Cms caused an in
crease in transcription of PR-2 and PR-4 genes. Conclusions. Potato plants under biotic and
abiotic stress, both independently and combined, activate the expression of a wide range of
the protective proteins, including HSP and PR families.
K e y w o r d s: heat shock proteins, PR, potato, Clavibacter michiganensis ssp. sepedonicus
Introduction
Plants are exposed to various stress factors of
both abiotic and biotic nature. To maintain
homeostasis in plants under stress conditions,
nutrient and energy redistribution between
growth, development processes and protective
reactions takes place [1].
Heat shock proteins (HSPs) are synthesized
in plants in response to the increase in tem
perature to protect from damages induced by
extremely high temperature. HSPs act as cha
pe rones, preventing from protein denaturation
and aggregation, and promoting the restoration
of protein activity after the exposure to high
temperature [2, 3]. HSPs (i) provide for tempo
rary binding and folding facilitation of imma
ture peptides in course of translation, (ii) disas
semble oligomeric protein complexes, (iii) con
trol biological activity of regulatory proteins
(including the transcription factors), (iv) facili
tate protein transport through plant cell mem
branes, (v) prevent against aggregation of par
tially denatured proteins due to intermolecular
Genomics, Transcriptomics
and Proteomics
ISSN 1993-6842 (on-line); ISSN 0233-7657 (print)
Biopolymers and Cell. 2018. Vol. 34. N 1. P 3–13
doi: http://dx.doi.org/10.7124/bc.00096B
mailto:alla.light@mail.ru
4
V. N. Nurminsky, A. S. Stolbikov, A. V. Pomortsev et al.
interactions [4]. It is known that HSPs are syn
thesized not only in response to high tempera
ture, but also to a wide range of stress factors,
e.g., salinity and dehydration [2, 5].
HSPs are divided into several classes de
pending on molecular weight: HSP100,
HSP90, HSP70, HSP60 and low molecular
weight HSP (sHSP) [6]. They differ by the
functions and capability to accumulate under
stress and normal conditions. Protein HSP101
plays a leading role in the development of
plant thermotolerance [7], therefore, investiga
tion of the HSP101 synthesis level in plants is
of interest. A number of HSPs accumulate in
plant cell in the absence of stress, and their
expressions only slightly changed under stress,
for example, HSP60 involved in the folding of
newly synthesized proteins [8]. In some cases,
the HSP accumulation, in particular sHSPs, is
observed under biotic stress [9–11].
The expression of the HSP101 gene is sen
sible to various stresses [7]. Therefore, the
protein is convenient for monitoring the influ
ence of different stress factors on the HSP
expression. HSP60 may be used as a control
variant. HSP17.8 belongs to the sHSP family,
so it can be induced under pathologies [6].
The available literary data on the influence
of thermal action on the plants subjected to
biotic stress are highly controversial. In some
cases, a preliminary thermal treatment led to
an increase in susceptibility of plants to infec
tion. For example, the temperature rise sup
pressed the defense responses of Arabidopsis
thaliana seedlings against Pseudomonas syrin-
gae pathogen infection [12]. An increased tem
perature at tobacco cultivation suppressed the
hypersensitivity reaction (HR) and promoted
the enhanced penetration of mosaic virus into
the plants [13]. The preliminary thermal impact
at 36 °C for 30–120 min intensified the infec
tion of barley with the powdery mildew (fungus
Erysiphe graminis f. sp. Hor dei) [14] and with
the pathogen Blumeria gra mi nis f. sp. Hor-
dei [15]. Shortterm heat treatment of soybeans
at 44 °C induced their susceptibility to
Phytophthora [16]. Similar situation was ob
served in case of infecting Coffea arabica L.
with the pathogens Co lle tot richum kahawae
and C. gloeosporioides, and the development
of susceptibility in this case correlated with the
induction of HSP70 synthesis [17]. On the
contrary, the 50 °C heat treatment for 30–60 s
suppressed infecting barley seedlings with
powdery mildew. Similarly, the heat treatment
of potato plants at 40 °C for 48 h inhibited their
infecting with powdery mildew [11].
Currently, various infection diseases of culti
vated crops, including potato, are widely spread.
Most of such infections are represented by patho
genic fungi and bacteria [18]. For example, in
the Nordic countries and Canada, up to 50 % of
the potato crops are regularly lost owing to the
ring rot potato disease caused by grampositive
bacterium Clavibacter michiganensis ssp. sepe-
donicus (Сms). There is no information about the
conditions provoking HSP synthesis in potato
under heat stress and pathogenesis, or in case of
superposition of the two stress factors. The data
available are either indirect or quite contradic
tory. The tomato plant cultivation at 15 °C sup
pressed manifestation of the symptoms of C.
michiganensis infecting [19]. In contrast, planting
the wild potato species S. acaule at 15 °C stimu
lated colonization of the plants with Cms, and
only at 21 °C – made the plants resistant to the
pathogen [20]. However, in these experiments,
the plants were grown (i) all the time at elevated
5
Expression of PR genes and genes of heat shock proteins in potato plants in vitro under infection with ring rot and heat stress
temperature, (ii) in the temperature conditions
(21–23 °C), when there was no synthesis of HSPs
in plants, and (iii) the species peculiarities were
not taken into account [2].
