Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system
In the previous studies, the DNA with the bulky Fap-dC derivative was demonstrated to be a difficult substrate for the nucleotide excision repair (NER), a system which is involved in the removal of bulky lesions from DNA. This type of compounds could be of particular interest as possible selective N...
Збережено в:
| Дата: | 2019 |
|---|---|
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут молекулярної біології і генетики НАН України
2019
|
| Назва видання: | Вiopolymers and Cell |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/154395 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system / A.A. Popov, A.N. Evdokimov, N.V. Lukyanchikova, I.O. Petruseva, O.I. Lavrik // Вiopolymers and Cell. — 2019. — Т. 35, № 2. — С. 107-117. — Бібліогр.: 34 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-154395 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1543952019-07-07T13:04:18Z Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system Popov, A.A. Evdokimov, A.N. Lukyanchikova, N.V. Petruseva, I.O. Lavrik, O.I. Structure and Function of Biopolymers In the previous studies, the DNA with the bulky Fap-dC derivative was demonstrated to be a difficult substrate for the nucleotide excision repair (NER), a system which is involved in the removal of bulky lesions from DNA. This type of compounds could be of particular interest as possible selective NER, considerably reducing the potency of DNA repair due to competitive immobilization of protein factors involved in this process. This approach can be potentially useful to increase the efficiency of chemotherapy. Aim. To identify DNA structures containing multiple bulky adducts that can efficiently inhibit the nucleotide excision repair. Methods. Enzymatic DNA synthesis, PCR, NER-competent cell extract preparation, in vitro NER assay, HPLC. Results. The conditions for the synthesis of extended DNA containing multiple unrepairable lesions were established. A wide range of DNA structures containing modified nucleotides was obtained. All modified DNAs were shown to inhibit the in vitro activity of the NER system. The DNA structure that inhibits the NER activity with the highest efficiency was selected. Conclusions. The model DNA structures effectively inhibiting the activity of NER were found. The new data obtained here can potentially be used for both basic and applied research. У наших попередніх дослідженнях було показано, що ДНК з об'ємним похідним Fap-dC є складнорепарованим субстратом для системи ексцизійної репарації нуклеотидів (Ерн). З'єднання такого типу можуть становити особливий інтерес як можливі селективні інгібітори системи Ерн, значно знижуючи ефективність репарації ДНК шляхом зв'язування білкових чинників, залучених до даного процесу. Цей підхід може бути потенційно корисний для підвищення ефективності хіміотерапії. Мета. Дане дослідження спрямоване на пошук ДНК-структур, що містять множинні об'ємні аддукти, які з найбільшою ефективністю можуть пригнічувати активність системи. Методи. Ферментативний синтез ДНК, ПЛР, приготування Ерн-компетентних клітинних екстрактів, реакція вирізання, що каталізується білками Ерн in vitro, ВЕРХ. Результати. Проведено підбір умов синтезу протяжних модельних ДНК з множинним включенням нерепарованого пошкодження Fap-dC. Отримано ряд ДНК-структур, що містить в своєму складі різну кількість модифікованих ланок. Показано, що всі отримані ДНК пригнічують активність системи Ерн in vitro. Обрана ДНК-структура, яка пригнічує NER найбільш високою ефективністю. Висновки. Модельні ДНК з нерепарованими ушкодженнями, здатні високою ефективністю пригнічувати NER, можуть розглядатися в якості інгібіторів системи Ерн. Виявлені в даній роботі закономірності потенційно можуть бути використані для проведення як фундаментальних, так і прикладних досліджень. В наших предыдущих исследованиях было показано, что ДНК с объемным производным Fap-dC является труднорепарируемым субстратом для системы эксцизионной репарации нуклеотидов (ЭРН). Соединения такого типа могут представлять особый интерес как возможные селективные ингибиторы системы ЭРН, значительно снижая эффективность репарации ДНК путем связывания белковых факторов, вовлеченных в этот процесс. Этот подход может быть потенциально полезен для повышения эффективности химиотерапии. Цель.