A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR

Aim. Polymerase chain reaction (PCR) is a key method for the C. trachomatis diagnostics. The first-generation tests targeting a cryptic plasmid showed quite a high sensitivity; however their value has recently been compromised by the discovery of C. trachomatis strains lacking the target DNA segment...

Повний опис

Збережено в:

Бібліографічні деталі
Дата:	2018
Автори:	Vitrenko, Y.A., Deryabin, O.M.
Формат:	Стаття
Мова:	English
Опубліковано:	Інститут молекулярної біології і генетики НАН України 2018
Назва видання:	Вiopolymers and Cell
Теми:	Molecular and Cell Biotechnologies
Онлайн доступ:	http://dspace.nbuv.gov.ua/handle/123456789/154282
Теги:	Додати тег Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:	Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:	A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR / Y.A. Vitrenko, O.M. Deryabin // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 117-126. — Бібліогр.: 20 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine

id	irk-123456789-154282
record_format	dspace
spelling	irk-123456789-1542822019-07-07T12:37:28Z A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR Vitrenko, Y.A. Deryabin, O.M. Molecular and Cell Biotechnologies Aim. Polymerase chain reaction (PCR) is a key method for the C. trachomatis diagnostics. The first-generation tests targeting a cryptic plasmid showed quite a high sensitivity; however their value has recently been compromised by the discovery of C. trachomatis strains lacking the target DNA segment (e.g. the “Swedish” variant) and thus escaping the diagnostics. Moreover, there are variants bearing no plasmid at all. We propose the addition of a chromosome gene as a PCR tar-get to back up plasmid-based assays and enhance the overall efficiency of diagnostics. Methods. Two multiplexed PCRs were set up to target C. trachomatis cryptic plasmid and the 16s rRNA gene. The 16s rRNA primers produce PCR signal from a range of Chlamydia species whereas the introduction of a Taqman probe (essential for real-time PCR) scales the assay down to C. tra-chomatis. At the same time, our plasmid PCR is specific to C. trachomatis exclusively. Results. The sensitivity of plasmid and 16s rRNA PCRs reached from one to ten genome-equivalents per reaction (geq/rxn) whereas the efficiency was always about 100%. Multiplexing did not reduce the analytical sensitivity. Addition of DNA prepared from clinical specimens to the reaction mix did not affect PCR with pure C. trachomatis DNA further demonstrating the robustness of this system. The kinetics of the two reactions was compared in 49 DNA samples prepared from C. trachomatis-positive swabs. In 45 of these samples, the reactions showed a good correlation in the threshold cycle of amplification Cq, the main analytical parameter of real-time PCR. Conclusions. The simultaneous detection of chromosomal and plasmid targets in multiplex PCR offers a high sensitivity and is particularly advantageous for specimens where the plasmid might be lost due to DNA degradation or counter-selection after treatment. The dual strategy of PCR presented here could constitute the core of a diagnostic test for both in-house and commercial use. Мета. Полімеразна ланцюгова реакція (ПЛР) є ключовим методом діагностики C. trachomatis. Мішенню тестів першого покоління є криптична плазміда, що забезпечує досить високу чутливість. Однак придатність цих тестів була поставлена під сумнів після відкриття штамів, в яких був відсутній цільовий сегмент ДНК, і такі варіанти не виявлялись у ПЛР (т.з. «шведські» варіанти). Більш того, існують варіанти, повністю позбавлені плазміди. У цій роботі ми пропонуємо використовувати хромосомний ген в якості додаткової мішені, що дозволить підстрахувати плазмідні ПЛР-тести і може підвисити загальну ефективність діагностики. Методи. Мультиплексна система із двох ПЛР була укладена для одночасної детекції криптичної плазміди і фрагменту гена 16s рРНК. Праймери на 16s рРНК можуть давати сигнал ПЛР при аналізі низки видів Chlamydia. Додання зонду типу Taqman (необхідного для ПЛР у реальному часі) звужує спектр виявлюваних видів до C. trachomatis. В той же час ПЛР з плазміди є специ-фічною виключно до C. trachomatis. Результати. Чутливість ПЛР з плазміди і гену 16s рРНК сягала від 1 до 10 ге-ном-еквівалентів на реакцію, а ефективність ПЛР була близько 100%. Постановка реакцій в мультиплексі не зме-ншувало аналітичну чутливість. Додання реакційної суміші ДНК, приготованої із клінічних зразків, не впливало на ПЛР з чистої ДНК C. trachomatis, що також демонструє надійність системи. Кінетика цих двох реакцій була порів-няна в 49 зразках ДНК із мазків позитивних по C. trachomatis. В 45 із цих зразків реакції показали добру кореляцію порогових циклів ампліфікації Cq – основного аналітичного параметра ПЛР у реальному часі. Висновки. Одночас-на детекція хромосомної та плазмідної мішеней у мультиплексній ПЛР забезпечує високу чутливість і має особли-ві переваги для зразків, де плазміда може бути втрачена в результаті деградації ДНК чи контр-селекції при терапії. Двоцільова стратегія ПЛР, яка представлена в цій роботі, може бути покладена в основу ефективного внутрішньо-лабораторного чи комерційного діагностичного тесту. Цель. Полимеразная цепная реакция (ПЦР) является ключевым методом диагностики C. trachomatis. Мишенью тестов первого поколения является криптическая плазмида, что обеспечивает достаточно высокую чувствитель-ность. Однако адекватность этих тестов была поставлена под сомнение после открытия штаммов, где отсутствовал целевой сегмент ДНК, и такие варианты не выявлялись в ПЦР (т.н. «шведские» варианты). Более того, существуют варианты, полностью лишенные плазмиды. В этой работе, мы предлагаем использовать хромосомный ген в качес-тве дополнительной мишени, что позволит подстраховать плазмидный ПЦР-тест и может повысить общую эффек-тивность диагностики. Методы. Мультиплексная система из двух ПЦР была составлена для одновременной детек-ции криптической плазмиды и фрагмента гена 16s рРНК. Праймери на 16s рРНК могут давать сигнал ПЦР при анализе ряда видов Chlamydia. Добавление зонда типа Taqman (необходимого для ПЦР в реальном времени) сужа-ет спектр виявляемых видов до C. trachomatis. В то же время, ПЦР с плазмиды обладает специфичностью исклю-чительно к C. trachomatis. Результати. Чувствительность ПЦР с плазмиды и гена 16s рРНК достигала от 1 до 10 геном-еквивалентов на реакцию, а эффективность ПЦР была около 100%. Постановка реакций в мультиплексе не уменшало аналитическую чувствительность. Добавление к реакционнной смеси ДНК, приготовленной из клини-ческих образцов, не влияло на ПЦР с чистой ДНК C. trachomatis, что также демонстрирует надежность системы. Кинетика этих двух реакций была проанализирована в сравнении на 49 образцах ДНК из мазков, позитивных по C. trachomatis. В 45 из этих образцов реакции показали хорошую корреляцию порогових циклов амплификации Cq – основного аналитического параметра ПЦР в реальном времени. Выводы. Одновременная детекция хромосомной и плазмидной мишеней в мультиплексной ПЦР обеспечивает высокую чувствительность и имеет особенное пре-имущество при анализе образцов, где плазмида может быть утрачена в результате деградации ДНК или контр-селекции при терапии. Двух-целевая стратегия ПЦР, представленная в данной работе, может быть положена в ос-нову эффективного внутрилабораторного или коммерческого диагностичного теста. 2018 Article A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR / Y.A. Vitrenko, O.M. Deryabin // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 117-126. — Бібліогр.: 20 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000976 http://dspace.nbuv.gov.ua/handle/123456789/154282 579 881.211.083 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України
institution	Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection	DSpace DC
language	English
topic	Molecular and Cell Biotechnologies Molecular and Cell Biotechnologies
spellingShingle	Molecular and Cell Biotechnologies Molecular and Cell Biotechnologies Vitrenko, Y.A. Deryabin, O.M. A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR Вiopolymers and Cell
description	Aim. Polymerase chain reaction (PCR) is a key method for the C. trachomatis diagnostics. The first-generation tests targeting a cryptic plasmid showed quite a high sensitivity; however their value has recently been compromised by the discovery of C. trachomatis strains lacking the target DNA segment (e.g. the “Swedish” variant) and thus escaping the diagnostics. Moreover, there are variants bearing no plasmid at all. We propose the addition of a chromosome gene as a PCR tar-get to back up plasmid-based assays and enhance the overall efficiency of diagnostics. Methods. Two multiplexed PCRs were set up to target C. trachomatis cryptic plasmid and the 16s rRNA gene. The 16s rRNA primers produce PCR signal from a range of Chlamydia species whereas the introduction of a Taqman probe (essential for real-time PCR) scales the assay down to C. tra-chomatis. At the same time, our plasmid PCR is specific to C. trachomatis exclusively. Results. The sensitivity of plasmid and 16s rRNA PCRs reached from one to ten genome-equivalents per reaction (geq/rxn) whereas the efficiency was always about 100%. Multiplexing did not reduce the analytical sensitivity. Addition of DNA prepared from clinical specimens to the reaction mix did not affect PCR with pure C. trachomatis DNA further demonstrating the robustness of this system. The kinetics of the two reactions was compared in 49 DNA samples prepared from C. trachomatis-positive swabs. In 45 of these samples, the reactions showed a good correlation in the threshold cycle of amplification Cq, the main analytical parameter of real-time PCR. Conclusions. The simultaneous detection of chromosomal and plasmid targets in multiplex PCR offers a high sensitivity and is particularly advantageous for specimens where the plasmid might be lost due to DNA degradation or counter-selection after treatment. The dual strategy of PCR presented here could constitute the core of a diagnostic test for both in-house and commercial use.
format	Article
author	Vitrenko, Y.A. Deryabin, O.M.
author_facet	Vitrenko, Y.A. Deryabin, O.M.
author_sort	Vitrenko, Y.A.
title	A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR
title_short	A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR
title_full	A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR
title_fullStr	A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR
title_full_unstemmed	A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR
title_sort	dual-target strategy for the detection of chlamydia trachomatis by real-time pcr
publisher	Інститут молекулярної біології і генетики НАН України
publishDate	2018
topic_facet	Molecular and Cell Biotechnologies
url	http://dspace.nbuv.gov.ua/handle/123456789/154282
citation_txt	A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR / Y.A. Vitrenko, O.M. Deryabin // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 117-126. — Бібліогр.: 20 назв. — англ.
series	Вiopolymers and Cell
work_keys_str_mv	AT vitrenkoya adualtargetstrategyforthedetectionofchlamydiatrachomatisbyrealtimepcr AT deryabinom adualtargetstrategyforthedetectionofchlamydiatrachomatisbyrealtimepcr AT vitrenkoya dualtargetstrategyforthedetectionofchlamydiatrachomatisbyrealtimepcr AT deryabinom dualtargetstrategyforthedetectionofchlamydiatrachomatisbyrealtimepcr
first_indexed	2025-07-14T05:56:09Z
last_indexed	2025-07-14T05:56:09Z
_version_	1837600677943050240
fulltext	117 Y. A. Vitrenko, O. M. Deryabin © 2018 Y. A. Vitrenko et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Bio- polymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited UDC 579 881.211.083 A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR Y. A. Vitrenko, O. M. Deryabin State Scientific Control Institute of Biotechnology and Strains of Microorganisms 30 Donetska Str., Kyiv, Ukraine, 03151 yavit@yahoo.com, admin@biocontrol.com.ua The first-generation tests targeting a cryptic plasmid for the C. trachomatis diagnostics showed a relatively high sensitivity; however their usefulness has recently been compromised by the discovery of C. trachomatis strains lacking the target DNA segment (e.g. the “Swedish” variant) or variants bearing no plasmid at all and thus escaping the diagnostics. Aim. We propose the addition of a C. trachomatis chromosome gene as a PCR target to back up plasmid- based assays and enhance the overall efficiency of diagnostics. Methods. Two multiplexed PCRs were set up to target C. trachomatis cryptic plasmid and the 16s rRNA gene. The 16s rRNA primers produce PCR signal from a range of Chlamydia species whereas the introduc- tion of a Taqman probe (essential for the real-time PCR) scales the assay down to C. trachoma- tis. At the same time, our plasmid PCR is specific to C. trachomatis exclusively. Results. The sensitivity of plasmid and 16s rRNA PCRs ranged between one to ten genome-equivalents per reaction (geq/rxn) whereas the efficiency was always ~100%. Multiplexing did not reduce the analytical sensitivity. Addition of DNA prepared from clinical specimens to the reaction mix did not affect PCR with pure C. trachomatis DNA further demonstrating the robustness of this system. The kinetics of the two reactions was compared in 49 DNA samples prepared from C. trachomatis-positive swabs. In 45, reactions showed a good correlation in the threshold cycle of amplification Cq, the main analytical parameter of real-time PCR. Conclusions. The simultaneous detection of chromosomal and plasmid targets in the multiplex PCR offers a high sensitivity and is particularly advantageous for specimens where the plasmid might be lost due to DNA degradation or counter-selection after treatment. The dual PCR strategy constitute the core of a diagnostic test for both in-house and commercial use. K e y w o r d s: Chlamydia trachomatis, real-time PCR, 16s rRNA, cryptic plasmid Introduction Chlamydia is a causative agent of a series of urogenital, respiratory and ocular disor- ders in humans and animals [1]. Although in most cases infections are asymptomatic, se- vere outcomes occur when the pathogen- associated damage is aggravated by an in- Molecular and Cell Biotechnologies ISSN 1993-6842 (on-line); ISSN 0233-7657 (print) Biopolymers and Cell. 2018. Vol. 34. N 2. P 117–128 doi: http://dx.doi.org/10.7124/bc.000976 mailto:yavit@yahoo.com 118 Y. A. Vitrenko, O. M. Deryabin adequate immune response [2, 3]. C. tracho- matis is the most clinically important and hence best-stu died representative of the phylum. This is a sexually transmitted obli- gate intracellular gram-negative bacterium. If not treated it can cause pelvic inflamma- tory disease, infertility, ectopic pregnancy, urethritis, infant pneumonia and blind- ness [3]. Therapy of C.trachomatis infection relies mainly on broad-spectrum antibiotics such as azithromycin and doxycycline, and no pathogen-specific treatment has been implemented as yet [4]. The diagnostics of Chlamydia infection in humans and animals makes a wide use of PCR [4]. For C. trachomatis, the cryptic plas- mid which is somehow linked with infectivi- ty [5] has long been the primary target in PCR tests [6]. The plasmid is present in up to 10 copies per cell [7]. However, a variant was discovered in Sweden where the plasmid had a deletion encompassing the target region used in diagnostic kits of that time [8, 9]. It was suggested that the deletion had been rapidly selected due to the diagnostic advantage it provided to the microorganism oppressed by screening programs. Moreover, plasmid-less variants have also been reported [10, 11]. Therefore, other PCR targets have been sug- gested: momp1 (major outer membrane pro- tein) [12], omcB (outer membrane complex B protein) [13], gyrase A [14], 16s rRNA [10, 15], 23s rRNA Here we present a set of PCRs targeting the C. trachomatis cryptic plasmid, 16s rRNA gene and a synthetic plasmid as an internal control. These reactions could constitute the basis of an in-house or affordable commercial diagnostic kit. They are highly sensitive, robust and amenable for multiplexing. The dual-target strategy appears to be particularly useful for problematic specimens in which a partial loss of DNA due to degradation or deletion might be an issue. Methods Samples Chlamydia reference DNA samples were ob- tained as a gift from the German Reference Center for Chlamydial Infections at the Insti- tu te of Microbiology, Friedrich-Schiller-Uni- ver