So, a role of HSPs in a cell under combined
effect of the two stress factors on plant – infec
tion and heat shock – is not clear. The aim of
our investigation was to study the character of
variations in the content of different HSP fam
ilies (HSP101, HSP60, and HSP17.8) and PR
proteins in potato tissues in vitro under heat
stress and infection with the ring rot pathogen.
Materials and Methods
Our investigations were conducted with the
potato plants Solanum tuberosum L. of species
Lukyanovsky in vitro. The plants of this spe
cies are characterized by susceptibility to a
number of pathogens, including ring rot [21].
That is why this species was chosen to obtain
a vivid picture of the gene expressions chan
ges. Microcloning of in vitro plants was per
formed by grafting. The seed pieces (grafts)
were placed into the agarbased nutrient
Murashige and Skoog (MS) medium with the
addition of sucrose 30 g/l, pyridoxine 1 mg/l,
thiamine 1 mg/l, ferulic acid 1 mg/l, рН 5.8–
6.0, at the depth of the internodes. The seed
pieces were cultivated under factorostatic con
ditions at 26±1 °C, illumination 32W/m2, pho
toperiod duration – 16 h.
Potato tissues were infected with Cms, strain
Ac 14 05, obtained from AllRussian collection
of microorganisms (Moscow). The bacterial
culture was grown in agarbased medium placed
in Petri dishes and containing dialysate solution
of yeast extract (SigmaAldrich, Inc., USA)
10 g/l, glucose 15 g/l, agaragar (Biotechno
vatsiya, Inc., Russia) 10 g/l, CaCO3 (Reachem,
Inc., Russia) 5 g/l, pH 7.0. The bacteria were
cultivated in a thermostat at 25 °C, in darkness.
To reveal the temperature of maximum HSP
synthesis the potato plants in vitro were heat
ed in an airdrying thermostat during 2 h at 26,
35, 37, 39, 42, 45, 50 °C. Next, the total pro
tein was isolated, and the content of HSP101
in the samples was determined by PAGE,
Western blotting and staining nitrocellulose
membranes with antibodies.
A series of the following experiments was
conducted to investigate the effect of the ring
rot infection upon the accumulation of the HSP
gene transcripts and content of HSPs in po
tato plants. The potato plants were infected
with Cms and after 48 h of incubation at 26 °C
underwent heat stress (39 °C, 2 h). The chan
ges in expression of the genes were registered
at both levels – transcript accumulation and
protein synthesis. The time of coincubation
was chosen due to our previous observa
tions [22], which showed that after 24 h of
coincubation the bacteria penetrated into the
root and stem zones of potato plants.
We also investigated the process of accumu
lation of the studied genes’ transcripts under the
conditions of heat treatment and infection with
the pathogen using reverse transcription real
time PCR. Earlier, in order to exclude possible
false positive results, PCR was conducted with
primers of the potato HSP genes on the matrix
of plasmid and chromosomal DNA of Cms. As
known, in the process of coevolution of the
pathogen and the host plant, acquisition and
transfer of genes from one organism to the
other (horizontal gene transfer) may occur [23].
As a result of the PCR test conducted on the
Cms DNA matrix, no products of amplification
were found, that evidenced for the absence of
6
V. N. Nurminsky, A. S. Stolbikov, A. V. Pomortsev et al.
genetic sequences, to which the primers were
selected, in the bacteria.
In experiments on the influence of Cms
bacterium infection (in combination with heat
shock) upon HSP expression, the suspension
with Cms (titer = 1×109 CFU/ml) was intro
duced into the growth medium of potato plants
in vitro. The plants were incubated under fac
torostatic conditions for 48 h. Next, the plants
underwent heat treatment in an airdrying ther
mostat at 26 or 39 °C for 2 h, afterwards the
total protein and RNA were separated. The
time of coincubation was chosen according to
our previous experiments on the intensity of
potato plant colonization with Cms by plating
tissue homogenates of root, stem and apical
zones. It has been found [22] that 2 days after
infecting the potato plants in vitro were com
pletely colonized with the pathogen.
