Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells

In non-cancerous breast cell lines HB2 and MCF10A the TP53 gene is localized inside a relatively small ~ 50 kb loop domain delimited by two S/MARs. Aim. To analyze the chromatin markers H4Ac and H3K9me3 of these two S/MARs and of the TP53 gene P1 promoter in different breast cells lines. Methods. We...

Повний опис

Збережено в:

Бібліографічні деталі
Дата:	2014
Автори:	Santos, G.C.Jr, Goes, A.C.S., de Moura Gallo, C.V.
Формат:	Стаття
Мова:	English
Опубліковано:	Інститут молекулярної біології і генетики НАН України 2014
Назва видання:	Вiopolymers and Cell
Теми:	Structure and Function of Biopolymers
Онлайн доступ:	http://dspace.nbuv.gov.ua/handle/123456789/154304
Теги:	Додати тег Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:	Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:	Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells / G.C.Jr Santos, A.C.S. Goes, C.V. de Moura Gallo // Вiopolymers and Cell. — 2014. — Т. 30, № 3. — С. 197-202. — Бібліогр.: 40 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine

id	irk-123456789-154304
record_format	dspace
spelling	irk-123456789-1543042019-06-16T01:29:18Z Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells Santos, G.C.Jr Goes, A.C.S. de Moura Gallo, C.V. Structure and Function of Biopolymers In non-cancerous breast cell lines HB2 and MCF10A the TP53 gene is localized inside a relatively small ~ 50 kb loop domain delimited by two S/MARs. Aim. To analyze the chromatin markers H4Ac and H3K9me3 of these two S/MARs and of the TP53 gene P1 promoter in different breast cells lines. Methods. We used chromatin immunoprecipitation (ChIP) to characterize the chromatin status of these S/MARs elements in breast non-cancerous cell lines HB2 and MCF10A and cancerous MCF-7, MDA-MB-231, BT-474 and T47D cell lines, by chromatin enrichment of H4Ac and H3K9me3 epigenetic markers, hallmarks of open and closed chromatin, respectively. Results. We found that these chromatin epigenetic markers are differentially distributed in S/MARs for all analyzed breast cell lines. Conclusions. We found no correlation between S/MARs and chromatin epige- netic status, suggesting that nuclear matrix fixation and chromatin status can be independent. High enrichment of H3K9me3 in the TP53 gene P1 promoter region in MCF-7, could explain lower levels of the TP53 expression, described earlier by our group. У неонкогенних клітинних лініях HB2 і MCF10A ген TP53 локалізований всередині відносно невеликої області (~ 50 тис. пар нуклеотидів) петлі домену, обмеженої двома S/MARs (ділянками, асо- ційованими з матриксом). Мета. Проаналізувати хроматинові маркери H4Ac і H3K9me3 в означених S/MARs і P1 промоторі гена TP53 в різних клітинних лініях молочної залози. Методи. Використано імунопреципітацію хроматину (чип) для характеристики стану хроматину елементів S/MARs у неонкогенних клітинних лініях HB2 і MCF10A та злоякісних клітинних лініях MCF-7, MDA-MB-231, БТ-474 і T47D за допомогою H4Ac і H3K9me3 епігенетичних маркерів за ознаками відкритого і закритого хроматину відповідно. Результати. Виявлено, що зазначені епігенетичні маркери нерівномірно розподілені в S/MARs для всіх проаналізованих клітинних ліній молочної залози. Висновки. Не знайдено кореляції в епігенетичному статусі S/MARs і хроматина, що дозволяє зробити припущення, що фіксація ядерного матриксу і статус хроматину можуть бути незалежними. Суттєве збагачення H3K9me3 P1 промоторної областігена TP53 в клітинній лінії MCF-7 може бути причиною нижчих рівнів експресії TP53, описаних раніше нашою групою. В неонкогенных клеточных линиях HB2 и MCF10A ген TP53 расположен внутри петли домена:относительно небольшой области (~ 50 тыс. пар нуклеотидов), ограниченной двумя S/MARs (участками, ассоциированными с матриксом). Цель. Проанализировать маркеры хроматина H4Ac и H3K9me3 в указанных S/MARs и P1 промотре гена TP53 в различных клеточных линиях молочной железы. Методы. Использовали иммунопреципитацию хроматина (чип) для характеристики состояния хроматина элементов S/MARs в неонкогенных клеточных линиях HB2 и MCF10A и злокачественных клеточных линиях MCF-7, MDA-MB-231, БТ-474 и T47D с помощью H4Ac и H3K9me3 эпигенетических маркеров по признакам открытого и закрытого хроматина соответственно. Результаты. Указанные эпигенетические маркеры неравномерно распределены в исследованных S/MARs для всех анализируемых линий клеток молочной железы. Выводы. Не выявлена корреляция в эпигенетическом статусе S/MARs и хроматина, что позволяет предположить, что фиксация в ядерного матрикса и статус хроматина могут быть независимыми. Существенное обогащение H3K9me3 P1 промоторной области гена TP53 клеточной линии MCF-7 может быть причиной более низких уровней экспрессии TP53, описанных ранее нашей группой. 2014 Article Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells / G.C.Jr Santos, A.C.S. Goes, C.V. de Moura Gallo // Вiopolymers and Cell. — 2014. — Т. 30, № 3. — С. 197-202. — Бібліогр.: 40 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000896 http://dspace.nbuv.gov.ua/handle/123456789/154304 577.21 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України
institution	Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection	DSpace DC
language	English
topic	Structure and Function of Biopolymers Structure and Function of Biopolymers
spellingShingle	Structure and Function of Biopolymers Structure and Function of Biopolymers Santos, G.C.Jr Goes, A.C.S. de Moura Gallo, C.V. Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells Вiopolymers and Cell
description	In non-cancerous breast cell lines HB2 and MCF10A the TP53 gene is localized inside a relatively small ~ 50 kb loop domain delimited by two S/MARs. Aim. To analyze the chromatin markers H4Ac and H3K9me3 of these two S/MARs and of the TP53 gene P1 promoter in different breast cells lines. Methods. We used chromatin immunoprecipitation (ChIP) to characterize the chromatin status of these S/MARs elements in breast non-cancerous cell lines HB2 and MCF10A and cancerous MCF-7, MDA-MB-231, BT-474 and T47D cell lines, by chromatin enrichment of H4Ac and H3K9me3 epigenetic markers, hallmarks of open and closed chromatin, respectively. Results. We found that these chromatin epigenetic markers are differentially distributed in S/MARs for all analyzed breast cell lines. Conclusions. We found no correlation between S/MARs and chromatin epige- netic status, suggesting that nuclear matrix fixation and chromatin status can be independent. High enrichment of H3K9me3 in the TP53 gene P1 promoter region in MCF-7, could explain lower levels of the TP53 expression, described earlier by our group.
format	Article
author	Santos, G.C.Jr Goes, A.C.S. de Moura Gallo, C.V.
author_facet	Santos, G.C.Jr Goes, A.C.S. de Moura Gallo, C.V.
author_sort	Santos, G.C.Jr
title	Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells
title_short	Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells
title_full	Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells
title_fullStr	Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells
title_full_unstemmed	Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells
title_sort	chromatin enrichment of histone marks h4ac and h3k9me3 in tp53 gene domain in breast cells
publisher	Інститут молекулярної біології і генетики НАН України
publishDate	2014
topic_facet	Structure and Function of Biopolymers
url	http://dspace.nbuv.gov.ua/handle/123456789/154304
citation_txt	Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells / G.C.Jr Santos, A.C.S. Goes, C.V. de Moura Gallo // Вiopolymers and Cell. — 2014. — Т. 30, № 3. — С. 197-202. — Бібліогр.: 40 назв. — англ.
series	Вiopolymers and Cell
work_keys_str_mv	AT santosgcjr chromatinenrichmentofhistonemarksh4acandh3k9me3intp53genedomaininbreastcells AT goesacs chromatinenrichmentofhistonemarksh4acandh3k9me3intp53genedomaininbreastcells AT demouragallocv chromatinenrichmentofhistonemarksh4acandh3k9me3intp53genedomaininbreastcells
first_indexed	2025-07-14T05:57:15Z
last_indexed	2025-07-14T05:57:15Z
_version_	1837600746796744704
fulltext	UDC 577.21 Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells G. C. Santos Jr1, A. C. S. Goes2, C. V. de Moura Gallo1 1Departament of Genetics, Institute of Bilogy, University of State of Rio de Janeiro (UERJ) Rua Sao Francisco Xavier, 524, sala 525-6, Maracana, Rio de Janeiro, CEP, 20.550-013, Brazil 2Department of Science and Biology, Institute of Bilogy, University of State of Rio de Janeiro (UERJ) Rua Sao Francisco Xavier, 524, sala 525-6, Maracana, Rio de Janeiro, CEP, 20.550-013, Brazil claudia.gallo@pq.cnpq.br In non-cancerous breast cell lines HB2 and MCF10A the TP53 gene is localized inside a relatively small ~ 50 kb loop domain delimited by two S/MARs. Aim. To analyze the chromatin markers H4Ac and H3K9me3 of these two S/MARs and of the TP53 gene P1 promoter in different breast cells lines. Methods. We used chromatin immunoprecipitation (ChIP) to characterize the chromatin status of these S/MARs elements in breast non-can- cerous cell lines HB2 and MCF10A and cancerous MCF-7, MDA-MB-231, BT-474 and T47D cell lines, by chromatin enrichment of H4Ac and H3K9me3 epigenetic markers, hallmarks of open and closed chromatin, respectively. Results. We found that these chromatin epigenetic markers are differentially distributed in S/MARs for all analyzed breast cell lines. Conclusions. We found no correlation between S/MARs and chromatin epige- netic status, suggesting that nuclear matrix fixation and chromatin status can be independent. High enrichment of H3K9me3 in the TP53 gene P1 promoter region in MCF-7, could explain lower levels of the TP53 expression, described earlier by our group. Keywords: TP53, loop domain, MAR, breast cancer, chromatin markers, ChIP assay. Introduction. DNA in eukaryotic nucleus is organized in nucleosomes consisting of ~ 147 bp of DNA wrapped around an octamer of four core histone proteins (H2A, H2B, H3 and H4). The N-terminal tail of histones is a subject to several types of post-translational modifica- tions, the two most important of which are acetylation and methylation of some amino acids, usually lysine. These histone modifications can affect the chromatin as- sembly making it permissible for proteins to modulate cellular processes such as transcription, repair, replica- tion and genome stability [1–4]. Histone acetylation and methylation are catalyzed by histone acetyltransfe- rases (HATs) and histone methyltransferases (HMTs), respectively. Histone H4 acetylation (H4Ac) is a hall- mark of open chromatin or euchromatin and may be a sign of gene activation [5–7]. It is generally decreased in breast cancer cell lines and tissues [8, 9]. In contrast, histone H3 lysine 9 trimethylation (H3K9me3) is a hall- mark of closed chromatin or constitutive heterochro- matin and may denote gene repression [10, 11]. Chro- matin is further organized in DNA loop domains delimi- ted by the border elements that include nuclear Scaf- fold/Matrix Attachment Regions (S/MARs), which could be 20 to 200 kb long [12, 13]. The S/MARs are respon- sible for DNA attachment to the nuclear matrix (NM) and are linked to DNA replication and transcription. They may include Topoisomerase II binding sites [14, 15] as well as other sequence motifs. Furthermore, NM is enriched in several transcription factors, which have been suggested to be MAR binding proteins (MARBPs) [16–18]. Several factors potentially affect the association of DNA with the NM, including the DNA sequence itself and its epigenetic state [19–22]. Scaffold Attachment Regions (SARs) can be enriched in H4Ac [23]. The at- tachment of human S/MARs to the nuclear matrix de- 197 ISSN 0233–7657. Biopolymers and Cell. 2014. Vol. 30. N 3. P. 197–202 doi: http://dx.doi.org/10.7124/bc.000896 � Institute of Molecular Biology and Genetics, NAS of Ukraine, 2014 pends on a high DNA methylation level and the absen- ce of H3K9ac within S/MAR [24]. Interestingly, some histone modification enzymes such as HATs are asso- ciated with NM [25]. Additionally, the loops can be ac- tive or inactive due to the MARs chromatin enrich- ment in H4Ac or H3K9me3, respectively [26]. However, as nuclear matrix remains a controversial concept [13] and the data on the interplay between MARs and histone epigenetic chromatin status are still absent, we decided to test whether the association of S/MARs with the nuclear matrix in breast cancer cell lines corresponds to specific chromatin modifications. We have previously mapped S/MARs in the 167 kb locus of the tumor suppressor gene TP53 in cancerous breast cell lines, MDA-MB-231, BT-474, T47D, MCF- 7, and non-cancerous breast cell lines, MCF10A and HB2, using DNA arrays [27]. We found that the loop domain organization in these cell lines was quite va- riable. MAR2 and MAR3 were detected in non-can- cerous cells HB2 and MCF10A, and MAR3 was detec- ted in cancerous cells BT-474 and T47D. Interestingly, these MARs were symmetrically disposed in relation to the TP53 gene P1 promoter, probably constituting the borders of a chromatin loop. Now, in an attempt to check the chromatin accessibility of these two S/MARs and the TP53 gene P1 promoter region we evaluated the chromatin enrichment levels of the histone epi- genetic markers H4Ac and H3K9me3 (linked to open and closed chromatin, respectively), by the chromatin immunoprecipitation (ChIP) assay, in the same breast cells lines. We found no correlation between the chro- matin enrichment of histone epigenetic marks and nuc- lear matrix attachment regions. We believe that our res- ults will help to get a better understanding on the TP53 chromatin domain organization and transcriptional control. Materials and methods. Cell lines. All cell lines were obtained from David Cappellen and Nancy Hynes (Friedrich Miescher Institute for BioMedical Research, Novartis Research Foundation, Switzerland). The hu- man mammary carcinoma cell lines MDA-MB-231 and T47D were cultured in DMEM medium supplemented with 10 % bovine serum, 0.5 % penicillin/streptomycin and 1 % glutamine. The human mammary carcinoma cell lines MCF-7 and BT-474 were cultured in RPMI medi- um supplemented with 10 % bovine serum, 0.5 % peni- cillin/streptomycin and 1 % glutamine. The control non- cancerous epithelial cell lines MCF10A and HB2 were cultured in DMEM medium supplemented with 10 % horse serum, 0.5 �g/ml hydrocortisone, 10 �g/ml insu- lin, 0.5 % penicillin/streptomycin and 1 % glutamine. ChIP assay. 25 �106 cells were cross-linked with 1 % formaldehyde for 10 min in a rocking platform at room temperature. Cross-linking reaction was stopped with 0.125 M Glycine diluted in 1 �PBS. The cells were wa- shed with ice-cold 1X PBS and resuspended in 1 ml Ly- sis/Sonication cold buffer (1 % SDS, 10 mM EDTA and 50 mM Tris-HCl, pH 7.5) with fresh 0.5 mM PMSF and 1 �PIC (Protease Inhibitor Cocktail) and incubated for 30 min on ice. The lysates were homogenized with 10 strokes, centrifuged at 750g for 5 min at 4 °C and the supernatant was discarded. The pellet was resuspended in 350 �l of Lysis/Sonication cold buffer with freshly added 1 mM PMSF and 1 � PIC, sonicated on ice and centrifuged for 10 min with 2000g at 4 °C. The superna- tant contains extracted chromatin. The immunoprecipi- tation was carried out overnight at 4 °C with constant agitation in an immunoprecipitation buffer (5 mM Tris- HCl, pH 8.0, 15 mM NaCl, 1 mM EDTA and 0.1 % NP 40) with 20 �g of chromatin, 750 �g of Protein G dyna- beads #100.03D («Invitrogen®», USA), 4 µg of antibo- dies H4 pan-acetyl (#39243, «Active Motif®»), trime- thyl H3K9 (#05-1242, «Millipore®»), normal rabbit IgG (#PP64B, «Millipore®»; control) and 1 � PIC. All the immunoprecipitations were made at 1:4 dilutions. The magnetic beads were washed 6 times with the immuno- precipitation buffer and the chromatin was eluted with the Lysis/sonication buffer for 15 min at room temperatu- re with constant agitation. The chromatin was eluted from magnetic beads and reversed cross-linked by 5.25 � dilution with 0.2380 M NaCl, denatured at 95 °C for 15 min, after 1 �l of RNA- se A (10 �g/�l) was added and incubated at 37°C for 15 min and 1 �l of proteinase K (10 �g/�l) was added and incubated at 67 °C for 15 min. DNA was cleaned-up by the standard Phenol-Chloroform method and submitted to qPCR. qPCR, was carried out using the standard Syber-Green method with the Mastermix («Roche®», France). All fold enrichment values of H4Ac and H3K9me3 are relative to the fold enrichment values of the �-actin gene region or the alpha-satellite region, respectively. 