sity Jena (Jena, Germany); Bacillus cereus DNA was a gift from Dr. Tigran Yuzbashev (Institute for Genetics and Selection of Industrial Microorganisms, Moscow, Russia). Lactobacillus rhamnosus DNA was isolated from a culture purchased at Probiotical SpA (Novara, Italy). Escherichia coli, Bacillus ce- reus, Listeria monocytogenes, Mycoplasma arginini, Campylobacter pylori DNA was iso- lated from stocks deposited at the State Scientific Control Institute of Biotechnology and Strains of Microorganisms (Kyiv, Ukraine). DNA isolation was done using GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA). Clinical spec- imens (vaginal, endocervical and urethral swabs) were kindly provided by several com- mercial and hospital labs in Kyiv, Ukraine. Patients ordering a C. trachomatis PCR test have signed consent for research use of their specimens. The Ethic Committee of the State Scientific Control Institute of Biotechnology and Strains of Microorganisms approved the use of human clinical specimens in this re- search. All biological materials were properly destroyed. 119 A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR Internal control A pUC18 — based plasmid bearing Thermus thermophilus tRNATyr gene as a SmaI – BamHI insert was kindly provided by Prof. Mykhailo Tukalo (Institute of Molecular Biology and Genetics, Kyiv, Ukraine). PCR PCR was performed with oligonucleotides (Table 1) designed with the aid of the Vector NTI® software (Thermo Fisher Scientific, Waltham, MA, USA) and primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer- blast). The reaction volume was 25 µl. The oli- go nucleotide quantity per reaction was as given in Table (right column). Other components were: 1x DreamTaq PCR buffer, 0.1 mM dNTP, 3 mM MgCl2, 0.6 mg/ml bovine serum albumin, 4 % glycerol, DreamTaq polymerase (Thermo Fisher Scientific, Waltham, MA, USA) or TaqF poly- merase (Interlabservice, Moscow, Russia). PCR program was: pre-denaturation, 95 °C for 10 min; amplification for 40–45 cycles of: 95 °C for 10 sec, 62 °C for 20 sec, 72 °C for 30 sec. Typically, 5 ul sample DNA were added to PCR. Real-time PCR was done on a Biorad CFX-96 PCR system (Biorad, Hercules, CA, USA). The threshold cycle of amplification Cq was registered as a point at which the amplification curve reached the intensity of fluorescence of 50 relative units. The efficiency of PCR was calculated using the formula: E = 10–1/slope – 1 where E — efficiency, “slope” — the slope of the trend line of the Cq dependence on the log10 of concentration of reference C. tracho- matis DNA (Fig. 3B and C). Results Primers, probes and target regions Our principle idea was to supplement a plasmid- based reaction with another one targeting some genomic fragment. Thus the test would be in- sured from plasmid-instability issues while keeping an elevated level of the analytical sen- sitivity suggestively provided by several copies of plasmid. The 16s rRNA gene was chosen as the target genomic fragment due to a unique pattern of conservative and hypervariable mo- tives [15]. There are two copies of this gene in C. trachomatis separated by about 20 kb (Fig. 1A). Primers were designed to detect a range of Chlamydia species thus reserving a possibility of detecting the Chlamydia genus without specification which might be in demand in certain clinical and veterinary situations. At the same time, the hexachlorofluorescein (HEX)-labeled Taqman probe is C. trachoma- tis — specific: mismatches to the corresponding sequence of other species are sufficient to ab- rogate the detection in real-time PCR (Fig. 1A). The cryptic plasmid is detected by a pair of primers targeting the predicted coding se- quence CDS3 (Fig. 1B). Note that the targeted region lies outside of the 377-bp Swedish de- letion. The function of CDS3 is yet unknown; interaction with other plasmid-born CDSs and chromosomal genes has been suggested [16]. The probe is labeled by 6-carboxyfluorescein (FAM) thus enabling multiplexing with the 16s rRNA PCR detected by HEX fluorescence. If PCR reaction is aimed to be used as a diagnostic test it must be accompanied by an internal control reaction. A positive PCR signal from the internal control would indicate that PCR conditions were correct and the compo- https://www.ncbi.nlm.nih.gov/tools/primer-blast https://www.ncbi.nlm.nih.gov/tools/primer-blast 120 Y. A. Vitrenko, O. M. Deryabin Fig. 1. PCR targets for C. trachomatis detection. A – The 16s rRNA gene on C. trachomatis 434/Bu chromosome (GeneBank NC_010287.1). One of the two 16s rRNA loci is zoomed to show the region targeted by primers (green arrowheads) and probe (red block). Rulers above the maps show the chromosomal coordinate in kilobase pairs. The probe sequence is given in bold. The corre- sponding sequences of Chlamydia species are shown with mismatches highlighted by red letters. B – C. tra- chomatis cryptic plasmids. Plasmid with rearrangements characteristic of the Swedish variant is shown by the in- ner circle, wild-type by the outer. Positions of primers are shown by arrows. This panel is adopted from a diagram published earlier [9]. A kind permission of the author, Dr. Helena Seth-Smith, was granted. A B 121 A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR nents of the PCR machinery worked properly. In this case, a negative result of the target reac- tion could surely be interpreted as the absence of the pathogen DNA in the sample (or its presence below the sensitivity threshold), not as a result of PCR failure. We designed a third reaction templated by the pUC18 plasmid bear- ing an insert in the multiple cloning site (see Materials and Methods). This plasmid should be added to the reaction mix along with sam- ple DNA. The forward primer anneals to the insert; the reverse primer anneals to the b- Lactamase gene which is a part of the original pUC18 backbone sequence. It was crucial to position one of the primers to a synthetically introduced insert. If we otherwise placed both primers to the backbone an undesirable back- ground PCR signal would be produced from the homologous expression vectors usually present in recombinant Taq polymerase stocks as an admixture. Note that such vectors are inevitably carried over to the PCR mix and produce a detectable amplicon [17] after about 30 cycles (data not shown). The Taqman probe for this reaction carries the cyanine 5 (Cy5) dye whose maximum of fluorescence emission (670 nm) lies away from that of FAM (517 nm) and HEX (556 nm) labeling the 16s rRNA and cryptic plasmid reactions, respectively. PCR with 16s rRNA primers amplified a distinct 156-bp product from purified DNA of C. tra- chomatis (Fig. 2, lanes 2 and 3) and some other Chlamydia species (Fig. 2, lanes 8–14). No 156-bp product was detected in DNA from Escherichia coli, Bacillus cereus, Listeria monocytogenes, Mycoplasma arginini (Fig. 2, lanes 4–7), Bacillus thermocatenulatus, Campylobacter pylori, Lactobacillus rhamno- sus (data not shown). Non-specific products of a higher molecular weight seen in PCR from some non-Chlamydia species have no diagnos- tic value. Cryptic plasmid, appearing as a 266-bp product, was detected only in PCR from C. trachomatis DNA (Fig. 2, lane 3). PCR from reference C. trachomatis DNA A triplex PCR consisting of reactions targeting the 16s rRNA gene and cryptic plasmid of reference C. trachomatis along with internal control produced a typical sigmoid curve (Fig. 3A) and distinct electrophoretic band (Fig. 3B) for each of the three reactions. Note that the internal control PCR (smooth grey curves) does not appear to be inhibited by the two diagnostic reactions (symbol-marked curves) even at elevated concentrations of tem- plate DNA. The individual analytical sensitiv- ity of the diagnostic reactions in triplex was assayed on ten-fold dilutions of pure C. tracho- matis DNA spanning four orders of magnitude (Fig. 3C and D). Reproducible sigmoid curves were observed for both reactions in the pres- ence of as low as five genome-equivalents per Fig. 2. PCR from the 16s rRNA gene and cryptic plasmid on reference strains. Amplicons generated with primers to 16s rRNA (2–14) and plasmid (3–14). 1 – Molecular weight marker producing the bands whose sizes are shown in base pairs (bp). 2,3 – Chlamydia trachomatis, 4 – Esche- richia coli, 5 – Bacillus cereus, 6 – Listeria monocyto- genes, 7 – Mycoplasma arginini, 8 – Chlamydia suis, 9 – C. mudidatum, 10 – C. abortus, 11 – C. felis, 12 – C. psit- taci, 13 – C. avium, 14 – C. pecorum 122 Y. A. Vitrenko, O. M. Deryabin A C D B Fig. 3. Sensitivity and efficiency of multiplex PCR for C. trachomatis. A – Triplex real-time PCR with primers to 16s rRNA (green triangles), cryptic plasmid (blue circles) and internal control (grey). C. trachomatis DNA was added in the amount indicated as log10 geq/rxn. The internal control was added as well. B – PCR from C.trachomatis DNA without (lane 2) or with (lane 3) the addition of internal control plasmid. Molecular weight marker (lane 1) produces bands whose sizes are shown in base pairs (bp). C – Of three reactions, only the one targeting cryptic plasmid is shown. The PCR efficiency was deduced from the plot of Cq to log geq/rxn given at the right (mean of three reactions, error bar: standard deviation). D – same as (c) but for 16s rRNA PCR. 123 A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR reaction mix (which is equal to the value of 0.7 in the logarithmic form). We monitored Cq, a PCR cycle at which the kinetics passes from the lag to exponential stage. The Cq is consid- ered as the main quantitative parameter of real- time PCR. In our assays, a ten-fold increment in the template concentration translated in the Cq decrease of about 3.3 cycles throughout the entire concentration range. Consequently, the PCR efficiency was close to one (100 %) indi- cating that (i) no loss of sensitivity happens upon dilution of the sample, (ii) no inhibition is caused by higher concentrations of tem- plate DNA. It is often speculated that multiplexing might weaken PCR because of unpredictable oligonucleotide heteroduplexes and/or ex- hausting PCR components. We compared the performance of our diagnostic reactions in the monoplex versus triplex format (Fig. 4, smooth and symbol-marked curves, respectively). No significant change in Cq and overall shape of curves has been observed at both high (4.7 log10 geq/rxn) and low (0.7 log10 geq/rxn) concentrations of pure C. trachomatis DNA. Thus we could dispel concern of a sensitivity loss due to multiplexing. Clinical samples Up to this point, the proposed strategy of dual- target PCR has been tested only on pure refer- ence DNA. Skepticism might hold that DNA from real clinical specimens could perform weaker in terms of the sensitivity and robust- ness. In view of this, we examined our reac- tions in triplex on reference C. trachomatis DNA with and without DNA isolated from C. trachomatis-negative specimens (Fig. 5, symbol-marked and smooth curve, respec- tively). Plasmid and 16s rRNA PCRs (Fig. 5A and B, respectively) produced a detectable fluorescent signal throughout a range of tem- plate DNA concentrations spanning four orders of magnitude. We did not observe any signifi- cant difference between real-time PCR curves registered in the presence or absence of clini- cal sample DNA. Thus the proposed PCR reac- tions are robust enough for the detection of C. trachomatis DNA in clinical specimens. Next we compared the performance of 16s rRNA and cryptic plasmid reactions on real C. trachomatis — positive samples (deemed such by commercial PCR kits; Fig. 6). We carried out triplex PCR (with the addition of internal control) and plotted the results as dots on the plane formed by two Cq values. In such representation, the results lie along the diago- nal line indicating that the two reactions sense the variation of the amount of C. trachomatis DNA in a similar manner. There were 45 such Fig. 4. A negligible effect of multiplexing on the PCRs for C. trachomatis. Pure C. trachomatis DNA was used to give the indicated number of log 10 geq/rxn. PCR was done either in triplex with primers to 16s rRNA (green triangles) + cryptic plasmid (blue circles) + internal con- trol (not shown) or monoplex with primers to 16s rRNA or cryptic plasmid (green and blue curves, respectively, without any symbol). 124 Y. A. Vitrenko, O. M. Deryabin samples out of total 49. In four outliers, one of the two reactions failed or poorly performed as judged by a higher Cq: one with plasmid and three with 16s rRNA. These results were essentially confirmed by re-analyzing the back- up stocks starting from DNA (data not shown). Overall, the two reactions were equally effi- cient on clinical specimens: the mean Cq was 28.2 and 28.3 for cryptic plasmid and 16s rRNA, respectively. Therefore, 16s rRNA and cryptic plasmid PCRs can complement each other in problematic cases thereby minimizing the chance of a false-negative result. Discussion About 90 million cases of C. trachomatis infec- tion are diagnosed worldwide and the incidence has grown within the last decade [18]. A large proportion of infections proceeds asymptho- matic and undetected, yet pelvic inflammatory disease could develop with a various probabil- ity and cause infertility in up to 18 % of cases [19]. Despite screening programs have been designed and promoted recently [20], many communities and regions still have a limited access to high-quality C. trachomatis diagnos- tics. The advent of molecular techniques, such A B Fig. 5. A negligible effect of DNA prepared from a clinical specimen on the PCRs for C. trachomatis. Pure C. trachomatis DNA was used to give the indicated number of log10 geq/rxn. PCR was done in triplex with primers to 16s rRNA + cryptic plasmid + internal control. Of the three reactions, only cryptic plasmid (A) or 16s rRNA (B) PCRs are shown. Curves registered in the pres- ence of DNA from a C. trachoma- tis – negative clinical sample are la- belled with triangles or circles. 125 A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR Fig. 6. Scatter of Cq values of PCR from clinical sam- ples. Forty nine clinical C. trachomatis – positive sam- ples were assayed by 16s rRNA and plasmid PCR and plotted on the plane of the corresponding Cq values. as PCR, holds a great promise to improve the management of infectious diseases at the pop- ulation level in general. Here we suggested that targeting two loci could greatly improve C. trachomatis PCR diagnostics. We chose the 16s rRNA gene as the chromosomal target to supplement plas- mid-born PCR. First, it is present in at least two copies (Fig. 1A) thus backing up the test if one of the copies picks up a mutation affect- ing the primer — template interaction. Second, we wanted to reserve an option to detect non- trachomatis Chlamydiaceae which would ex- pand the use of 16s rRNA reaction in clinical and veterinary diagnostics. The 16s RNA gene offers enough conserved motives for designing primers to 16s rRNA sequence from a range of Chlamydia species (Fig. 2). At the same time, our Taqman probe (Fig. 1A) was suffi- ciently restrictive narrowing down the range to C. trachomatis (Fig. 3 and data not shown). The sensitivity and efficiency were similar for 16s rRNA and plasmid PCR, on both pure DNA (Fig. 3) and clinical samples (Fig. 6). The reactions were performed well in the multiplex format (Figs. 3 and 4). Thus the system does not appear to be affected by a reciprocal inhibiting effect of the reactions and exhaust of active components towards the end of PCR. Furthermore, the reactions were not perturbed by inhibitors potentially carried through the DNA isolation step (Fig. 5 and data not shown). Thus this PCR set could be combined with various DNA isolation kits and integrated into an existing laboratory work- flow. Despite a high analytical sensitivity, the clinical sensitivity of a test based on the pro- posed reactions remains to be determined. This should be done on a panel of reference clinical samples prepared under the same con- ditions and deemed C. trachomatis-positive by a “golden standard” test. For the quantification of C. trachomatis, 16s rRNA PCR appears more advantageous be- cause the plasmid copy number is a variable parameter per se. Our results show that 16s rRNA, as a PCR target, is not worse than plas- mid used traditionally. However, it would be premature to refuse from targeting the plasmid which is believed to be somehow associated with virulence [5]. It is plausible that the di- agnostics of the future will be focused more on highly virulent stages and variants in order to avoid unnecessary therapeutic measures. In rare samples, one of the two reactions failed (Fig. 6) which could be caused by (i) partial DNA degradation, (ii) sequence varia- tion in primer target sites, (iii) infection erad- ication. In general, since many aspects of C. trachomatis biology and pathogenesis still 126 Y. A. Vitrenko, O. M. Deryabin remain unclear we suggest that a PCR diag- nostic kit must be somewhat redundant. The use of two reactions, able to back-up each other on problematic samples, appears to be advantageous for the test’s reliability. Conclusions The dual-target strategy for PCR detection of C. trachomatis presented here benefits from the simultaneous targeting the cryptic plasmid and 16s rRNA gene. Such a strategy offers a high sensitivity and reproducibility, performs well upon multiplexing, and ensures an effi- cient C. trachomatis detection in samples where one of the targets is lost. Adoption of these reactions could be a launching point in the development of a quantitative kit for both in-house use and commercial production. List of abbreviations PCR, polymerase chain reaction; Cq – thresh- old cycle in PCR amplification; geq/rxn, ge- nome-equivalents per reaction; bp, base pairs. FAM,6-carboxyfluorescein; HEX, hexachlo- rofluorescein; Cy5, cyanine-5; BHQ-1,2 and 3, black-hole quencher-1,2 and 3, respectively. Funding This research was performed in the framework of the ”Program for Typing and Certification of Microbial and Virial Stocks in Profile Institutions” curated by the State Scientific Control Institute of Biotechnology and Strains of Microorganisms. Y.V. was supported by Ukrmedspilka, Ltd, Kyiv, Ukraine Acknowledgements We are grateful to Dr. Maria Obolenska (Institute of Molecular Biology and Genetics, Kyiv, Ukraine) for providing her lab premises for some experiments. We also thank Mykhailo Tukalo (Institute of Molecular Biology and Genetics, Kyiv, Ukraine) for the pUC18-tRNATyr plasmid. REFERENCES 1. Hooppaw AJ, Fisher DJ. A Coming of Age Story: Chlamydia in the Post-Genetic Era. Infect Immun. 2015;84(3):612–21. 2. Beatty WL, Morrison RP, Byrne GI. Persistent chla- mydiae: from cell culture to a paradigm for chlamyd- ial pathogenesis. Microbiol Rev. 1994;58(4):686–99. 3. Elwell C, Mirrashidi K, Engel J. Chlamydia cell biology and pathogenesis. Nat Rev Microbiol. 2016;14(6):385–400. Table. Oligonucleotides used in this study Name Target 5’ - mod Sequence 3’ - mod Quantity, pmol/rxn CT 16s OD fwd 16s rRNA AGTGGCGGAAGGGTTAGTAATG 10 CT 16s OD rev TCACATAGACTCTCCCTTAACCGA 10 CT 16s OD probe HEX TGTGGCGATATTTGGGCATCCGAG BHQ2 3 CT CP OD fwd Cryptic plasmid GCGAATCAGATCCGGTTGC 15 CT CP OD rev CACATCTGCCGTCTTGCTCTATTTG 15 CT CP OD probe FAM TGCTTTCAGATTTGCGAGACAGCGGT BHQ1 3 bLctm fwd pUC18 plasmid TTTCCGTGTCGCCCTTATTC 5 bLctm rev CCCAACTGATCTTCAGCATCTT 5 bLctm probe Сy5 TGCTCACCCAGAAACGCTGG BHQ3 2 127 A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR 4. Lanjouw E, Ouburg S, de Vries HJ, Stary A, Rad- cliffe K, Unemo M. 2015 European guideline on the management of Chlamydia trachomatis infections. Int J STD AIDS. 2016;27(5):333–48. 5. Carlson JH, Whitmire WM, Crane DD, Wicke L, Virtaneva K, Sturdevant DE, Kupko JJ 3rd, Porcella SF, Martinez-Orengo N, Heinzen RA, Kari L, Caldwell HD. The Chlamydia trachomatis plasmid is a tran- scriptional regulator of chromosomal genes and a virulence factor. Infect Immun. 2008;76(6):2273–83. 6. Ostergaard L, Birkelund S, Christiansen G. Use of polymerase chain reaction for detection of Chlamydia trachomatis. J Clin Microbiol. 1990;28(6):1254–60. 7. Palmer L, Falkow S. A common plasmid of Chla- mydia trachomatis. Plasmid. 1986;16(1):52–62. 8. Unemo M, Clarke IN. The Swedish new variant of Chlamydia trachomatis. Curr Opin Infect Dis. 2011;24(1):62–9. 9. Seth-Smith HM, Harris SR, Persson K, Marsh P, Barron A, Bignell A, Bjartling C, Clark L, Cutclif- fe LT, Lambden PR, Lennard N, Lockey SJ, Quail MA, Salim O, Skilton RJ, Wang Y, Holland MJ, Parkhill J, Thomson NR, Clarke IN. Co-evolution of genomes and plasmids within Chlamydia tracho- matis and the emergence in Sweden of a new vari- ant strain. BMC Genomics. 2009;10:239. 10. An Q, Olive DM. Molecular cloning and nucleic acid sequencing of Chlamydia trachomatis 16S rRNA genes from patient samples lacking the cryp- tic plasmid. Mol Cell Probes. 1994;8(5):429–35. 11. Yeow TC, Wong WF, Sabet NS, Sulaiman S, Shah- hosseini F, Tan GM, Movahed E, Looi CY, Shan- kar EM, Gupta R, Arulanandam BP, Hassan J, Abu Bakar S. Prevalence of plasmid-bearing and plas- mid-free Chlamydia trachomatis infection among women who visited obstetrics and gynecology clin- ics in Malaysia. BMC Microbiol. 2016;16:45. 12. Dutilh B, Bébéar C, Rodriguez P, Vekris A, Bonnet J, Garret M. Specific amplification of a DNA sequence common to all Chlamydia trachomatis serovars us- ing the polymerase chain reaction. Res Microbiol. 1989;140(1):7–16. 13. Pickett MA, Everson JS, Pead PJ, Clarke IN. The plasmids of Chlamydia trachomatis and Chlamydophi- la pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents. Microbiology. 2005;151(Pt 3):893–903. 