Текущее исследование направлено на поиск ДНК-структур, содержащих множественные объемные аддукты, которые с наибольшей эффективностью могут подавлять активность системы. Методы. Ферментативный синтез ДНК, ПЦР, приготовление ЭРН-компетентных клеточных экстрактов, реакция вырезания, катализируемая белками ЭРН in vitro, ВЭЖХ. Результаты. Проведен подбор условий синтеза протяженных модельных ДНК с множественным включением нерепарируемого повреждения Fap-dC. Получен ряд ДНК-структур, содержащий в своем составе различное количество модифицированных звеньев. Показано, что все полученные ДНК подавляют активность системы ЭРН in vitro. Выбрана ДНК-структура, которая ингибирует NER наиболее высокой эффективностью. Выводы. Модельные ДНК с нерепарируемыми повреждениями, способные высокой эффективностью подавлять NER, могут рассматриваться в качестве ингибиторов системы ЭРН. Обнаруженные в настоящей работе закономерности потенциально могут быть использованы для проведения не только фундаментальных, но и прикладных исследований. 2019 Article Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system / A.A. Popov, A.N. Evdokimov, N.V. Lukyanchikova, I.O. Petruseva, O.I. Lavrik // Вiopolymers and Cell. — 2019. — Т. 35, № 2. — С. 107-117. — Бібліогр.: 34 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.00099C http://dspace.nbuv.gov.ua/handle/123456789/154395 577.213.3 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Structure and Function of Biopolymers Structure and Function of Biopolymers |
| spellingShingle |
Structure and Function of Biopolymers Structure and Function of Biopolymers Popov, A.A. Evdokimov, A.N. Lukyanchikova, N.V. Petruseva, I.O. Lavrik, O.I. Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system Вiopolymers and Cell |
| description |
In the previous studies, the DNA with the bulky Fap-dC derivative was demonstrated to be a difficult substrate for the nucleotide excision repair (NER), a system which is involved in the removal of bulky lesions from DNA. This type of compounds could be of particular interest as possible selective NER, considerably reducing the potency of DNA repair due to competitive immobilization of protein factors involved in this process. This approach can be potentially useful to increase the efficiency of chemotherapy. Aim. To identify DNA structures containing multiple bulky adducts that can efficiently inhibit the nucleotide excision repair. Methods. Enzymatic DNA synthesis, PCR, NER-competent cell extract preparation, in vitro NER assay, HPLC. Results. The conditions for the synthesis of extended DNA containing multiple unrepairable lesions were established. A wide range of DNA structures containing modified nucleotides was obtained. All modified DNAs were shown to inhibit the in vitro activity of the NER system. The DNA structure that inhibits the NER activity with the highest efficiency was selected. Conclusions. The model DNA structures effectively inhibiting the activity of NER were found. The new data obtained here can potentially be used for both basic and applied research. |
| format |
Article |
| author |
Popov, A.A. Evdokimov, A.N. Lukyanchikova, N.V. Petruseva, I.O. Lavrik, O.I. |
| author_facet |
Popov, A.A. Evdokimov, A.N. Lukyanchikova, N.V. Petruseva, I.O. Lavrik, O.I. |
| author_sort |
Popov, A.A. |
| title |
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system |
| title_short |
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system |
| title_full |
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system |
| title_fullStr |
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system |
| title_full_unstemmed |
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system |
| title_sort |
unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system |
| publisher |
Інститут молекулярної біології і генетики НАН України |
| publishDate |
2019 |
| topic_facet |
Structure and Function of Biopolymers |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/154395 |
| citation_txt |
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system / A.A. Popov, A.N. Evdokimov, N.V. Lukyanchikova, I.O. Petruseva, O.I. Lavrik // Вiopolymers and Cell. — 2019. — Т. 35, № 2. — С. 107-117. — Бібліогр.: 34 назв. — англ. |
| series |
Вiopolymers and Cell |
| work_keys_str_mv |
AT popovaa unrepairablesubstratesofnucleotideexcisionrepairandtheirapplicationtosuppresstheactivityofthisrepairsystem AT evdokimovan unrepairablesubstratesofnucleotideexcisionrepairandtheirapplicationtosuppresstheactivityofthisrepairsystem AT lukyanchikovanv unrepairablesubstratesofnucleotideexcisionrepairandtheirapplicationtosuppresstheactivityofthisrepairsystem AT petrusevaio unrepairablesubstratesofnucleotideexcisionrepairandtheirapplicationtosuppresstheactivityofthisrepairsystem AT lavrikoi unrepairablesubstratesofnucleotideexcisionrepairandtheirapplicationtosuppresstheactivityofthisrepairsystem |
| first_indexed |
2025-07-14T06:32:55Z |
| last_indexed |
2025-07-14T06:32:55Z |
| _version_ |
1837602992314908672 |
| fulltext |
107
A. Popov, A. Evdokimov, N. Lukyanchikova
© 2019 A. Popov et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Biopoly-
mers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium,
provided the original work is properly cited
UDC 577.213.3
Unrepairable substrates of nucleotide excision repair and their
application to suppress the activity of this repair system
A. A. Popov1, A. N. Evdokimov1, N. V. Lukyanchikova1, I. O. Petruseva1, O. I. Lavrik1,2
1 Novosibirsk Institute of Chemical Biology and Fundamental Medicine,
Siberian Branch of the Russian Academy of Sciences
8, Akademika Lavrentieva Ave., Novosibirsk, Russian Federation, 630090
2 Novosibirsk State University
2, Pirogova Str., Novosibirsk, Russian Federation, 630090
lavrik@niboch.nsc.ru
In the previous studies, the DNA with the bulky Fap-dC derivative was demonstrated to be a
difficult substrate for the nucleotide excision repair (NER), a system which is involved in the
removal of bulky lesions from DNA. This type of compounds could be of particular interest
as possible selective NER, considerably reducing the potency of DNA repair due to competi-
tive immobilization of protein factors involved in this process. This approach can be poten-
tially useful to increase the efficiency of chemotherapy. Aim. To identify DNA structures
containing multiple bulky adducts that can efficiently inhibit the nucleotide excision repair.
Methods. Enzymatic DNA synthesis, PCR, NER-competent cell extract preparation, in vitro
NER assay, HPLC. Results. The conditions for the synthesis of extended DNA containing
multiple unrepairable lesions were established. A wide range of DNA structures containing
modified nucleotides was obtained. All modified DNAs were shown to inhibit the in vitro
activity of the NER system. The DNA structure that inhibits the NER activity with the highest
efficiency was selected. Conclusions. The model DNA structures effectively inhibiting the
activity of NER were found. The new data obtained here can potentially be used for both
basic and applied research.
K e y w o r d s: DNA repair, nucleotide excision repair, unrepairable DNA lesions, model DNA
substrates
Introduction
The nucleotide excision repair system (NER)
removes from the DNA a wide range of bulky
adducts that are induced into DNA by ultra-
violet light (UV), various chemically active
compounds (drugs, mutagenic environmental
compounds), active forms of oxygen and ion-
izing radiation [1]. The damages removed by
the NER system include the products of pho-
tocrosslinking of adjacent pyrimidine bases,
platinum adducts, protein-DNA crosslinking;
ISSN 1993-6842 (on-line); ISSN 0233-7657 (print)
Biopolymers and Cell. 2019. Vol. 35. N 2. P 107–117
doi: http://dx.doi.org/10.7124/bc.00099C
108
A. Popov, A. Evdokimov, N. Lukyanchikova et al.
adducts arising from the interaction of active
derivatives of benzo[a]pyrene, benzo[c]anthra-
cene, acetylaminofluorene with DNA, as well
as with other bulky adducts, significantly dis-
turbing the regular structure of double-stran ded
DNA [2].
About 30 proteins are involved in the NER
process, forming functional complexes at each
stage of the reparative process [1, 3]. These
proteins carry out the search for damage, its
verification and subsequent removal of short
oligonucleotide containing the lesion. The re-
synthesis of the nucleotide sequence is per-
formed by the specialized DNA repair poly-
merases and several proteins of the DNA rep-
lication.
One of the approaches to the study of NER
mechanism includes the use of the synthetic
substrate analogues — double-stranded DNAs
containing bulky modification in the defined
position of a molecule, as well as structural
analogs of the intermediates of NER process
[4–9]. The model DNAs mimicking various
NER intermediates can be used as a tool for
determining the parameters of protein affinity
to damaged DNA [10, 11]. The extended linear
DNA duplexes can be also used to study the
stage of damage elimination and the changes
of protein-DNA complexes that occur in the
NER process. Thus, the substrates with bulky
groups, which are highly recognized and re-
moved from the DNA by the NER system, can
serve as a tool for determining the activity of
this system in vitro [12].
The model DNAs containing photoactivat-
able or chemically active groups are of great
interest, as it can be regarded as the probes
for affinity modification of proteins [13].
Various DNA derivatives containing arylazido
groups have been used most widely to design
photoactivatable DNA probes. Their rapid
activation by exposure to UV light after the
formation of a complex of photoreactive sub-
strate with the protein makes it possible to
study the dynamics of the process of protein-
DNA interactions in NER [14]. For instance
new details of the mechanism of primary dam-
age recognition during the NER process were
estimated using photoactivatable analogs of
the NER substrates. The method of photoaf-
finity modification was used to determine a
character of protein-DNA interactions for the
main proteins involved in the recognition and
verification of the damage - XPC, RPA and
XPA [10, 15–17].
Among the previously used photoactivable
model DNAs, the 4-azido-2,5-difluoro-3-chlo-
ropyridin-6-yl derivative of dC (Fap-dC) is of
particular interest. It was shown that Fap-dC
in the DNA duplex with a length of 137 bp is
a practically unrepairable damage for the NER
system [18]. At the same time, DNA containing
Fap-dC can efficiently bind [the] NER factors
[19, 20]. Fap-dC demonstrated a high effi-
ciency as a probe for [the] photoaffinity modi-
fication of DNA binding proteins in [the] NER-
competent HeLa cell extracts [11, 18]. Thus,
DNA of various lengths and structures contain-
ing Fap-dC residue at the defined position was
successfully used to study the NER system.
The extended model DNA structures con-
taining reactive and hardly repairable damage
can serve as a useful tool for comparative as-
sessments of the ability to suppress NER, as
well as for investigations which include visu-
alization of nucleoprotein complexes. The pur-
pose of this work was to obtain extended
model DNAs containing multiple Fap-dC
109
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system
groups, and to analyze the possible use of such
DNAs to suppress the activity of the NER
system.
Materials and Methods
T4-polynucleotide kinase, T4-DNA ligase and
Taq DNA polymerase were from “Biosan”
(Novosibirsk); DNA polymerase β was kindly
provided by S. N. Khodyreva; the set of the
enzymes for DNA digestion “DNA Degradase”
was produced by “ZymoResearch”; ɑ-[³²P]-
dCTP and ɣ-[³²P]-ATP (3000 Ci/mmol) were
produced at ICBFM SB RAS; Fap-dCTP
(Fig. 1A) was synthesized as described in [21]
and kindly provided by I. V. Safronov; oligo-
deoxyribonucleotide containing non-nucleo-
side insertion nAnt (ONT-1, Table 1; Fig. 1B)
was synthesized as described in [12]; C33A
(human cervical cancer cell line) cells were
kindly provided by N. P. and F L. Kisselev.
Furthermore, proteinase K, dNTP’s (“Biosan”,
Novosibirsk), urea, N,N’-methylenbi sacrila-
mide (“Amersco”), acrilamide (“Applichem”),
TEMED (“Helicon”), DEAE filters DE-81
(“Whatman”), DNA Gel Extraction Kit
QIAquick (“Qiagen”), Quick Start Bradford
Protein Assay Kit (“Biorad”) were used in this
work.
The sequences of the oligodeoxyribonucle-
otides (ONT) used are shown in Table 1.
Synthesis of 137-nt DNA duplex containing
non-nucleoside insertion nAnt. ONT-1 contain-
ing non-nucleoside fragment with N-[6-(9-
Table 1. The numbering, sequence and length of oligonucleotides (ONT) used.
ONT # Sequence length, nt
1 5’-caccgtcMccctggat* 16
2 5’-caccgtcgccctggat 16
3 5’-tggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccaggg 67
4 5’-gacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatt 69
5 5’-gcctacagcatccagggcgacggtgccgaggatg 34
6 5’-atcaccggcgccaca 15
7 5’-gtatccgctcatgagacaat 20
8 5’-gggggctcggcaccgtcaccctggatgctgtagg 34
*M – non-nucleoside insertion nAnt.
Fig. 1. Structures of model lesion used. Exo-N-{2-[N-(4-
azido-2,5-difluoro-3-chloropyridin-6-yl)-3-aminopropio-
nyl]aminoethyl}-deoxycytidinine (Fap-dC, A) and the non-
nucleoside fragment of the modified DNA strand, contain-
ing N-[6-(9-antracenylcarbomoyl)hexanoyl]-3-amino-1,2-
propandiol (nAnt, B)].
A
B
110
A. Popov, A. Evdokimov, N. Lukyanchikova et al.
antracenylcarbomoyl)hexanoyl]-3-amino-1,2-
propandiol (nAnt), flanking 5’-[³²P]-ОNТ-3
and ОNТ-4 were mixed with template ОNТ-5
in equimolar amount. The mixture was heated
at 95ºС for 5 min, than slowly cooled (about
of 1ºС per minute) to the room temperature.
The ligation of the single strand breaks was
carried out by the addition of Т4 DNA ligase
and ATP with the following incubation at 12°С
for 12 h. Single-stranded DNA obtained was
purified by electrophoresis in polyacrylamide
gel under denaturing conditions according to
[22]. Briefly, the target DNA was separated by
electrophoresis and was isolated from gel by
electroelution to DEAE filter. The elution of
oligonucleotide from DEAE filter was per-
formed at 70ºС by 3 М LiClO4. DNA was
precipitated with acetone and dissolved in TE
buffer. The resulting modified DNA was an-
nealed with the appropriate complementary
strand.
Synthesis of 756-nt DNA by PCR. Non-
modified 756 bp DNA was obtained by PCR
using pBR322 as template and ОNT-6 and
ОNТ-7 as primers. The 100 μl of reaction
mixture contained 25 ng of a template, 0.5 µМ
primers, 0.2 mМ dNTP’s, 1.5 mM MgCl2 and
6 units of Taq DNA polymerase in Taq DNA
polymerase reaction buffer. In order to obtain
the modified DNA of the same length, PCR
was carried out under the same conditions with
addition of 5 to 160 µМ Fap-dCTP in the reac-
tion mixture. PCR products were precipitated
with ethanol in 0.3 M CH3COONa (pH 5.5)
with linear polyacrylamide as a co-precipitant
and then dissolved in TE buffer. Purification
of PCR products was carried out by electro-
phoresis in 1 % agarose gel. Isolation of DNA
from agarose gel was performed using
QIAquick Kit (“Qiagen”) according to proto-
col provided by manufacturer.
Resulting DNAs concentrations were deter-
mined by measuring the optical density of the
solution at 260 nM. The concentration of DNA
obtained was calculated using “OligoCalculator”.
NER-competent C33A cell extract was ob-
tained by the standard method described in
[23]. The concentration of protein in the ex-
tract was determined using Quick Start
Bradford Protein Assay Kit (“Bio Rad”), using
BSA as a standard for the calibration curve.
Analysis of relative NER efficiency was car-
ried out by the method described in [12] using
137 bp DNA containing nAnt lesion, and
ОNТ-8 as a template for detection of the exci-
sion products. Briefly, the excision products
were detected by annealing to the template
followed by end-labeling using α-[32P]-dCTP
and Taq DNA polymerase. The analysis of the
excision products was performed by electro-
phoresis in 10 % polyacrilamide under dena-
turating conditions. Mixture of [³²P]-5ꞌ-labeled
oligodeoxyribonucleotides was used as a DNA
ladder. To estimate the influence of 756 bp
Fap-dC- and non-modified DNA on specific
excision of nAnt lesion from the model DNA
the extended DNA was added into reaction
mixtures during the excision reaction.
Enzymatic hydrolysis of 756-strand DNA to
deoxymononucleotides was performed using
the DNA Degradase kit (“Zymo Researsh”)
according to the manufacturer’s protocol.
Analysis of a mixture of mononucleotides
was performed using high performance liquid
chromatography (HPLC) with chromatograph
Milichrom A-02 and ProntoSIL-120-5-C18 AQ
column. Gradient from 0 % acetonitrile in 0.05
triethylamine acetate (TEEAAc) to 100 %
111
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system
acetonitrile in 0.05 TEEAAc was used at pH
7.5, 40°С, 0.15 ml/min and 3.9 MPa.
Results and Discussion
Synthesis of 756 bp DNA duplexes was per-
formed using PCR. To ensure the specificity
and productivity of the synthesis of the target
product, the conditions for PCR were opti-
mized: the time of each stage of the cycle was
determined, the optimal composition of the
buffer, the concentration of dNTP and primers
were selected.
A modified analogue of nitrogenous bases -
exo-N-{2-[N-(4-azido-2,5-difluoro-3-chloro-
pyridin-6-yl)-3-aminopropionyl]aminoethyl}-
deoxycytidinine (Fap-dC, Fig. 1A) was used
as one as the model lesion. Extended (756 bp)
Fap-dC-DNAs were obtained by adding the
Fap-dCTP (up to 5, 10, 20, 40, 80, and 160 μM)
to the reaction mixture during PCR (Table 2).
In addition to the 756 bp Fap-dC-DNA
containing different number of modified nu-
cleotides and non-modified DNA of the same
length and sequence, 137 bp nAnt-DNA
(Fig 1B) was obtained.
Table 2. DNA obtained using the PCR and
modified triphosphate.
DNA formal name The concentration of Fap-dCTP in the
reaction mixture during PCR, μM
nm DNA 0
5-Fap-dC-DNA 5
10-Fap-dC-DNA 10
20-Fap-dC-DNA 20
40-Fap-dC-DNA 40
80-Fap-dC-DNA 80
160-Fap-dC-DNA 160
It was previously shown that nAnt is ef-
fectively removed by proteins of the NER
system from model DNA in vitro [12, 19]. The
properties of nAnt-DNA as a NER substrate
allow us to use it in our study for estimation
of NER activity in vitro.
To assess the ability of model DNAs to
suppress the activity of the NER system, the
influence of such DNA on NER efficiency in
vitro was studied. The efficiency of excision
was estimated using extracts of human cervical
cancer cells C33A. The incubation of 20 nM
137 bp nAnt-DNA with cell extracts was car-
ried out in [the] presence or absence of 3 nM
756 bp competitive DNA. Non-modified DNA
(nm DNA) or DNA containing the Fap-dC
groups was used as a competitive DNA. The
products of the specific excision obtained dur-
ing the reaction were analyzed in 10 % PAAG
under denaturing conditions.
It was found that Fap-dC-containing DNA
effectively suppresses the excision of bulky
lesion from nAnt-containing DNA. The ob-
served decrease in the relative efficiency of
nAnt excision was 50–80 %, depending on the
concentration of Fap-dCTP used in the synthe-
sis of Fap-dC-DNA (Fig. 2). The greatest effect
was observed in the experiment, where 40-Fap-
dC-DNA was used as a competitor (Fig. 2A,
line 6). Thus, this DNA structure can be con-
sidered as DNA with unrepairable damage,
which most effectively inhibits the activity of
the NER system.
To estimate the number of modified nucle-
otides included in 756 bp DNA during PCR,
40-Fap-dC-DNA was enzymatically hydro-
lyzed using “DNA Degradase” kit.
The resulting mixture of mononucleotides
was analyzed by high performance liquid chro-
matography (HPLC) with chromatograph
Milichrom A-02 and ProntoSIL-120-5-C18 AQ
column. Modified Fap-dC nucleotide has sig-
112
A. Popov, A. Evdokimov, N. Lukyanchikova et al.
nificantly higher retention time in the condi-
tions used, so it was possible to calculate the
corresponding peak area precisely. The peak
areas corresponding to unmodified nucleotides
were also calculated. Taking into account the
values of extinction of nucleotides at the used
wavelength, the amount of the modified nu-
cleotide in the resulting mixture was estimated.
It was found that hydrolyzate, and, conse-
quently, the 40-Fap-dC-DNA contains approx-
imately one modification per 20 non-modified
nucleotides. The ratio of the modified to non-
modified triphosphates in the reaction mixture
during PCR was also 1:20. Thus we can con-
clude that the modified dC is incorporated into
the DNA during DNA synthesis catalyzed with
Taq DNA polymerase with high efficiency
matching the efficiency of unmodified dCTP
incorporation. The results are consistent with
the data obtained in the study of the substrate
properties of Fap-dCTP in another incorpora-
tion reaction – the reaction catalyzed by DNA
polymerase β [21].
For the ability of model DNA to bind repair
factors, not only the DNA sequence is crucial
[24], but also the spatial organization of the
DNA fragment in the damaged region [25–27].
According to our previous studies, Fap-dC
lesion incorporated into DNA significantly
affects the double-stranded structure of DNA.
The long and flexible linker enables intercala-
tion of the fluoroazido-pyridyl ring into the
DNA helix. It results in stacking this residue
with the purine rings of the opposite dG, and
no destabilization of the regular DNA duplex
structure was found at the damaged site. The
destabilized helical element is located on the
3′ side of the lesion [19]. Considering the
Fig. 2. A — NER dual incision activity of C33A cell extract on nAnt-DNA, detected after 40 min incubation of model
DNAs with cell extract. Reaction mixtures containing 20 nM nAnt-DNA were incubated with C33A cells extract for
40 min at 30°C in the absence (lane 1) or presence of 3 nM competitive DNA (lane 2 – non-modified duplex, lane 3 –
5-Fap-dC-DNA, lane 4 – 10-Fap-dC-DNA, lane 5 – 20-Fap-dC-DNA, lane 6 – 40-Fap-dC-DNA, lane 7 – 80-Fap-dC-
DNA, lane 8 – 160-Fap-dC-DNA). M – markers of DNA length (nt, nucleotide), the lengths of the marker DNAs are
given on the right. B — The dependence of relative efficiency of the NER on the type of competitive DNA. Maximum
product accumulation was taken as unit and was detected for nAnt-DNA incubated with cell extract for 40 min. Each
experiment was performed three times, error bars indicate standard deviation of the relative NER efficiency at each
experimental point.
A B
113
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system
previously obtained data and the calculated
number of the modified groups into model
DNA, we can assume the possible location of
Fap-dC and the destabilization caused by le-
sions in Fap-dC-DNA. We assume that the
ratio of modified to non-modified nucleotides
into 756 bp DNA under 1:20 allows the forma-
tion of several separate sites of DNA structure
destabilization (Fig 3A). Such destabilization
sites can be recognized by repair factors, such
as XPC-HR23B, increasing their affinity for
this type of structure. Being bound in unpro-
ductive complexes with Fap-dC-DNA, repair
proteins can no longer participate in reparative
processes. The copy number of NER proteins
in the cell, and hence in cell extracts, is rela-
tively small [28, 29]. Therefore, even a small
amount of the extended DNA is sufficient to
significantly suppress the activity of NER.
An increase in the ratio of modified to non-
modified nucleotides in the DNA composition
up to 1:20 leads to the appearance of the ad-
ditional binding sites for repair factors, and
hence to a more pronounced suppression of
the NER activity. But a further increase in the
number of modified groups leads to the inter-
ference of areas of the regular double-stranded
structure destabilization (Fig. 3B). The ques-
tion of the spatial organization of such DNA
needs additional research. However, it can be
assumed that significant distortions of the ge-
ometry and structure of the DNA duplex in this
case interfere with their recognition as a NER
substrate, and prevent the binding of repair
factors with such model DNA.
The model DNAs with unrepairable lesions
that can inhibit NER with high efficiency are
of considerable interest. It is known that the
main drugs used in the treatment of malignant
tumors are cytostatics. Such drugs are able to
disrupt the structure of the DNA in the cell,
which leads to the activation of damage repair
A
B
Fig. 3. Estimated patterns of duplex
structure destabilization in Fap-dC-
DNA. The low ratio of modified to
non-modified nucleotides presumably
leads to the formation of separate re-
gions of duplex structure destabiliza-
tion (blue rectangles), while high ratio
- to the formation of interfered regions
(red rectangles). The most probable
hydrogen bonds are also indicated:
bold lines represent the hydrogen
bonds occurring with more than 90 %
probability, thin lines – 50–90 %,
dashed line – 10–50 %.
114
A. Popov, A. Evdokimov, N. Lukyanchikova et al.
systems. In case of adequate regimens of treat-
ment and suitable cytostatic agent selection,
the tumor cells are eliminated as a result of the
induction of irreversible apoptosis or another
mechanism of elimination. In this regard, the
basis of successful treatment is the therapeutic
“competence” of the drug used and the number
of cytostatic molecules in the cell (the drug
dose). However the activity of the NER system
can eliminate the damage and reduce the ther-
apeutic effect of anticancer drugs [30, 31]. The
cytostatics with different mechanisms of action
are used in the world practice. These are drugs
that disrupt the DNA structure, and drugs that
induce intrastrand or interstrand crosslinks. In
all cases, if any of these lesions occur, a nu-
cleotide excision repair system is induced as
one of the earliest cell defense systems [32,
33]. If the damages have [been] detected and
the repair process has occurred, the amount of
damage per cell could decrease to [the] under-
therapeutic levels. A cancer cell has significant
genetic plasticity [34]. They are quite often
highly resistant for cytostatic actions and sur-
vive, increasing the chance of relapse.
Therefore, the DNA structures capable of ef-
fective inhibition of the activity of the NER
system can be considered as potential anti-
cancer drugs. The model DNA with bulky
unrepairable adducts could inhibit the repair
process by binding the key protein factors of
the NER system. In this regard, the presence
of model DNA with unreparable damage
should increase the cytotoxicity of anticancer
therapy based on the cytostatic agents, induc-
ing inter- and intrastrand crosslinks into cell
DNA, as well as the bulky lesions formation.
Thus, the results of our investigation can po-
tentially be used for design of DNA repair
inhibitors and potentially in the applied re-
search.
Conclusions
In the present report a new approach to the
synthesis of DNA with unrepairable lesions
was described. The obtained DNA structures
were shown to inhibit the nucleotide excision
repair in vitro. The DNA structure that inhibits
the NER with the highest efficiency was se-
lected for the further study and analyzed. The
suggestion concerning the possible connection
between the number of the modified nucleo-
tides introduced in the model DNAs and their
ability to inhibit the NER process was made.
The data obtained in this paper will be useful
for fundamental and medical research.
Funding
This study was supported by the Russian
Science Foundation (project №17-74-10086);
and Russian State funded budget project
V1.57.1.2, 0309-2016-0001.
REFERENCES
1. Gillet LC, Schärer OD. Molecular mechanisms of
mammalian global genome nucleotide excision re-
pair. Chem Rev. 2006;106(2):253–76.
2. Sugasawa K. Regulation of damage recognition in
mammalian global genomic nucleotide excision
repair. Mutat Res. 2010;685(1-2):29–37.
3. Volker M, Moné MJ, Karmakar P, van Hoffen A,
Schul W, Vermeulen W, Hoeijmakers JH, van Driel
R, van Zeeland AA, Mullenders LH. Sequential as-
sembly of the nucleotide excision repair factors in
vivo. Mol Cell. 2001;8(1):213–24.
4. Sugasawa K, Okamoto T, Shimizu Y, Masutani C,
Iwai S, Hanaoka F. A multistep damage recognition
mechanism for global genomic nucleotide excision
repair. Genes Dev. 2001;15(5):507–21.
115
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system
5. Hey T, Lipps G, