Spectrum of mutations in patients with organic acidurias from Ukraine
Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4) in patients with iso...
Збережено в:
| Дата: | 2018 |
|---|---|
| Автори: | , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут молекулярної біології і генетики НАН України
2018
|
| Назва видання: | Вiopolymers and Cell |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/154281 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Spectrum of mutations in patients with organic acidurias from Ukraine / O.I. Barvinska, N.V. Olkhovych, T.O. Shkurko, N.G. Gorovenko // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 107-116. — Бібліогр.: 19 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-154281 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1542812019-07-07T12:25:45Z Spectrum of mutations in patients with organic acidurias from Ukraine Barvinska, O.I. Olkhovych, N.V. Shkurko, T.O. Gorovenko, N.G. Biomedicine Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4) in patients with isovaleric aciduria, 100 % of alleles (4/4) in patients with glutaric aciduria type I. MUT gene mutations in patients from Ukraine are represented by one known N219Y missense mutation p. and a R326G missense rearrangement. Analysis of the GCDH gene in patients from Ukraine revealed three known missense mutations: R383C, G390R and A421V. Rearrangements in the IVD gene of our patients were represented by two novel mutations: 49dupTGTGGCG, S133C, and one known mutation: R53P. Conclusions. The mutations observed in Ukrainian patients with organic acidurias were mostly represented by rare or new rearrangements. These data could be useful for the development of molecular diagnostics of Ukrainian patients with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria Мета. Визначення спектру мутацій у пацієнтів з України, що страждають на глутарову ацидурію I типу, ізольовану метилмалонову ацидурію та ізовалеріанову ацидурію. Методи. Сиквенування за Сенгером. Результати. Було виявлено 37,5 % мутантних алелей (три зразки з восьми) у пацієнтів з ізольованою метилмалоновою ацирурією, 100 % алелей (чотири з чотирьох) у хворих з ізовалеріановою ацидурією, 100 % алелей (чотири з чотирьох) у пацієнтів з глутаровою ацидурією I типу. Спектр мутацій у гені MUT у пацієнтів в Україні представлений однією відомою місенс мутацією с. N219Y та місенс заміною p. R326G. В результаті аналізу сиквенсу гену GCDH у пацієнтів було виявлено три відомі місенс перебудови p. R383C, p. G390R та p. A421V. Мутації в гені IVD у наших пацієнтів були представлені двома новими перебудовами c. 49dupTGTGGCG, p. S133C і однією відомою місенс заміною p. R53P. Висновки. Отримані результати показали, що спектр мутацій у пацієнтів з органічними ацидуріями в Україні представлений переважно рідкісними або ж новими перебудовами. Ці дані можуть бути корисними для розробки молекулярно-генетичного алгоритму діагностики у хворих з України, що мають глутарову ацидурію І типу, ізольовану метилмалонову ацидурію та ізовалеріанову ацидурію. Цель. Определение спектра мутаций у пациентов с Украины с глутаровой ацидурией I типа, изолированной метилмалоновой ацидурией и изовалериановой ацидурией. Методы. Сиквенирование за Сэнгером. Результаты. Было выявлено 37,5 % мутантных аллелей (три образца из восьми) у пациентов с изолированной метилмалоновой ацидурией, 100 % аллелей (четыре из четырех) у больных с изовалериановой ацидурией, 100 % аллелей (четыре из четырех) у пациентов с глутаровой ацидурией I типа. Спектр мутаций в гене MUT у пациентов с Украины представлен одной известной миссенс мутацией с. N219Y и миссенс заменой p. R326G. В результате анализа сиквенса гена GCDH пациентов из Украины было обнаружено три известные миссенс перестройки p. R383C, p. G390R и p. A421V. Мутации в гене IVD у наших пациентов были представлены двумя новыми перестройками c. 49dupTGTGGCG, p. S133C и одной известной миссенс заменой p. R53P. Выводы. Полученные результаты показали, что спектр мутаций у пациентов с органическими ацидуриями в Украине представлен в большинстве редкими или новыми перестройками. Эти данные могут быть полезными для разработки молекулярно-генетического алгоритма диагностики у больных с глутаровой ацидурией I типа, изолированной метилмалоновой ацидурией, и изовалериановой ацидурией в Украине. 2018 Article Spectrum of mutations in patients with organic acidurias from Ukraine / O.I. Barvinska, N.V. Olkhovych, T.O. Shkurko, N.G. Gorovenko // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 107-116. — Бібліогр.: 19 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000975 http://dspace.nbuv.gov.ua/handle/123456789/154281 616.575-056.7-07 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Biomedicine Biomedicine |
| spellingShingle |
Biomedicine Biomedicine Barvinska, O.I. Olkhovych, N.V. Shkurko, T.O. Gorovenko, N.G. Spectrum of mutations in patients with organic acidurias from Ukraine Вiopolymers and Cell |