For isolation of the total protein we used
0.5 g sample of the total plant (leaves, stems
and roots). A buffer was added to the sample
to extract the protein (0.1 M TrisHCl, 0.003 M
DDS-Na, 0.001 M β-mercaptoethanol, 4 %
polyvinylpyrrolidone, pH 7.4–7.6) and a 1 mM
solution of phenylmethylsulfonyl fluoride
(PMSF) for inhibiting proteases. A sample with
quartz sand was thoroughly ground to powder
in a mortar with liquid nitrogen. Сoarse cel
lular components of the sample were removed
by centrifugation at 15,000 rpm (Centrifuge
Allegra 64 R, USA) for 15 min. The protein
from the supernatant was precipitated with a
threefold volume of cooled acetone. The pro
tein pellet was dissolved in the buffer prepared
for the sample (0.625 M TrisHCl, 0.008 M
DDS-Na, 0.1 M β-mercaptoethanol, 10% glyc
erol, pH 6.8), incubated at 100 °C for 5 min
and centrifuged at 5000 rpm (Centrifuge
MiniSpin, Germany) for 15 min. The samples
obtained were boiled in the water bath at 95 °C
for 3 min. The protein was diluted in the sam
ple buffer with bromophenol blue (0.625 M
TrisHCl, 0.008 M DDSNa, 10 % glycerol,
0.001 % bromophenol blue, pH 6.8) and used
for electrophoresis fractionation of 10 μg of
protein per track [24]. Electrophoresis in
PAAG was conducted according to the modi
fied Laemmli system, on the Mini-PRONEAN
III Electrophoretic Cell, BioRad (USA). 13 %
PAAG was used to the end of simultaneous
fractionation of highmolecular weight and
lowmolecular weight proteins. The protein
molecular weight was determined by the path
length of the corresponding protein in the gel
with the aid of a standard set of protein mar
kers (SibEnzyme). In order to determine the
protein load upon the track and to equalize the
volume of application of the samples, a special
program Gel Analysis (Russia) was used.
The transfer of proteins onto the nitrocel
lulose membrane (Sigma, USA) was carried
out by a “wet” technique in a special blotting
device (BioRad, USA). In this work, antibod
ies against HSP101 (Agrisera AS 07253,
Sweden), HSP60 (US Biological H183077B,
USA), HSP17.6 TTP 2 (Agrisera As 07255,
Sweden), class I, were used. The antibodies
against HSP17.6 specific for Arabidopsis thali-
ana were used because HSP17.8 (present in
potato tissues) is homologous to HSP17.6 of
Arabidopsis. Visualization of antibodies was
conducted with the use of secondary antibod
ies conjugated with alkaline phosphatase
(Sigma, USA), in the presence of BCIP and
NBT (Sigma, USA). After that, the nitrocel
lulose membranes were dried at indoor tem
perature and scanned.
7
Expression of PR genes and genes of heat shock proteins in potato plants in vitro under infection with ring rot and heat stress
Isolation of plasmid DNA (miniprep) from
bacteria was carried out by the technique of
alkaline lysis using polyethylene glycol (PEG
6000). Chromosomal DNA of the bacteria was
obtained with commercial kits GenFlute
Bacterial Genomic DNA Kit (USA). In PCR on
the matrices of plasmid and chromosomal DNA
we used ReadyMix Tag PCR Reaction Mix kits
(Sigma, USA). PCR was conducted on the
GENE CYCLER (BioRad, USA) according to
the following program: 1 cycle 94 °C – 5 min;
25 cycles of 94 °C – 1 min; 56 °С – 1 min;
72 °C – 1 min; 1 cycle 72 °C – 7 min. For
electrophoretic separation of the amplification
products, 1.2 % agarose gel in TAE buffer
(242.2 g/L TRIS, 89.6 ml/L glacial acetic acid,
18.62 g/L disodium EDTA pH 7.6) was used
with the addition of 5 μg/ml ethidium bromide.
The voltage was 80 to 110 V. The gel was pho
tographed in the ultraviolet spectrum with the
geldocumentation system (BioRad, USA).
Isolation of RNA from plant tissues was
carried out with TRIReagent (SigmaAldrich,
USA) according to the manufacturer’s proto
col. Since small volumes of the samples were
used in the experiments, for RNA isolation the
tissues of leaves were taken from the middle
tier of the potato plants. Homogenization of
the TRIReagent material was carried out in a
TissueLyser II homogenizer (Qiagen, USA)
for 2 min at the frequency of 30 cycles per
second. The proteins were denatured with bro
mochloropropane (SigmaAldrich, USA). The
nucleic acids were precipitated with 2.5 vo lu
mes of 96 % ethanol at – 20 °C during the
night. Next, the samples were centrifuged at
14,000 g and +4 °C for 10 min, the residual
nucleic acid pellet was dried at the room tem
perature, resuspended in 25–40 μl of deionized
sterilized water and used to synthesize the first
cDNA strand. The amount (normalized multi
plicity of expression) and purity of the iso
lated RNA were evaluated spectrophotometri
cally (NanoPhotometer NP80 spectrophotom
eter, Implen GmbH, Germany) via the optical
density indicator at 260/280 nm. Furthermore,
the quality of isolated RNA was monitored by
the technique of electrophoresis in 1 % agarose
gel under nondenaturing conditions.
In case of cDNA synthesis, 1 μg of RNA was
taken for one reaction. When the first cDNA
strand was created, RNA previously treated with
DNAase I (Fermentas, Lithuania) was used as
the matrix. Synthesis was conducted using oli
go (dT) 15 primer and reversetranscriptase
RevertAid H Minus MMuLV (Fermentas,
Lithuania) according to the manufacturer’s pro
tocol (with minor modifications).
The sequences of potato genes HSP17.8,
HSP101, HSP60 and EF-1α (the reference
gene) were taken from the Spud DB database
(http://solanaceae.plantbiology.msu.edu/) and
tested in Blast NCBI GenBank (http: // www.
ncbi.nlm.nih.gov/genbank/). The following
primers for the analyzed genes were chosen.
For the HSP17.8 gene, the pair HSP17.8L:
TCCAAAGGAAGAGGTGAAGAAACC and
HSP17.8R: CGACTCAGCATAAGACACAG
GCA. For the HSP101 gene, the pair HSP101L:
AGGAGGTGGTTGGAGAAGAAAGT and
HSP101R: CCCAGTAGCAGCATTCACAAGC.
For the HSP60 gene, the pair HSP60L: GTAG
AGGGTGCTGTCGTGGT and HSP60R:
GCTGTCCTAATCACTTTCACTGGAT. For
the EF-1α gene, the pair EF-1αL ATGGTTGT
TGAGACCTTTGCTGA and EF-1αR: GCACT
GTTCACTTTCCCTTCTTCTG. For the PR4
gene, the pair PR4L: GGCTGGACCGCTTTTTG
8
V. N. Nurminsky, A. S. Stolbikov, A. V. Pomortsev et al.
TGG and PR4R: CTGTTTCTTGTGTTCCTGT
TCCTGT. For the PR2 gene, the pair PR2L:
GCTGCGATGGAACGAACAGGA and
PR2R: CCAGGCTTTCTCGGACTACCT.
The reversetranscriptase PCR was con
ducted in real time using a readymade mixture
of qPCRmixHS SYBR reagents (Eurogen,
Russia) and the proper equipment C 1000
Thermal Cycler CFX 96 RealTime System
(BioRad, USA). The volume of the reaction
mixture was 10 μl. PCR was conducted ac
cording to the following protocol: warming up
to 50 °C for 2 min, one denaturing cycle
(95 °C, 5 min), 36 amplification cycles (95 °C,
20 sec – 60 °C, 30 sec – 72 °C, 30 sec).
Software MS Excel and Statistica was used
for statistical analysis of the data obtained.
Results and Discussion
It is known that HSP101 plays a leading role in
thermotolerance in plants [7], therefore, in the
first series of experiments we have chosen the
conditions, under which maximum synthesis of
HSPs in vitro under heat treatment is observed
in potato plants. The maximum amount of
HSP101 in potato plants in vitro was found
under heat treatment at 39 °C, 2 h (Fig. 1).
Then we have investigated the process of ac
cumulation of transcripts of the studied genes
under the conditions of heat treatment and infec
tion with the pathogen. It was revealed that the
greatest accumulation of HSP101 (Fig. 1) and a
high content of the HSP101 gene transcripts (Fig.
2) were observed at 39 °C. As far as the genes
HSP17.8 and HSP60 are concerned, a multiple
increase in the level of transcripts after heat treat
ment of the plants was revealed with respect to
the control plants (without heat treatment). The
smallest changes in the level of transcripts (do
zensfold) were observed for the gene HSP60,
the largest changes (thousandsfold) – for the
gene HSP17.8 (Fig. 2). No valid expression
level for all these genes was observed in the
control plants and in case of infecting the plants
with the phytopathogen. In the case of superpo
sition of the two stress factors (heat treatment of
the plants infected with Cms) a 4fold decrease
in the number of the HSP101 gene transcripts
was observed. Noteworthy, a level of the HSP60
gene expression in potato tissues at heat stress
and infection was substantially lower (18 c.u.
(conditional units)) than that at heat treatment
only (35 c.u.). The combined treatment of po
tato plants resulted in [an] increase of the number
of the HSP17.8 gene transcripts by 1.5 times as
compared to heat treatment only.
At the next stage of the research the content
of tested HSPs was measured. The data are
presented in Fig. 3. Synthesis of HSP60 and
HSP101 in the control plants was observed in
trace amounts. Heat treatment of potato plants
at 39 °C induced the synthesis of HSP101,
HSP60 and HSP17.8. Infecting potato plants
with Cms significantly induced the synthesis of
HSP60, and insignificantly – HSP101 (Fig. 3).
However, infecting potato plants under heat
Fig. 1. The content of the HSP101 protein in potato tis
sues in vitro under various thermal effects in the range of
26–50 °C. Results of Western blotting. The stacking gel
was prepared with a 13 % polyacrylamide concentration
by weight, 10 μg of protein was applied to the track.
Data of a typical experiment are shown. The experiments
were conducted in the form of at least 3 independent re
checks. 3 plants in each sample were used in order to
extract protein (for immune blotting).
9
Expression of PR genes and genes of heat shock proteins in potato plants in vitro under infection with ring rot and heat stress
stress at 39 °C enhanced the synthesis of HSP101
(Fig. 4). Such an impact also resulted in an in
crease of HSP17.8 and induction of HSP60.
In present work both the largest content of
HSP101 in potato plants in vitro (Fig. 1, 3),
and a large number of the HSP101 gene tran
script (Fig. 2) were revealed under heat treat
ment at 39 °C (2 h). All the available data only
indirectly indicate the temperature range influ
encing the HSP synthesis in potato plants.
Meanwhile, there are no clear data on the time
and temperature ranges of thermal exposure
inducing the HSP synthesis in potato plants
[25–27]. So, it was revealed for the first time
that the heat treatment of potato plants in vitro
at 39 °C for 2 h induced maximum synthesis
of HSPs. The temperature of maximum syn
thesis of HSPs in A. thaliana is known to be
37–38 °C [28], in Sorghum bicolar – 45 °С
[29], in yeast S. cerevisiae – 37–39 °С [30].
Infecting potato plants in vitro with Cms
actually did not influence the HSP expression at
both the HSP gene transcript level (Fig. 2) and
the protein level (Fig. 3). Infection induced the
HSP synthesis only in trace amounts (Fig. 3).
It is likely that, because of the lack of specific
receptors to Cms pathogen, the pathogen sus
ceptible potato plants react to Cms bacteria like
to any other stress factors, and respond to this
pathogen with a such nonspecific reaction as the
HSP synthesis. Owing to the presence of spe
cific Cms receptors, recognition of the pathogen
takes place in the cells of resistant variety plants,
and a cascade of signaling reactions is initia
ted [31]. This process leads to the regulation of
gene expression and probably to obtaining syn
thesized proteins of direct antimicrobial activity.
However, the results of measuring the stu
died HSP gene transcripts indicate that the
Fig. 2. Variations in the level of transcripts of the genes
HSP101, HSP60 and HSP17.8 in potato leaf tissues in
vitro under heat stress and infection.
Data of a typical experiment are shown. C – check sam
ples; HS – heat shock conditions corresponding to heat
stress (39 °C, 2 h); Inf – conditions of inoculation of po
tato plants with Cms; Inf+HS – conditions, when potato
tissues are inoculated with Cms and subjected to heat
stress (39 °C, 2 h). The experiments, which presumed
isolation of RNA (for realtime PCR), were conducted in
the form of at least 3 independent rechecks. 3 plants in
each sample were used. M±SD, n=3.
10
V. N. Nurminsky, A. S. Stolbikov, A. V. Pomortsev et al.
combination of Cms infecting and heat treat
ment of potato plants inhibits the thermal ac
tivation of the HSP101 and HSP60 gene ex
pression. Meanwhile, heat stress stimulates the
HSP17.8 gene expression.
These results evidence that biotic stress is
able to initiate and transform the protective
response of plants to heat influence. The fact of
such response correlates with the data related
to variations in the expression level of the genes
encoding pathogenrelated (PR) proteins. In this
work, it was shown that the expression levels
of the genes PR2 (1,3-β-gluco si dase) and PR4
(heveinlike protein) in tissues of the susceptible
potato variety Lukyanovsky were amplified
under the Cms infection, and the expression
level of the PR2 gene under biotic stress was
twice higher than that of PR4 (Fig. 4). The
growth of the number of transcripts of these
genes by 2–3 times is considered to be substan
tial. According to literary data, the infecting of
tomato plants with Clavibacter michiganensis
ssp. michiganensis (tomato pathogen) is known
to amplify the contents of such proteins as
1,3-β-glucosidase (PR2), endochitinase (PR3),
heveinlike protein (PR4), thaumatin/osmotin
(PR5), cucumisinlike serine protease [32]. The
induction of expression of the PR genes (PR1,
PR2, PR3, PR4, PR5, PR6) was also shown in
the tomato plants infected with bacteria Pecto-
bac te rium carotovorum [33].
Noteworthy, in our investigation, when po
tato plants were heat treated, the levels of tran
scripts of the PR2 and PR4 genes were also
increased in comparison with contral samples.
The PR4 gene expression was 3fold higher
under heat stress compared to the control sam
ple. There are the reports that expression of this
gene in tissues of other plants can increase
Fig. 4. Variations in the level of transcripts of the PR-2
and PR-4 genes in potato leaf tissues in vitro under heat
stress and Cms infection.
Data of a typical experiment are shown. C – control sam
ples; HS – heat stress (39 °C, 2 h); Inf – inoculation of
potato plants with Cms; Inf+HS – potato tissues are inocu
lated with Cms and subjected to heat stress (39 °C, 2 h).
The experiments, which presumed isolation of RNA (for
realtime PCR), were conducted in the form of at least
3 independent rechecks. 3 plants in each sample were
used. M±SD, n=3.
Fig. 3. Results of Western blotting of the HSP101, HSP60
and HSP17.8 proteins of potato plants under the condi
tions of heat exposure and infecting with Cms.
Data of a typical experiment are shown. C – control sam
ples; HS – heat stress (39 °C, 2 h); Inf – inoculation of
potato plants with Cms; Inf+HS –potato tissues are inoc
ulated with Cms and subjected to heat stress (39 °C, 2 h).
Potato plants in vitro were inoculated with Cms. After
2 days of coincubation, the plants were heat treated at
39 °C (2 h) and the content of HSPs was determined.
The experiments were conducted in the form of at least 3
independent rechecks. 3 plants in each sample were used
in order to extract protein (for immune blotting).
11
Expression of PR genes and genes of heat shock proteins in potato plants in vitro under infection with ring rot and heat stress
under abiotic stresses. For example, it was ob
served in rice under ultraviolet treatment, tem
perature effect (4 °C, 12 °C), salinity, exposure
to abscisic and jasmonic acids [34], and in
arabidopsis – when treated with ethy lene [35].
Under the combined influence of the two
stress factors (Cms infection and heat treatment),
there was a 4fold growth of the PR2 and PR4
gene transcripts number (Fig. 4). The changes
in the number of transcripts of the HSP genes
may be explained by changes in the PRprotein
genes expression. For example, under biotic
stress, one can observe an increase in the PR
gene expression (Fig. 4), while the HSP gene
expression is not intensive. Under heat treat
ment, it is possible to observe some increase in
the HSP and PR gene expression, which may be
explained by intensification of the protective
proteins synthesis as a non-specific protective
response of the plant to stress factors. In case of
superposition of two stress factors, the number
of transcripts of the majority of analyzed HSP
genes is smaller than that under only heat treat
ment; furthermore, on the contrary, the number
of transcripts of the PR genes grows.
Conclusions
Therefore, for the first time we have shown the
following. (1) Hightemperature exposure
(39 °C for 2 h) of potato plants cultivated in
vitro provokes the greatest increase of the
HSP101 gene transcript level and maximum
induction of the HSP101 synthesis. (2) Cms
infecting does not affect the expression of HSPs
and activates the expression of PR2 and PR4
genes in potato plants. (3) Heat stress combined
with infection leads to an increase in the expres
sion of all the genes studied, whereas the max
imum expression of the HSP17.8 and PR2 genes
is observed. The obtained results indicate that
the plants under stressful influences activate the
protective programs, including a wide range of
the protective proteins.
Acknowledgments
The research was done using the equipment of
Core Facilities Center “Bioanalitika” and the col
lections of Core Facilities Center “Bio re source
Center” at Siberian Institute of Plant Physiology
and Biochemistry SB RAS (Irkutsk, Russia).
Funding
The work has been conducted with the financial
support of Russian Foundation for Basic Research
(RFBR), Grant No. mol_a 163400806.
REFERENCES
1. Prasch CM, Sonnewald U. Signaling events in
plants: stress factors in combination change the
picture. Environ Exp Bot. 2015;114:4–14.
2. Vierling E. The roles of heat shock proteins in plants.
Annu Rev Plant Physiol Plant Mol Biol. 1991;42:579–
620.
3. Qu AL, Ding YF, Jiang Q, Zhu C. Molecular mech
anisms of the plant heat stress response. Biochem
Biophys Res Commun. 2013;432(2):203–7.
4. Basha E, Lee GJ, Breci LA, Hausrath AC, Buan NR,
Giese KC, Vierling E. The identity of proteins as
sociated with a small heat shock protein during heat
stress in vivo indicates that these chaperones protect
a wide range of cellular functions. J Biol Chem.
2004;279(9):7566–75.
5. Wahid A, Gelani S, Ashraf M, Foolad MR. Heat
tolerance in plants. An overview. Environ Exp Bot.
2007;61(3):199–223.
6. Gupta SC, Sharma A, Mishra M, Mishra RK, Chow-
dhuri DK. Heat shock proteins in toxicology: how
close and how far? Life Sci. 2010;86(11–12):377–84.
7. Singh A, Grover A. Plant Hsp100/ClpBlike proteins:
poorlyanalyzed cousins of yeast ClpB machine.
Plant Mol Biol. 2010;74(4–5):395–404.
12
V. N. Nurminsky, A. S. Stolbikov, A. V. Pomortsev et al.
8. Al-Whaibi MH. Plant heatshock proteins: a mini
review. J King Saud Univ Sci. 2011;23(2):139–50.
9. Krause M, Durner J. Harpin inactivates mitochon
dria in Arabidopsis suspension cells. Mol Plant
Microbe Interact. 2004;17(2):131–9.
10. Maimbo M, Ohnishi K, Hikichi Y, Yoshioka H,
Kiba A. Induction of a small heat shock protein and
its functional roles in Nicotiana plants in the defense
response against Ralstonia solanacearum. Plant
Physiol. 2007;145(4):1588–99.
11. Kubienová L, Sedlářová M, Vítečková-Wünschová A,
Piterková J, Luhová L, Mieslerová B, Lebeda A,
Navrátil M, Petřivalský M. Effect of extreme tem
peratures on powdery mildew development and
Hsp70 induction in tomato and wild Solanum spp.
Plant Protect Sci. 2013;49(Sp Iss):S41–55.
12. Wang Y, Bao Z, Zhu Y, Hua J. Analysis of temperature
modulation of plant defense against biotrophic microbes.
Mol Plant Microbe Interact. 2009;22(5):498–506.
13. Király L, Hafez YM, Fodor J, Király Z. Suppression
of tobacco mosaic virusinduced hypersensitivetype
necrotization in tobacco at high temperature is as
sociated with downregulation of NADPH oxidase
and superoxide and stimulation of dehydroascorbate
reductase. J Gen Virol. 2008;89(Pt 3):799–808.
14. Schweizer P, Vallélian-Bindschedler L, Mösinger E.
Heatinduced resistance in barley to the powdery
mildew fungus Erysiphe graminis f.sp. hordei. Physi
ol Mol. 1995;47(1):51–66.
15. Vallelian-Bindschedler L, Schweizer P, Mosinger E,
Metraux JP. Heatinduced resistance in barley to
powdery mildew (Blumeria graminisf.sp.hordei) is
associated with a burst of active oxygen species.
Physiol Mol Plant Pathol. 1998;52(3):185–99.
16. Gijzen M, MacGregor T, Bhattacharyya M, Buzzell R.
Temperature induced susceptibility to Phytophthora
sojae in soybean isolines carrying diffe rent Rps genes.
Physiol Mol Plant Pathol. 1996;48(3):209–15.
17. Chen SR, Dunigan DD, Dickman MB. Bcl2 fa mi ly
members inhibit oxidative stressinduced pro
grammed cell death in Saccharomyces cerevisiae.
Free Radic Biol Med. 2003;34(10):1315–25.
18. Anisimov BV, Belov GL, Varitsev Yu.A., Elanskii SN,
Zhuromsky GK, Zavriev SK, Zeyruk VN, Ivanyuk VG,
Kuznetsova MA, Plyahnevich MP, Pshechenkov KA,
Simakov EA, Sklyarova NP, Stashevski Z, Uskov AI,
Yashina IM. Protection of potato plants from diseases,
pests and weeds. Moscow: “Kartofelevod”, 2009; 272 p.
19. Chang RJ, Ries SM, Pataky JK. Effects of tempera
ture, plant age, inoculum concentration, and cultivar
on the incubation period and severity of bacterial
canker of tomato. Plant Dis. 1992;76(11):1150–5.
20. Laurila J, Metzler MC, Ishimaru CA, Rokka VM.
Infection of plant material derived from Solanum
acaule with Clavibacter michiganensis ssp. sepe
donicus: temperature as a determining factor in
immunity of S. acaule to bacterial ring rot. Plant
Pathol. 2003;52(4):496–504.
21. Romanenko AS, Riffel AA, Graskova IA, Rachen-
ko MA. The role of extracellular pHhomeostasis in
potato resistance to ringrot pathogen. J Phyto-
pathol. 1999;147(11–12):679–86.
22. Perfileva AI, Rymareva EV. The impact of sodium
monoiodoacetate on the colonization of potato plants
in vitro with the causative agent of ring rot. Plant
Protect Quarantine. 2013;3:49–50.
23. Khavkin EE. Potato late blight as a model of co
evolution in the hostpathogen system. Rus J Plant
Physiol. 2015;62(3):439–51.
24. Pobezhimova TP, Kolesnichenko AV, Grabelnykh OI.
Methods of plant mitochondria investigations. Po-
larography and electrophoresis. Moscow: Prome
kobezopasnost, 2004; 99 p.
25. Ahn Y, Claussen K, Zimmerman L. Genotypic dif
ferences in the heatshock response and thermo to
le rance in four potato cultivar. Plant Science.
2004;166(4):901–11.
26. Levy D, Veilleux RE. Adaptation of potato to high
temperatures and salinity – a review. Amer J Po-
tato Res. 2007;84(6):487–506.
27. Tang R, Zhu W, Song X, Lin X, Cai J, Wang M,
Yang Q. Genome-Wide Identification and Function
Analyses of Heat Shock Transcription Factors in
Potato. Front Plant Sci. 2016;7:490.
28. Hong SW, Lee U, Vierling E. Arabidopsis hot mutants
define multiple functions required for acclimation to
high temperatures. Plant Physiol. 2003;132(2):757–67.
29. Howarth CJ. Molecular responses of plants to an
increased incidence of heat shock. Plant Cell Envi-
ron. 1991;14(8):831–41.