198 SANTOS G. C. Jr. ET AL. All primers, synthesized by SIGMA®, are listed in 5'–3' and F – forward, R – reverse: MAR2: F – CTGGCCGGAAATGTTTTCTA, R – GTGCCAGGAGCTGTTCTAGG; MAR3: F – GTCTGGAGCTATTTGAAAATG, R – TGTCTTCCTGTGCCTGTAGTC; TP53P1: F – GCGTGTCACCGTCGTGGAAAG, R – GGAGCCTCGCAGGGGTTGATG; �-actin gene region: F – GACGTAGCACAGCT TCTCCT, R – GGGACCTGACTGACTACCTCAT; Alpha-Satellite (#CS207313, Millipore®) F – CTG CACTACCTGAAGAGGAC, R – GATGGTTCAAC ACTCTTACA. All chromatin extraction, immunoprecipitation and qPCR were done in triplicate and the error bars corres- ponded to the S.E.M. of three different experiments. Statistic analysis. All statistic data and graphics we- re performed by the GraphPad version 6.0 using unpai- red t-test analyses with Welch’s correction and 95 % confidence interval. Results and discussion. Association of S/MARs in breast cells is independent of H4Ac and H3K9me3 en- richment levels. Scaffold/Matrix Attachment Regions (S/MARs) have been described as cis-acting factors in- volved in DNA replication, transcription regulation and chromatin organization. Possibly they take part in the coordination of these cellular processes [28–30]. The tumor suppressor gene TP53 is one of the most studied genes implicated in cancer and, despite a huge know- ledge on its post-translational regulation [31, 32], its transcription control and genomic domain are not very well established [33]. In a previous work we described MARs in a genomic region of 167 kb containing the TP53 and neighboring genes, using different cell lines [27]. Here we concentrated our study on two MARs, na- mely MAR2 and MAR3. Interestingly, the association of MAR2 with the nuc- lear matrix was detected only in two analyzed non- cancerous cell lines HB2 and MCF10A where the TP53 gene is organized into a ~ 50 kb loop domain flanked 199 S/MARS AND CHROMATIN STATUS OF TP53 DOMAIN A B MAR 2 MAR 3TP53P1 MAR 3MAR 2 F o ld E n ri ch m en t F o ld E n ri ch m en t 0 2 4 6 0 2 4 6 10 20 Fig. 1. Chromatin state of MARs in breast cell lines in TP53 domain: A – TP53 genomic region organization based on NCBI database: NT_ 010718.16:7.1M-7.2M (94 kb+), covering the 167 kb genomic domain at the 17p13.1 chromosomal region (genes are represented by horizontal bars and arrows indicate the analyzed MARs – black; positions of MAR2 and MAR3 are indicated by black arrows, relatively to position 0, which corresponds to the major transcription start site (P1) of TP53 (TP53P1, indicated by a gray arrow); in the HB2 and MCF10A cell lines, MARs 2 and 3 delimitate a 50 kb loop encompassing the TP53, WRAP53 and EFNB3 genes); B – ChIP assay of MAR2 and MAR3, indicating the enrichment of euchromatin marker H4Ac (black column)(relative to beta-actin gene region) and heterochromatin marker H3K9me3 (grey column) (relative do alpha-satellite gene region); the cell lines utilized to describe MAR2 or MAR3 are underlined. Error bars correspond to +/–S.E.M. from 3 different experiments; p < < 0.05; p < < 0.005; *p < 0.0001 by two S/MARs (Fig. 1, A). This organization is pertur- bed in cancerous cell lines MDA-MB-231, BT-474, T47D and MCF-7 [27]. Chromatin is composed of DNA and proteins, mostly histones, which are involved in ge- nomic DNA organization in the nuclei. Histone altera- tions in N-terminal tail by acetylation, methylation or ubiquitylation may produce different levels of DNA compaction, leading to an open chromatin or euchroma- tin, permissive to the protein factors access, or leading to close chromatin or heterochromatin, repressive for the association of transcription factors [34–37]. These his- tone alterations may be tracked using a ChIP assay, and give an idea of the chromatin ambiance through the epi- genetic profile at a genomic site, in normal and cance- rous cells [38, 39]. In order to gain insight of the me- chanisms governing the attachment of these two S/ MARs, MAR2 and MAR3, in normal and breast cancer cell lines and to determine the chromatin state at S/ MARs, we performed the ChIP assays to detect the en- richment of both H4Ac and H3K9 me3 euchromatin and heterochromatin markers, respectively, in two non- cancerous cell lines: HB2 and MCF10A, and in four cancerous cell lines: MCF-7, T47D, BT-474 and MDA- MB-231 (Fig. 1, B). As presented in Fig. 1, B, we could not identify a specific pattern of the epigenetic histone markers enrichment in non-cancerous and cancerous cells, despite certain differences between histone mar kers when MAR3 are present in cancerous cells, BT- 474 and T47D. Moreover, the histone enrichment levels were quite different among cell lines, suggesting that neither H4Ac nor H3K9me3, chromatin enrichments, are lin- ked to S/MARs. Indeed, a link between the association of these regions to the NM and active histone marks re- mains controversial [13, 24, 40]. These results, suggest that nuclear matrix fixation and chromatin epigenetic status can be independent. Chromatin status of TP53 gene P1 promoter can be linked to TP53 transcription in MCF-7 cells. We have simultaneously performed ChIP assays in the TP53 gene P1 promoter region (TP53P1) to detect chromatin chan- ges associated with the TP53 transcriptional status (Fig. 2). Indeed, in the cell lines, TP53 is less expressed in can- cerous cells, relative to HB2, as follows: ~ 2.5X in MCF- 7 and T47D, ~ 1.66X in MDA-MB-231 and ~ 1.11X in BT-474 [27]. Interestingly, a higher enrichment of hetero- chromatin marker H3K9me3 in TP53P1 in MCF-7, as shown in Fig. 2, corroborates the lowest level of the TP53 gene expression observed in this cell line. Also, a high- er enrichment of H4Ac in the non-cancerous cell lines, MCF10A and HB2, corroborates higher levels of TP53 described in HB2, in our earlier report [27].These results together suggest that chromatin status of the P1 TP53 promoter, can regulate the TP53 expression in some breast cell lines. Conclusions. Our results show no correlation bet- ween S/MARs and H4 acetylation/H3K9 trimethyla- tion, suggesting that nuclear matrix fixation and these specific chromatin modifications are possibly indepen- dent events during breast cancer progression. Also, chro- matin status of the P1 TP53 promoter can regulate TP53 expression in the MCF-7 cell line. Acknowledgements and funding. This research was supported by grants from CNPQ (INBEB-CNPQ grant N 57.3767/2008-4) and CAPES-COFECUB (grant N 615/2008). 200 SANTOS G. C. Jr. ET AL. F o ld E n ri ch m en t TP53 P1 Promoter Region 0 2 4 6 8 10 Fig. 2. Chromatin state of TP53 P1 Promoter re- gion. ChIP assay of the TP53 P1 promoter regi- on, indicating the enrichment of euchromatin marker H4Ac (black column) (relative to beta- actin gene region) and heterochromatin marker H3K9me3 (grey column) (relative do alpha-sa- tellite gene region). Error bars cor respond to +/– S.E.M. from 3 different experiments; p < 0.05; ****p < 0.00001 Çáàãà÷åííÿ õðîìàòèíîâèìè ìàðêåðàìè H4Ac ³ H3K9me3 äîìåíó ãåíà TP53 ó êë³òèííèõ ë³í³ÿõ ìîëî÷íî¿ çàëîçè Ã. Äæ. Ð. Ñàíòîñ, A. C. Ñ. Õîåñ, Ê. Â. äå Ìîóðà Ãàëëî Ðåçþìå Ó íåîíêîãåííèõ êë³òèííèõ ë³í³ÿõ HB2 ³ MCF10A ãåí TP53 ðîçòàøî- âàíèé âñåðåäèí³ â³äíîñíî íåâåëèêî¿ ïåòë³ õðîìàòèíó (~ 50 òèñ. ïàð íóêëåîòèä³â), îáìåæåíî¿ äâîìà ä³ëÿíêàìè ïðèêð³ïëåííÿ äî ÿäåðíîãî ìàòðèêñó (ÄÏÌ). Ìåòà. Ïðîàíàë³çóâàòè õðîìàòèíîâ³ ìàðêåðè H4Ac ³ H3K9me3 ó çàçíà÷åíèõ ÄÏÌ ³ P1 ïðîìîòîð³ ãåíà TP53 â ð³çíèõ êë³òèííèõ ë³í³ÿõ ìîëî÷íî¿ çàëîçè. Ìåòîäè. ²ìóíî- ïðåöèï³òàö³þ õðîìàòèíó çà äîïîìîãîþ àíòèò³ë ïðîòè ìàðêåð³â àêòèâíîãî õðîìàòèíó H4Ac ³ ãåòåðîõðîìàòèíó H3K9me3 âèêîðè- ñòàíî äëÿ õàðàêòåðèñòèêè ñòàíó õðîìàòèíó åëåìåíò³â ÄÏÌ ó íåîíêîãåííèõ êë³òèííèõ ë³í³ÿõ HB2 ³ MCF10A òà çëîÿê³ñíèõ êë³- òèííèõ ë³í³ÿõ MCF-7, MDA-MB-231, ÁÒ-474 ³ T47D. Ðåçóëüòàòè. Çàçíà÷åí³ åï³ãåíåòè÷í³ ìàðêåðè íåð³âíîì³ðíî ðîçïîä³ëåí³ â äîñë³ä- æóâàíèõ ÄÏÌ äëÿ âñ³õ ïðîàíàë³çîâàíèõ ë³í³é êë³òèí ìîëî÷íî¿ çà- ëîçè. Âèñíîâêè. Íå çíàéäåíî êîðåëÿö³¿ â åï³ãåíåòè÷íîìó ñòàòóñ³ ÄÏÌ ³ õðîìàòèíó. Öå äîçâîëÿº ïðèïóñòèòè, ùî ô³êñàö³ÿ ó ÿäåðíî- ìó ìàòðèêñ³ ³ ñòàòóñ õðîìàòèíó ìîæóòü áóòè íåçàëåæíèìè. Ñóòòºâå çáàãà÷åííÿ H3K9me3 P1 ïðîìîòîðíî¿ îáëàñò³ ãåíà TP53 êë³òèííî¿ ë³í³¿ MCF-7 ìîæå áóòè ïðè÷èíîþ íèæ÷èõ ð³âí³â åêñïðå- ñ³¿ TP53, îïèñàíèõ ðàí³øå íàøîþ ãðóïîþ. Êëþ÷îâ³ ñëîâà: TP53, õðîìàòèí, ïåòëåâèé äîìåí, ÌÀÐ, ðàê ìî- ëî÷íî¿ çàëîçè, åï³ãåíåòè÷í³ ìîäèô³êàö³¿ ã³ñòîí³â, ÷èï àíàë³çó. Îáîãàùåíèå õðîìàòèíîâûìè ìàðêåðàìè H4Ac è H3K9me3 äîìåíà ãåíà TP53 â êëåòî÷íûõ ëèíèÿõ ìîëî÷íîé æåëåçû Ãþ Äæ. Ð. Ñàíòîñ, A. C. Ñ. Ãîåñ, Ê. Â. äå Ìîóðà Ãàëëî Ðåçþìå Â íåîíêîãåííûõ êëåòî÷íûõ ëèíèÿõ HB2 è MCF10A ãåí TP53 ðàñïî- ëîæåí âíóòðè îòíîñèòåëüíî íåáîëüøîé ïåòëè õðîìàòèíà (~ 50 òûñ. ïàð íóêëåîòèäîâ), îãðàíè÷åííîé äâóìÿ ó÷àñòêàìè ïðèêðåï- ëåíèÿ ê ÿäåðíîìó ìàòðèêñó (ÓÏÌ). Öåëü. Ïðîàíàëèçèðîâàòü õðî- ìàòèíîâûå ìàðêåðû H4Ac è H3K9me3 â óêàçàííûõ ÓÏÌ è P1 ïðîìîòîðå ãåíà TP53 â ðàçëè÷íûõ êëåòî÷íûõ ëèíèÿõ êëåòîê ìî- ëî÷íîé æåëåçû. Ìåòîäû. Èììóíîïðåöèïèòàöèþ õðîìàòèíà ñ ïî- ìîùüþ àíòèòåë ïðîòèâ ìàðêåðîâ àêòèâíîãî õðîìàòèíà H4Ac è ãåòåðîõðîìàòèíà H3K9me3 èñïîëüçîâàëè äëÿ õàðàêòåðèñòèêè ñîñòîÿíèÿ õðîìàòèíà ýëåìåíòîâ ÓÏÌ â íåîíêîãåííûõ êëåòî÷- íûõ ëèíèÿõ HB2 è MCF10A è çëîêà÷åñòâåííûõ êëåòî÷íûõ ëèíèÿõ MCF-7, MDA-MB-231, ÁÒ-474 è T47D. Ðåçóëüòàòû. Óêàçàííûå ýïèãåíåòè÷åñêèå ìàðêåðû íåðàâíîìåðíî ðàñïðåäåëåíû â èññëåäî- âàííûõ ÓÏÌ äëÿ âñåõ àíàëèçèðóåìûõ ëèíèé êëåòîê ìîëî÷íîé æå- ëåçû. Âûâîäû. Íå âûÿâëåíà êîððåëÿöèÿ â ýïèãåíåòè÷åñêîì ñòà- òóñå ÓÏÌ è õðîìàòèíà. Ýòî ïîçâîëÿåò ïðåäïîëîæèòü, ÷òî ôèê- ñàöèÿ â ÿäåðíîì ìàòðèêñå è ñòàòóñ õðîìàòèíà ìîãóò áûòü íåçà- âèñèìûìè. Ñóùåñòâåííîå îáîãàùåíèå H3K9me3 P1 ïðîìîòîðíîé îáëàñòè ãåíà TP53 êëåòî÷íîé ëèíèè MCF-7 ìîæåò áûòü ïðè÷è- íîé áîëåå íèçêèõ óðîâíåé ýêñïðåññèè TP53, îïèñàííûõ ðàíåå íà- øåé ãðóïïîé. Êëþ÷åâûå ñëîâà: TP53, õðîìàòèí, ïåòëåâîé äîìåí, ÌÀÐ, ðàê ìîëî÷íîé æåëåçû, ýïèãåíåòè÷åñêèå ìîäèôèêàöèè ãèñòîíîâ, ÷èï àíàëèçà. REFERENCES 1. Choe MK, Hong CP, Park J, Seo SH, Roh TY. Functional ele- ments demarcated by histone modifications in breast cancer cells. Biochem Biophys Res Commun. 2012;418(3):475–82. 2. Budhavarapu VN, Chavez M, Tyler JK. How is epigenetic infor- mation maintained through DNA replication? Epigenetics Chro- matin. 2013;6(1):32. 3. Terweij M, van Leeuwen F. Histone exchange: sculpting the epi- genomeþ Front Life Sci. 2013; 7(1–2):63–79. 4. Luo XG, Guo S, Guo Y, Zhang CL. Histone modification and breast cancer. Breast cancer – focusing tumor microenviron- ment, stem cells and metastasis. Eds M Gunduz, E Gunduz. 2011; Ch. 15:321–342. 5. Chicoine LG, Schulman IG, Richman R, Cook RG, Allis CD. Nonrandom utilization of acetylation sites in histones isolated from Tetrahymena. Evidence for functionally distinct H4 acety- lation sites. J Biol Chem. 1986;261(3):1071–6. 6. O'Neill LP, Turner BM. Histone H4 acetylation distinguishes coding regions of the human genome from heterochromatin in a differentiation-dependent but transcription-independent manner. EMBO J. 1995;14(16):3946–57. 7. Thorne AW, Kmiciek D, Mitchelson K, Sautiere P, Crane- Robinson C. Patterns of histone acetylation. Eur J Biochem. 1990; 193 (3):701–13. 8. Leroy G, Dimaggio PA, Chan EY, Zee BM, Blanco MA, Bryant B, Flaniken IZ, Liu S, Kang Y, Trojer P, Garcia BA. A quantitative atlas of histone modification signatures from human cancer cells. Epigenetics Chromatin. 2013;6(1):20. 9. Bell O, Tiwari VK, Thoma NH, Schubeler D. Determinants and dynamics of genome accessibility. Nat Rev Genet. 2011;12(8): 554–64. 10. Hon GC, Hawkins RD, Caballero OL, Lo C, Lister R, Pelizzola M, Valsesia A, Ye Z, Kuan S, Edsall LE, Camargo AA, Stevenson BJ, Ecker JR, Bafna V, Strausberg RL, Simpson AJ, Ren B. Global DNA hypomethylation coupled to repressive chromatin domain formation and gene silencing in breast cancer. Genome Res. 2012;22(2):246–58. 11. Baylin SB, Jones PA. A decade of exploring the cancer epige- nome – biological and translational implications. Nat Rev Can- cer. 2011;11(10):726–34. 12. Vassetzky YS, Hair A, Razin SV. Rearrangement of chromatin domains in cancer and development. J Cell Biochem Suppl. 2000;Suppl 35:54–60. 13. Razin SV, Iarovaia OV, Vassetzky YS. A requiem to the nuclear matrix: from a controversial concept to 3D organization of the nucleus. Chromosoma. 2014; 123(3):217–24 14. Eivazova ER, Gavrilov A, Pirozhkova I, Petrov A, Iarovaia OV, Razin SV, Lipinski M, Vassetzky YS. Interaction in vivo between the two matrix attachment regions flanking a single chromatin loop. J Mol Biol. 2009;386(4):929–37. 15. Razin SV, Vassetzky YS, Hancock R. Nuclear matrix attachment regions and topoisomerase II binding and reaction sites in the vi- cinity of a chicken DNA replication origin. Biochem Biophys Res Commun. 1991;177(1):265–70. 16. Ottaviani D, Lever E, Takousis P, Sheer D. Anchoring the ge- nome. Genome Biol. 2008;9(1):201. 17. Wilson RH, Coverley D. Relationship between DNA replication and the nuclear matrix. Genes Cells. 2013 Jan;18(1):17–31. 18. Rivera-Mulia JC, Hernandez-Munoz R, Martinez F, Aranda-An- zaldo A. DNA moves sequentially towards the nuclear matrix du- ring DNA replication in vivo. BMC Cell Biol. 2011;12:3. 201 S/MARS AND CHROMATIN STATUS OF TP53 DOMAIN 19. Bode J, Maass K. Chromatin domain surrounding the human interferon-beta gene as defined by scaffold-attached regions. Biochemistry. 1988;27(13):4706–11. 20. Forrester WC, Fernandez LA, Grosschedl R. Nuclear matrix at- tachment regions antagonize methylation-dependent repression of long-range enhancer-promoter interactions. Genes Dev. 1999; 13(22):3003–14. 21. Fernandez LA, Winkler M, Grosschedl R. Matrix attachment re- gion-dependent function of the immunoglobulin mu enhancer in- volves histone acetylation at a distance without changes in en- hancer occupancy. Mol Cell Biol. 2001;21(1):196–208. 22. Martens JH, Verlaan M, Kalkhoven E, Dorsman JC, Zantema A. Scaffold/matrix attachment region elements interact with a p300-scaffold attachment factor A complex and are bound by acetylated nucleosomes. Mol Cell Biol. 2002;22(8):2598–606. 23. Keaton MA, Taylor CM, Layer RM, Dutta A. Nuclear scaffold at- tachment sites within ENCODE regions associate with actively transcribed genes. PLoS One. 2011;6(3):e17912. 24. Kisseljova NP, Dmitriev P, Katargin A, Kim E, Ezerina D, Mar- kozashvili D, Malysheva D, Planche E, Lemmers RJ, van der Ma- arel SM, Laoudj-Chenivesse D, Lipinski M, Vassetzky YS. DNA polymorphism and epigenetic marks modulate the affinity of a scaffold/matrix attachment region to the nuclear matrix. Eur J Hum Genet. 2014 Jan 22. doi: 10.1038/ejhg.2013.306. 25. Hendzel MJ, Sun JM, Chen HY, Rattner JB, Davie JR. Histone acetyltransferase is associated with the nuclear matrix. J Biol Chem. 1994;269(36):22894–901. 26. Davie JR. Nuclear matrix, dynamic histone acetylation and transcriptionally active chromatin. Mol Biol Rep. 1997; 24 (3): 197–207. 27. Goes AC, Cappellen D, Santos GC Jr, Pirozhkova I, Lipinski M, Vassetzky Y, de Moura-Gallo CV. Loop domain organization of the p53 locus in normal and breast cancer cells correlates with the transcriptional status of the TP53 and the neighboring genes. J Cell Biochem. 2011;112(8):2072–81. 28. Trevilla-Garcia C, Aranda-Anzaldo A. Cell-type-specific orga- nization of nuclear DNA into structural looped domains. J Cell Biochem. 2011;112(2):531–40. 29. Dijkwel PA, Hamlin JL. Matrix attachment regions are positio- ned near replication initiation sites, genes, and an interamplicon junction in the amplified dihydrofolate reductase domain of Chinese hamster ovary cells. Mol Cell Biol. 1988;8(12): 5398–409. 30. Boulikas T. Chromatin domains and prediction of MAR sequen- ces. Int Rev Cytol. 1995;162A:279–388. 31. Muller PA, Vousden KH. p53 mutations in cancer. Nat Cell Biol. 2013;15(1):2–8. 32. Khoury MP, Marcel V, Fernandes K, Diot A, Lane DP, Bourdon JC. Detecting and quantifying p53 isoforms at mRNA level in cell lines and tissues. Methods Mol Biol. 2013;962:1–14. 33. Wang B, Niu D, Lam TH, Xiao Z, Ren EC. Mapping the p53 trans- criptome universe using p53 natural polymorphs. Cell Death Differ. 2014;21(4):521–32. 34. Razin SV, Petrov A, Hair A, Vassetzky YS. Chromatin domains and territories: flexibly rigid. Crit Rev Eukaryot Gene Expr. 2004;14(1–2):79–88. 35. Espinoza CA, Ren B. Mapping higher order structure of chroma- tin domains. Nat Genet. 2011;43(7):615–6. 36. van Steensel B. Chromatin: constructing the big picture. EMBO J. 2011;30(10):1885–95. 37. Zuleger N, Robson MI, Schirmer EC. The nuclear envelope as a chromatin organizer. Nucleus. 2011;2(5):339–49. 38. Gargiulo G, Minucci S. Epigenomic profiling of cancer cells. Int J Biochem Cell Biol. 2009;41(1):127–35. 39. Dalvai M, Bystricky K. The role of histone modifications and variants in regulating gene expression in breast cancer. J Mam- mary Gland Biol Neoplasia. 2010;15(1):19–33. 40. Majocchi S, Aritonovska E, Mermod N. Epigenetic regulatory elements associate with specific histone modifications to prevent silencing of telomeric genes. Nucleic Acids Res. 2014;42(1): 193–204. Received 30.02.14 202 SANTOS G. C. Jr. ET AL.

Chromatin enrichment of histone marks H4Ac and H3K9me3 in TP53 gene domain in breast cells

Репозитарії

Схожі ресурси