| description |
Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4) in patients with isovaleric aciduria, 100 % of alleles (4/4) in patients with glutaric aciduria type I. MUT gene mutations in patients from Ukraine are represented by one known N219Y missense mutation p. and a R326G missense rearrangement. Analysis of the GCDH gene in patients from Ukraine revealed three known missense mutations: R383C, G390R and A421V. Rearrangements in the IVD gene of our patients were represented by two novel mutations: 49dupTGTGGCG, S133C, and one known mutation: R53P. Conclusions. The mutations observed in Ukrainian patients with organic acidurias were mostly represented by rare or new rearrangements. These data could be useful for the development of molecular diagnostics of Ukrainian patients with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria |
| format |
Article |
| author |
Barvinska, O.I. Olkhovych, N.V. Shkurko, T.O. Gorovenko, N.G. |
| author_facet |
Barvinska, O.I. Olkhovych, N.V. Shkurko, T.O. Gorovenko, N.G. |
| author_sort |
Barvinska, O.I. |
| title |
Spectrum of mutations in patients with organic acidurias from Ukraine |
| title_short |
Spectrum of mutations in patients with organic acidurias from Ukraine |
| title_full |
Spectrum of mutations in patients with organic acidurias from Ukraine |
| title_fullStr |
Spectrum of mutations in patients with organic acidurias from Ukraine |
| title_full_unstemmed |
Spectrum of mutations in patients with organic acidurias from Ukraine |
| title_sort |
spectrum of mutations in patients with organic acidurias from ukraine |
| publisher |
Інститут молекулярної біології і генетики НАН України |
| publishDate |
2018 |
| topic_facet |
Biomedicine |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/154281 |
| citation_txt |
Spectrum of mutations in patients with organic acidurias from Ukraine / O.I. Barvinska, N.V. Olkhovych, T.O. Shkurko, N.G. Gorovenko // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 107-116. — Бібліогр.: 19 назв. — англ. |
| series |
Вiopolymers and Cell |
| work_keys_str_mv |
AT barvinskaoi spectrumofmutationsinpatientswithorganicaciduriasfromukraine AT olkhovychnv spectrumofmutationsinpatientswithorganicaciduriasfromukraine AT shkurkoto spectrumofmutationsinpatientswithorganicaciduriasfromukraine AT gorovenkong spectrumofmutationsinpatientswithorganicaciduriasfromukraine |
| first_indexed |
2025-07-14T05:56:06Z |
| last_indexed |
2025-07-14T05:56:06Z |
| _version_ |
1837600674645278720 |
| fulltext |
107
O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko
© 2018 O. I. Barvinska et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Bio-
polymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium,
provided the original work is properly cited
UDC 616.575-056.7-07
Spectrum of mutations in patients with organic acidurias
from Ukraine
O. I. Barvinska1,2, N. V. Olkhovych1, T. O. Shkurko1, N. G. Gorovenko2
1 National Children's Specialized Hospital Okhmatdyt, Ministry of Health of Ukraine
28/1, Chornovola Str., Kyiv, Ukraine, 01135
2 P. L. Shupik National medical academy of post-graduate education
9, Dorohozhytska Str., Kyiv, Ukraine, 04112
oiaminska@gmail.com
Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methyl-
malonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have
identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4)
in patients with isovaleric aciduria, 100 % of alleles (4/4) in patients with glutaric aciduria type I.
MUT gene mutations in patients from Ukraine are represented by one known N219Y missense
mutation p. and a R326G missense rearrangement. Analysis of the GCDH gene in patients from
Ukraine revealed three known missense mutations: R383C, G390R and A421V. Rearrangements
in the IVD gene of our patients were represented by two novel mutations: 49dupTGTGGCG,
S133C, and one known mutation: R53P. Conclusions. The mutations observed in Ukrainian
patients with organic acidurias were mostly represented by rare or new rearrangements. These
data could be useful for the development of molecular diagnostics of Ukrainian patients with
glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria
K e y w o r d s: organic acidurias, MUT, GCDH, IVD.
Introduction
Organic acidurias are a subgroup of inborn
errors of metabolism which includes more than
33 inherited disorders by SSIEM classification
2011 [1] and are characterized by the cumula-
tive prevalence of 1:7962 live birth [2]. The
most prevalent disorders in this group are iso-
lated methylmalonic aciduria (MIM 251000,
deficiency of methylmalonyl-CoA mutase
(EC 5.4.99.2)), isovaleric aciduria (MIM
243500, deficiency of isovaleryl-CoA dehy-
drogenase (EC1.3.99.10)), propionic aciduria
(MIM 606054, deficiency of propionyl-CoA
carboxylase (EC 6.4.1.3)), and glutaric acid-
uria type 1 (MIM 231670, deficiency of glu-
taryl-CoA-dehydrogenase (EC 1.3.99.7)).
Organic acidurias are caused by the deficiency
of enzymes and transporters which take part
in metabolism of amino acids, carbohydrates
Biomedicine ISSN 1993-6842 (on-line); ISSN 0233-7657 (print)
Biopolymers and Cell. 2018. Vol. 34. N 2. P 107–116
doi: http://dx.doi.org/10.7124/bc.000975
https://www.omim.org/entry/251000
https://www.ncbi.nlm.nih.gov/omim/243500
https://www.omim.org/entry/606054
https://www.omim.org/entry/231670
108
O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al.
or lipid intermediates [3]. Such alterations of
metabolism lead to some common clinical
manifestations such as developmental delay,
seizures, lethargy, coma, vomiting, failure to
thrive, hepatomegaly, respiratory distress and
some unique ones such as dystonic-dyskinetic
disorder, macrocephaly in case of GA I, sweaty
odor of feet in case of IVA [3–5]. The most
common biochemical features are hyperam-
monemia, metabolic acidosis, ketosis and hy-
poglycemia. Without treatment these disorders
could result in coma or death very quickly.
Therefore, early diagnosis is crucial for de-
creasing a level of disability, mortality and
morbidity of patients. In all developed coun-
tries the majority of organic acidurias are de-
tected within the newborn screening by tandem
mass spectrometry of acylcarnitines in dry
blood spots [6]. The diagnosis is confirmed by
gas chromatography, mass spectrometry or
molecular genetic analysis.
Glutaric aciduria I (GA I) and isovaleric
aciduria (IVA) are monogenic autosomal reces-
sive inherited disorders, caused by mutations
in genes GCDH (mapped to 19p13.2, includes
12 exons) and IVD (mapped to 15q.14-15,
includes 12 exons) respectively [4, 5].
Noteworthy, methylmalonic aciduria (MMA)
is a big heterogenous group of inherited dis-
orders which are remarkable for elevation of
methylmalonic acid in biological fluids. In
terms of biochemical features these disorders
are divided into two groups – isolated MMA
and combined MMA. Isolated MMA is a clin-
ical condition which could be caused by muta-
tions in such genes as MUT, MMAA, MMAB
and MCEE, while combined MMA manifests
in complex with homocystinuria/homocyste-
inemia and is caused by mutations in the genes
MMACHC, MMADHC, LMBRD1, ABCB4,
HCFC1 [7]. The isolated MMA is a more
prevalent disorder than the combined one and
60 % of mutations are detected in the
MUT gene (mapped to 6p.12.3, consists of
13 exon s) [8]. The current mutation database
HGMD Professional 2017.4 describes 361 mu-
tations in the MUT gene, 87 rearrangements
in the IVD gene, and 208 the in GCDH gene.
The absence of highly predominant mutations
in the genes MUT, IVD and GCDH and the
need to define and distinguish different types
of MMA stipulate the use of sequencing as a
common method of confirming MMA, IVA
and GA I.
Aim
To investigate a disease-causing mutations
spectrum in patients with organic acidurias
from Ukraine.
Materials and Methods
This study included 8 patients (4 males and 4
females) aged from 10 days to 3 years. These
individuals were selected for organic aciduria
diagnosis confirmation by selective screening
of inborn errors of fatty acid and amino acid
metabolism (2011–2016). All selected patients
with suspected isolated methylmalonic acid-
uria, glutaric aciduria type I or isovaleric ac-
iduria had elevations of typical acylcarnitines
in dry blood spots and organic acids in urine.
All parents gave their written informed consent
on these investigations. The study was ap-
proved by the Committee of Bioethics of
NSCH “OKhMATDYT”.
Dry blood spots were collected on
WhatmanTM N 903 specimen collection papers
and dried according to all requirements.
109
Spectrum of mutations in patients with organic acidurias from Ukraine
Genomic DNA was extracted from dry
blood spots with NEOGENE reagents kit
(Ukraine) according to the manufacturer’s pro-
tocol.
The exons and flanking intronic regions of
the MUT, IVD and GCDH genes were amplified
by the polymerase chain reaction (PCR) from
genomic DNA in SimpliAmp™ Thermal Cycler
(Thermo Fisher Scientific) with the amplifica-
tion kit GenPak®PCRCore NEOGENE
(Ukraine) and primers developed with Primer3
software. The primers are presented in Table 1.
The visualization of PCR products was per-
formed with capillary electrophoresis on
MCE-202 MultiNA Shimadzu (Japan) using
DNA 500 Shimadzu kit (Japan), 1000
Shimadzu kit (Japan) and molecular weight
marker 25 bp DNA Ladder Invitrogen by Life
Technologies (USA), and dye SYBR® Gold
Molecular probes by Life Technologies (USA).
The PCR products were sequenced directly
using forward and reverse primers on genetic
analyzer ABI 3130 by Applied Biosystems
(USA). The preparation of samples to sequenc-
Table 1. Primers for exons and flanking intronic regions of genes GCDH, IVD and MUT
GCDH gene MUT gene IVD gene
Exon Primers Exon Primers Exon Primers
2–3 F: ggccggattctaggaggaac
R: cttagtgcctctgaccctgg 2 F: aggaagcagaaaaggggaaga
R: cgtgcatgtgttgttttctttca 1 F: cacggttgattggctcgg
R: tgtcccacggtctcaaatct
4–5 F: gtcacctgatcagtctcgct
R: cagtgagccaagatcgtgc 3 F: gttggttttgacatgtatgagca
R: cctgcaagtaacgacagaaca 2–3 F: tcaagctgtctaggctgaaga
R: cacaggtccaaaagatgcagt
6 F: accctctgaaagtggctgtg
R: gatcagatctccaggtgaagc 4 F: ggtacagtcctgatgatggttc
R: ttcaacagcacagtggatcc 4 F: taagcaggtctgtggcatca
R: atccatggccccttcctaac
7–8 F: cctgccttggcctcctaaa
R: cgagtccggctgagtaagaa 5 F: cataaatgtacgtgcactgatct
R: gcactacagggaagctagga 5–6 F: ctttaccgacaccctggtct
R: cttttggtcaccctccttgc
9 F: ggactgtgtgcaaaccgag
R: ccacagctgctcagaagga 6 F: aaacactgaactctgactcttct
R: actgctgttctttgtatgagct 7 F: gggagcatgggactaggatg
R: cacatgtcactgaagcgcta
10 F: agtgacgtccttctgagcag
R: catcaaggacaagagggacag 7 F: tcccaagacttaagaggttttgt
R: tatgcttgcctgtgtgcatc 8 F: agctccacttctgactggaa
R: tcctcaggccttttgtctgt
11 F: ctgctgtccctcttgtcctt
R: ccacagtccccatgtgagta 8 F: tctactttcctctcacacccc
R: tcctgagcaagtttctcaatgc 9 F: ccgtaactgtggcaagactt
R: ctgcatgctgaggaagactg
12 F: agcattcaccatctctgttgg
R: aggaacacatctgaacgacttc 9 F: acttgggaaggtcagcactatta
R: cctcagccacagtaaaatacaca 10–11 F: ccccatctccatcatcctga
R: aggctggtcttgaactcctg
10 F: aagagaattggatgcataaaggc
R: tctgtttgacatgagaaactcct 12 F: ccctccctcttgctaccttt
R: ttgggagctgttgtggagaa
11 F: cctgcacattaacccctgaat
R: agtcagtggctacataccagt
12 F: ctcccattctgtaggttatctgt
R: agcataggttactggtttgca
13 F: agccccaaatgccagtagta
R: acaccaggcctataagtaaggt
F -forward, R- reverse
https://www.biocompare.com/104463-Thermo-Fisher-Scientific/
http://neogene.com.ua/index.php?route=product/product&path=18_45&product_id=86
110
O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al.
ing and analysis was performed with BigDye
Terminator v3.1 cycle sequencing kit by
Applied Biosystems (USA), BigDye XTermi-
nator Purification Kit by Applied Biosystems
(USA), PCR clean up Gel extraction by
Macherey-Nagel (Germany), according to the
protocol of the manufacturer.
The assessment of pathogenicity of novel
missense mutations was verified with Mutation
Taster, Polyphen2, Provean software. Nucleo-
tide sequence changes which result in frame-
shift were considered pathogenic. The predic-
tion of the effect of novel missense mutations
on the structure of protein was made with
DeepView4.1 software, the modelling involved
the use of a crystallographic structure of hu-
man methylmalonyl-CoA mutase PDB ID:
2XIJ previously reported by Froese et al. [9]
and human isovaleryl-CoA dehydrogenase
PDB ID: 1IVH reported by Tifanny et al. [10].
The analysis of mutations was performed using
the normal human MUT (NM_000255.3), IVD
(NM_002225.3), GCDH (NM_000159.3) se-
quences as a reference. The nomenclature of
mutations was based on coding sequences
according to the standards of the Human
Genome Variation Society [11].
Results and Discussion
The sequencing of exons and intron flanking
regions of the MUT, GCDH, IVD genes was
performed to confirm the diagnosis of isolated
methylmalonic aciduria in 4 patients, glutaric
aciduria type I in 2 patients and isovaleric
aciduria in 2 patients with a specific profile of
elevated acylcarnitines in dry blood spots and
organic acids in urine.
According to the gene MUT sequence, two
different missense mutations in this gene were
identified in 2 patients with suspected isolated
type of MMA. Patient 1 carried mutation in 3
exon p. N219Y, c.655 A > T in homozygous
state (Table 2). This rearrangement has already
been described in the HGMD database and is
considered to be a frequent mutation, as its
presence in 25 alleles out of 302 in Caucasian
population was previously published [8].
Patient 2 had a missense mutation in exon
5 of the MUT gene p. R326G, c.976 A > G in
heterozygous state which has not been added
to HGMD database yet (Fig. 1A) (Table 2).
The analysis of this novel missense mutation
with Mutation Taster, PolyPhen2 and Provean
Predictor software showed that it had a patho-
genic effect (Table 3). The 3D model of meth-
ylmalonyl-CoA mutase (MCM) revealed that
the replacement of positively charged large
amino acid Arg with a small neutral amino acid
Gly in the 326th position causes breaking of 4
hydrogen bonds, which Arg326 creates with
Thr92, Phe91, Gly380 and Ala330 in the
N-terminal domain (Fig. 1B). Consequently,
such alterations result in the tertiary conforma-
tion changes of methylmalonyl-CoA mutase
that likely affect the protein function.
The mutation in the second allele of Patient 2
was not detected in any exon from 2 to 13 and
its intronic flanking regions. The only addi-
tional findings in Patient 2 were three polymor-
phisms p. K212K, p. R532H, p. I671V in ho-
mozygous state. No mutations were found in
exons 2–13 with flanking regions of introns of
the MUT gene in two other patients with sus-
pected MMA. In these two patients it is neces-
sary to search for mutations in regulatory re-
gions or introns of the MUT gene or other genes
MMAA, MMAB, MCEE which are responsible
for other types of isolated MMA [7].
111
Spectrum of mutations in patients with organic acidurias from Ukraine
The sequence of the GCDH gene, performed
in order to confirm the diagnosis of glutaric
aciduria type I in Patient 3, detected missense
rearrangement p. R383C, c.1147 C > T in ho-
mozygous state (Table 2). This mutation is con-
sidered to be rare, for example, in Spanish pop-
ulation it was present in one allele out of 70 and
in 3 alleles out of 38 in Japanese population [5,
17]. The diagnosis of glutaric aciduria type I was
also confirmed in Patient 4 with the identifica-
tion of two known missense mutations p. G390R,
c.1168G > C – a rare variant in Caucasian pop-
ulation, and p. A421V, c. 1262 C > T – prevalent
in Old Order Amish population [14, 15, 18].
The sequencing of the IVD gene in Patient 5
with suspected isovaleric aciduria revealed a
known mutation p. R53P, c.158 G > C in het-
erozygous state (Table 2). Previously this mu-
tation was reported in two alleles out of 16 in
the USA studies and in 5 alleles out of 46 in
Turkish population [16, 19]. A novel duplica-
tion of 7 nucleotides – c.49dupTGTGGCG
(Table 2) was detected in the second allele of
Patient 5 (Fig. 2A). This mutation causes a
frameshift in exon 1, changing amino acid
sequence and resulting in crucial alteration of
tertiary structure of isovaleryl-CoA dehydro-
genase with the loss of all cofactor and sub-
strate binding sites. Such a truncated and
changed protein could not perform its func-
tions. The analysis of the IVD gene of Patient
6 revealed missense rearrangement p. S133C,
Table 2. Mutations in patients with organic acidurias
Patient
No Diagnosis Gene
Genotype Reported for the first
timeExon Allele 1 Exon Allele 2
1 Methylmalonic
aciduria MUT 3 p. N219Y,
c.655 A > T 3 p. N219Y,
c.655 A > T Aquaviva [12]
2 Methylmalonic
aciduria MUT 5 p. R326G,
c.976 A > G NA NA Submitted by GeneX
in Ensemble
3 Glutaric
Aciduria I GCDH 10 p. R383C,
c.1147 C > T 10 p. R383C,
c.1147 C > T Goodman [13]
4 Glutaric
Aciduria I GCDH 11 p. G390R,
c.1168G > C 12 p. A421V,
c. 1262 C > T
Anikster [14], Biery
[15]
5 Isovaleric
aciduria IVD 1 c.49dupTGTGGCG 2 p. R53P,
c.158 G > C
This study,
Mohsen [16]
6 Isovaleric
aciduria IVD 4 p. S133C,
c.398 C > G 4 p. S133C,
c.398 C > G This study
NA – not available
Table 3. Description and characteristics of new mutations in patients with organic acidurias
New mutation Mutation Taster Polyphen2 Provean Predictor
p. R326G in exon 5 of MUT gene Disease causing Probably damaging score of 1.000 Deleterious
– 6.991
p. S133C in exon 4 of IVD gene Disease causing Probably damaging score of 1.000 Deleterious
– 4.698
http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=PubMed&list_uids=9711871&dopt=Abstract
http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=PubMed&list_uids=15486829&dopt=Abstract
112
O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al.
Fig. 1. A – Image of MUT gene se-
quence of Patient 2 with rearrange-
ment c.976 A > G in heterozygous
state. B – Fragments of three-dimen-
sional models of human wild-type
MCM (green amino acid residue)
and MCM with mutation p. R326G
(red amino acid residue).
A
B
113
Spectrum of mutations in patients with organic acidurias from Ukraine
A
B
C
Fig. 2. A – Image of IVD gene se-
quence of Patient 5 with duplication
c.49dupTGTGGCG in heterozygous
state. B – Image of the IVD gene se-
quence of Patient 6 with rearrange-
ment c.398 C > G in homozygous
state. C – Fragment of three-dimen-
sional models of human wild-type
іsovaleryl CoA dehydrogenase
(IVD) (green amino acid residue)
and IVD with mutation p. S133C
(red amino acid residue).
114
O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al.
c.398 C > G in homozygous state (Table 2)
(Fig. 2B). This mutation has not been described
in mutation database HGMD yet. The analysis
of this rearrangement by Mutation Taster,
Polyphen2, Provean software predicted it as
the disease-causing one (Table 3). This muta-
tion causes a change of one polar amino acid
Serine to another polar amino acid Cysteine in
the N-terminal domain of isovaleryl Co-A de-
hydrogenase (IVD). Such replacement causes
breaking of one hydrogen bond which Ser133
creates with Ala129 and lengthens the other
which Ser133 creates with Ser256 (Fig. 2C).
Also, other hydrogen bonds with Tyr134,
Ala136, His137, Val130 remain unchanged.
Taking into consideration the fact that this
amino acid residue is close to FAD-binding
site, such alterations could affect cofactor bind-
ing and functional activity of protein.
To sum up, the sequencing of the MUT, IVD
and GCDH genes allowed identifying a spec-
trum of mutations in Ukrainian patients with
organic acidurias which is represented by
known but rare variants (p. R53P in the IVD
gene and p. R383C, p. G390R in the GCDH
gene) or novel mutations (p. R326G in the MUT
gene, p. S133C and c.49dupTGTGGCG in the
IVD gene). The only exceptions were missense
mutation p. N219Y in the MUT gene and p.
A421V in the GCDH gene which are considered
to be common variants for Caucasians and
Amish population respectively [7, 18].
Conclusions
The sequence analysis of the MUT gene con-
firmed the diagnosis of classic isolated meth-
ylmalonic aciduria in two patients out of 4
suspected ones. In these patients two missense
mutations were detected, including one com-
monly known mutation p. N219Y (2/8 alleles)
and the other undisclosed one – p. R326G
(1/8 alleles). According to the results of the
GCDH gene sequence, three missense rear-
rangements p. R383C (2/4 alleles), p. G390R
(1/4 alleles), p. A421V (1/4 alleles) were de-
tected in patients with suspected glutaric ac-
iduria type I and the previous diagnosis was
confirmed. Two missense mutations – recurrent
p. R53P (1/4 alleles) and novel p. S133C
(2/4 alleles), and one novel duplication
c.49dupTGTGGCG (1/4 alleles) in the IVD
gene were revealed in patients with a probable
diagnosis of isovaleric aciduria. All new mis-
sense mutations were analyzed with Mutation
Taster, Polyphen2, Provean Predictor software
and were predi cted as deleterious ones. Three-
dimensional modelling of novel missense mu-
tations also revealed alterations in the structure
of protein which could affect its functions. In
perspective, these data could be used for the
development of a molecular genetic diagnostic
algorithm for the patients with isolated MMA,
GA I and IVA.
REFERENCES
1. Zschocke J. SSIEM Classification of Inborn Errors of
Metabolism. In: Blau N, Duran M, Gibson K, Dionisi
Vici C. Eds Physician’s Guide to the Diagnosis, Treat-
ment, and Follow-Up of Inherited Metabolic Diseases.
Berlin, Heidelberg: “Springer” 2014; 817–30.
2. Sanderson S, Green A, Preece MA, Burton H. The
incidence of inherited metabolic disorders in the West
Midlands, UK. Arch Dis Child. 2006;91(11): 896–9.
3. Vaidyanathan K, Narayanan MP, Vasudevan DM.
Organic acidurias: an updated review. Indian J Clin
Biochem. 2011;26(4):319–25.
4. Couce ML, Aldamiz-Echevarría L, Bueno MA, Bar-
ros P, Belanger-Quintana A, Blasco J, García-Sil-
va MT, Márquez-Armenteros AM, Vitoria I, Vives I,
115
Spectrum of mutations in patients with organic acidurias from Ukraine
Navarrete R, Fernández-Marmiesse A, Pérez B,
Pérez-Cerdá C. Genotype and phenotype character-
ization in a Spanish cohort with isovaleric acidemia.
J Hum Genet. 2017;62(3):355–360.
5. Mushimoto Y, Fukuda S, Hasegawa Y, Kobayashi H,
Purevsuren J, Li H, Taketani T, Yamaguchi S. Clin-
ical and molecular investigation of 19 Japanese
cases of glutaric acidemia type 1. Mol Genet Metab.
2011;102(3):343–8.
6. Therrell BL, Padilla CD, Loeber JG, Kneisser I,
Saadallah A, Borrajo GJ, Adams J. Current status
of newborn screening worldwide: 2015. Semin
Perinatol. 2015;39(3):171–87.
7. Kurkina MV, Baydakova GV, Zakharova EY. Mo-
lecular and biochemical characteristics of the iso-
lated methylmalonic aciduria in Russian patients.
Med Gen. 2016;15(9):17–28.
8. Forny P, Schnellmann AS, Buerer C, Lutz S, Fow-
ler B, Froese DS, Baumgartner MR. Molecular
Genetic Characterization of 151 Mut-Type Methyl-
malonic Aciduria Patients and Identification of 41
Novel Mutations in MUT. Hum Mutat. 2016;37(8):
745–54.
9. Froese DS, Kochan G, Muniz JR, Wu X, Gileadi C,
Ugochukwu E, Krysztofinska E, Gravel RA, Op-
permann U, Yue WW. Structures of the human GT-
Pase MMAA and vitamin B12-dependent methyl-
malonyl-CoA mutase and insight into their complex
formation. J Biol Chem. 2010;285(49):38204–13.
10. Tiffany KA, Roberts DL, Wang M, Paschke R,
Mohsen AW, Vockley J, Kim JJ. Structure of human
isovaleryl-CoA dehydrogenase at 2.6 A resolution:
structural basis for substrate specificity,. Biochem-
istry. 1997;36(28):8455–64.
11. den Dunnen JT. Sequence Variant Descriptions:
HGVS Nomenclature and Mutalyzer. Curr Protoc
Hum Genet. 2016;90:7.13.1–7.13.19.
12. Acquaviva C, Benoist JF, Callebaut I, Guffon N, Ogi-
er de Baulny H, Touati G, Aydin A, Porquet D, Elion J.
N219Y, a new frequent mutation among mut(degree)
forms of methylmalonic acidemia in Caucasian pa-
tients. Eur J Hum Genet. 2001;9(8):577–82.
13. Goodman SI, Stein DE, Schlesinger S, Christen-
sen E, Schwartz M, Greenberg CR, Elpeleg ON.
Glutaryl-CoA dehydrogenase mutations in glutaric
acidemia (type I): review and report of thirty novel
mutations. Hum Mutat. 1998;12(3):141–4.
14. Anikster Y, Shaag A, Joseph A, Mandel H, Ben-
Zeev B, Christensen E, Elpeleg ON. Glutaric acid-
uria type I in the Arab and Jewish communities in
Israel. Am J Hum Genet. 1996;59(5):1012–8.
15. Biery BJ, Stein DE, Morton DH, Goodman SI. Gene
structure and mutations of glutaryl-coenzyme A de-
hydrogenase: impaired association of enzyme sub-
units that is due to an A421V substitution causes
glutaric acidemia type I in the Amish. Am J Hum
Genet. 1996;59(5):1006–11.
16. Mohsen AW, Anderson BD, Volchenboum SL, Bat-
taile KP, Tiffany K, Roberts D, Kim JJ, Vockley J.
Characterization of molecular defects in isovaleryl-
CoA dehydrogenase in patients with isovaleric aci-
demia. Biochemistry. 1998;37(28):10325–35.
17. Busquets C, Merinero B, Christensen E, Gelpí JL,
Campistol J, Pineda M, Fernández-Alvarez E, Prats JM,
Sans A, Arteaga R, Martí M, Campos J, Martínez-
Pardo M, Martínez-Bermejo A, Ruiz-Falcó ML, Vaquer-
izo J, Orozco M, Ugarte M, Coll MJ, Ribes A. Glutaryl-
CoA dehydrogenase deficiency in Spain: evidence of
two groups of patients, genetically, and biochemically
distinct. Pediatr Res. 2000;48(3):315–22.
18. Fraidakis MJ, Liadinioti C, Stefanis L, Dinopou-
los A, Pons R, Papathanassiou M, Garcia-Villoria J,
Ribes A. Rare Late-Onset Presentation of Glutaric
Aciduria Type I in a 16-Year-Old Woman with a
Novel GCDH Mutation. JIMD Rep. 2015;18:85–92.
19. Ozgul RK, Karaca M, Kilic M, Kucuk O, Yucel-
Yilmaz D, Unal O, Hismi B, Aliefendioglu D, Sivri S,
Tokatli A, Coskun T, Dursun A. Phenotypic and ge-
notypic spectrum of Turkish patients with isovaleric
acidemia. Eur J Med Genet. 2014;57(10):596–601.
Спектр мутацій у пацієнтів з органічними
ацидуріями в Україні
О. Ю. Барвінська, Н. В. Ольхович, Т. О. Шкурко,
Н. Г. Горовенко
Мета. Визначення спектру мутацій у пацієнтів з
України, що страждають на глутарову ацидурію I типу,
ізольовану метилмалонову ацидурію та ізовалеріанову
ацидурію. Методи. Сиквенування за Сенгером.
Результати. Було виявлено 37,5 % мутантних алелей
116
O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al.
(три зразки з восьми) у пацієнтів з ізольованою метил-
малоновою ацирурією, 100 % алелей (чотири з чоти-
рьох) у хворих з ізовалеріановою ацидурією, 100 %
алелей (чотири з чотирьох) у пацієнтів з глутаровою
ацидурією I типу. Спектр мутацій у гені MUT у паці-
єнтів в Україні представлений однією відомою місенс
мутацією с. N219Y та місенс заміною p. R326G. В ре-
зультаті аналізу сиквенсу гену GCDH у пацієнтів було
виявлено три відомі місенс перебудови p. R383C,
p. G390R та p. A421V. Мутації в гені IVD у наших
пацієнтів були представлені двома новими перебудо-
вами c. 49dupTGTGGCG, p. S133C і однією відомою
місенс заміною p. R53P. Висновки. Отримані резуль-
тати показали, що спектр мутацій у пацієнтів з орга-
нічними ацидуріями в Україні представлений пере-
важно рідкісними або ж новими перебудовами. Ці дані
можуть бути корисними для розробки молекулярно-
генетичного алгоритму діагностики у хворих з України,
що мають глутарову ацидурію І типу, ізольовану ме-
тилмалонову ацидурію та ізовалеріанову ацидурію.
К л юч ов і с л ов а: органічні ацидурії, MUT, GCDH,
IVD.
Спектр мутаций у пациентов с органическими
ацидуриями в Украине
А. Ю. Барвинская, Н. В. Ольхович, Т. А. Шкурко,
Н. Г. Горовенко
Цель. Определение спектра мутаций у пациентов с
Украины с глутаровой ацидурией I типа, изолирован-
ной метилмалоновой ацидурией и изовалериановой
ацидурией. Методы. Сиквенирование за Сэнгером.
Результаты. Было выявлено 37,5 % мутантных алле-
лей (три образца из восьми) у пациентов с изолиро-
ванной метилмалоновой ацидурией, 100 % аллелей
(четыре из четырех) у больных с изовалериановой
ацидурией, 100 % аллелей (четыре из четырех) у па-
циентов с глутаровой ацидурией I типа. Спектр мута-
ций в гене MUT у пациентов с Украины представлен
одной известной миссенс мутацией с. N219Y и мис-
сенс заменой p. R326G. В результате анализа сиквенса
гена GCDH пациентов из Украины было обнаружено
три известные миссенс перестройки p. R383C,
p. G390R и p. A421V. Мутации в гене IVD у наших
пациентов были представлены двумя новыми пере-
стройками c. 49dupTGTGGCG, p. S133C и одной из-
вестной миссенс заменой p. R53P. Выводы. По лу чен-
ные результаты показали, что спектр мутаций у паци-
ентов с органическими ацидуриями в Украине пред-
ставлен в большинстве редкими или новыми пере-
стройками. Эти данные могут быть полезными для
разработки молекулярно-генетического алгоритма
диагностики у больных с глутаровой ацидурией I типа,
изолированной метилмалоновой ацидурией, и изова-
лериановой ацидурией в Украине.
К л юч е в ы е с л ов а: органические ацидурии, MUT,
GCDH, IVD
Received 02.02.2018
_Hlk517186706
|