13
Expression of PR genes and genes of heat shock proteins in potato plants in vitro under infection with ring rot and heat stress
30. Rikhvanov EG, Voynikov VK. Hsp104p functions in
induced thermotolerance and prion inheritance in Sac
charomyces cerevisiae. Biol Bull Rev. 2005;125:115–28.
31. Lomovatskaya LA, Romanenko AS, Filinova NV,
Salyaev RK. Influence of exopolysaccharides of the
causative agent of ring rot on the kinetic parameters
of adenylate cyclases of potato plants. Doklady Biol
Sci. 2011; 441(4):565–8.
32. Savidor A, Teper D, Gartemann KH, Eichenlaub R,
Chalupowicz L, Manulis-Sasson S, Barash I,
Tews H, Mayer K, Giannone RJ, Hettich RL, Ses-
sa G. The Clavibacter michiganensis subsp. michi-
ganensis-tomato interactome reveals the perception
of pathogen by the host and suggests mechanisms
of infection. J Proteome Res. 2012;11(2):73650. d
33. Nikolaychik EA. Systemic induction of PR genes of
Solanum Lycopersicum plants in contact with bac
teria Pectobacterium carotovorum: the role of the
dspE gene. Proceed BSU. 2009;4(2):215–25.
34. Wang N, Xiao B, Xiong L. Identification of a cluster
of PR4like genes involved in stress responses in
rice. J Plant Physiol. 2011;168(18):2212–24.
35. Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT,
Yang C, He X, Han Y, Martin GB. Tomato transcrip
tion factors pti4, pti5, and pti6 activate defense re
sponses when expressed in Arabidopsis. Plant Cell.
2002;14(4):817–31.
Експресія генів PR та білків теплового шоку
в картоплі in vitro при інокуляції кільцевою
гниллю й тепловому впливі
В. Н. Нурмiнский, А. С. Столбiков,
А. В. Поморцев, А. І. Перфільєва
Мета. Дослідити зміну експресії білків теплового шоку
БТШ101, БТШ 60 і БТШ 17.8 в тканинах картоплі
сорту Лук’яновський in vitro при тепловому впливі та
зараженні збудником кільцевої гнилі Clavibacter
michiganensis ssp. sepedonicus (Cms). Методи. Зміну
експресії вивчено на двох рівнях: кількості транс
криптів та вмісту протеїну. Результати. Показано, що
при тепловому впливі 39 °С протягом 2 годин in vitro
спостерігається максимальне накопичення HSP101. В
контрольних варіантах у рослин було не було відміче
но ані синтезу білків HSP101, HSP60 й HSP17.8, ані
утворення транскриптів генів HSP101, HSP60 та
HSP17.8. Зараження без теплового впливу індукувало
експресію білку HSP60. Зараження пригнічувало ак
тивацію експресії БТШ при тепловому стресі. При
зараженні рослин картоплі Cms підвищувалась кіль
кість транскриптів генів PR-2 та PR-4. Висновки.
Рослини картоплі при біотичних і абіотичних стресах,
як окремо, так і спільно, активують експресію широ
кого спектру захисних білків, включаючи білки сімей
ства HSP і PR.
К л юч ов і с л ов а: білки теплового шоку, PR, кар
топля, Clavibacter michoganensis ssp. sepedonicus.
Экспрессия генов PR и белков теплового шока
в картофеле in vitro при заражении кольцевой
гнилью и тепловом воздействии
В. Н. Нурминский, А. С. Столбиков,
А. В. Поморцев, А. И. Перфильева
Цель. Исследовать изменение экспрессии БТШ101,
БТШ60 и БТШ17.8 in vitro в тканях картофеля сорта
Лукьяновский при тепловом воздействии и заражении
возбудителем кольцевой гнили Clavibacter michi ga nen-
sis ssp. sepedonicus (Cms). Методы. Изменение экс
прессии изучено на двух уровнях: количества транс
криптов и содержании белка. Результаты. Было по
казано, что при тепловом воздействии 39 °С 2 часа в
картофеле наблюдается максимальное накопление
HSP101. В контрольных вариантах у растений не было
отмечено ни синтеза белков HSP101, HSP60 и HSP17.8,
ни образования транскриптов генов HSP101, HSP60 и
HSP17.8. Заражение без тепловой обработки индуци
ровало экспрессию белка HSP60. Заражение подавля
ло активацию экспрессии БТШ при тепловом стрессе.
При заражении растений картофеля Cms повышалось
количество транскриптов генов PR-2 и PR-4. Выводы.
Растения картофеля при биотическом и абиотическом
стрессах, как по отдельности, так и совместно, акти
вируют экспрессию широкого спектра защитных бел
ков, включая белки семейства HSP и PR.
К л юч е в ы е с л ов а: белки теплового шока, PR,
картофель, Clavibacter michoganensis ssp. sepedonicus.
Received 27.01.2017
|