14. Patel AL, Sachdev D, Nagpal P, Chaudhry U, Son- kar SC, Mendiratta SL, Saluja D. Prevalence of Chlamydia infection among women visiting a gyn- aecology outpatient department: evaluation of an in-house PCR assay for detection of Chlamydia trachomatis. Ann Clin Microbiol Antimicrob. 2010;9:24. doi: 10.1186/1476-0711-9–24. 15. Monstein HJ, Kihlström E, Tiveljung A. Detection and identification of bacteria using in-house broad range 16S rDNA PCR amplification and genus- specific DNA hybridization probes, located within variable regions of 16S rRNA genes. APMIS. 1996;104(6):451–8. 16. Gong S, Yang Z, Lei L, Shen L, Zhong G. Characteriza- tion of Chlamydia trachomatis plasmid-encoded open reading frames. J Bacteriol. 2013;195(17):3819–26. 17. Chiang CS, Liu CP, Weng LC, Wang NY, Liaw GJ. Presence of beta-lactamase gene TEM-1 DNA se- quence in commercial Taq DNA polymerase. J Clin Microbiol. 2005;43(1):530–1. 18. Mylonas I. Female genital Chlamydia trachomatis infection: where are we heading? Arch Gynecol Obstet. 2012;285(5):1271–85. 19. Haggerty CL, Gottlieb SL, Taylor BD, Low N, Xu F, Ness RB. Risk of sequelae after Chlamydia tracho- matis genital infection in women. J Infect Dis. 2010;201 Suppl 2:S134–55. 20. Phillipson L, Gordon R, Telenta J, Magee C, Jans- sen M. A review of current practices to increase Chlamydia screening in the community – a consum- er-centred social marketing perspective. Health Expect. 2016;19(1):5–25. Двоцільова стратегія виявлення Chlamydia trachomatis за допомогою ПЛР у реальному часі Я. О. Вітренко, О. М. Дерябін Мішенню тестів діагностики C. trachomatis першого покоління є криптична плзмда. Нещодавно відкриті штами без цільового сегмента ДНК (т.зв. «Шведскі» варіанти) або повністю позбавлені плазміди не діа- гностуються ПЛР. Мета. Запропоновано використову- вати хромосомний ген в якості додаткової мішені, що дозволить підстрвахувати плазмідний ПЛР-тест і може 128 Y. A. Vitrenko, O. M. Deryabin підвищити загальну ефективність діагностики. Методи. Мультиплексна система з двох ПЛР була складена для одночасної детекції криптичної плазміди і фрагмента гена 16s рРНК. Праймери на 16s рРНК можуть давати сигнал ПЛР при аналізі ряду видів Chlamydia. Додавання зонда типу Taqman (необхідно- го для ПЛР в реальному часі) звужує спектр виявляв видів до C. trachomatis. У той же час, ПЛР з пла-зміди володіє специфічністю виключно до C. trachomatis. Результати. Чутливість ПЛР з плазміди і гена 16s рРНК досягала від 1 до 10 геном-еквівалентів на ре- акцію, а ефективність – близько 100 %. Реакція в муль- типлексі не зменшує аналітичну чутливість. Додавання до реакційної суміші ДНК клінічних зразків не впли- вало на ПЛР з чистою ДНК C. trachomatis, що також демонструє надійність системи. Кінетику цих двох реакцій проаналізовано на 49 зразках ДНК з мазків, позитивних до C. trachomatis. Для 45 зразках показано хорошу кореляцію порогових циклів ампліфікації Cq – основного аналітичного параметра ПЛР у реальному часі. Висновки. Одночасна детекція хромосомної і плазмідной мішені в мультиплексній ПЛР забезпечує високу чутливість і має перевагу при аналізі зразків з втраченою плазмидою через деградацію ДНК або контрселекціі при терапії. Двоцільова стратегія ПЛР, може бути основою для ефективного внутрішньола- бораторного або комерційного діагностичного тесту. К л юч ов і с л ов а: Chlamydia trachomatis, ПЛР у реальному часі, ген 16s рРНК, криптична плазміда Двухцелевая стратегия выявления Chlamydia trachomatis с помощью ПЦР в реальном времени Я. А. Витренко, О. Н. Дерябин Мишенью тестов диагностики C. trachomatis первого поколения является криптическая плазмида. Недавно открытые штаммы без целевого сегмента ДНК(т.н. «шведские» варианты) или полностью лишенные плаз- миды не диагностируются ПЦР. Цель. Предложено использовать хромосомный ген в качестве дополни- тельной мишени, что позволит подстраховать плазмид- ный ПЦР-тест и может повысить общую эффектив- ность диагностики. Методы. Мультиплексная система из двух ПЦР была составлена для одновременной де- текции криптической плазмиды и фрагмента гена 16s рРНК. Праймери на 16s рРНК могут давать сигнал ПЦР при анализе ряда видов Chlamydia. Добавление зонда типа Taqman (необходимого для ПЦР в реальном вре- мени) сужает спектр виявляемых видов до C. trachomatis. В то же время, ПЦР с плазмиды обла- дает специфичностью исключительно к C. trachomatis. Результаты. Чувствительность ПЦР с плазмиды и гена 16s рРНК достигала от 1 до 10 геном-эквивалентов на реакцию, а эффективность – около 100 %. Реакция в мультиплексе не уменшала аналитическую чувстви- тельность. Добавление к реакционнной смеси ДНК из клинических образцов не влияло на ПЦР с чистой ДНК C. trachomatis, что также демонстрирует надежность системы. Кинетика этих двух реакций проанализиро- вана на 49 образцах ДНК из мазков, позитивных по C. trachomatis. В 45 образцах реакции показали хоро- шую корреляцию порогових циклов амплификации Cq – основного аналитического параметра ПЦР в ре- альном времени. Выводы. Одновременная детекция хромосомной и плазмидной мишеней в мультиплексной ПЦР обеспечивает высокую чувствительность и имеет преимущество при анализе образцов с утраченой плаз- мидой из-за деградации ДНК или контрселекции при терапии. Двух-целевая стратегия ПЦР, может быть основой для эффективного внутрилабораторного или коммерческого диагностичного теста. К л юч е в ы е с л ов а: Chlamydia trachomatis, ПЦР у реальном времени, ген 16s рРНК, криптичская плазмида Received 13.09.2017

A dual-target strategy for the detection of Chlamydia trachomatis by real-time PCR

Репозитарії

Схожі ресурси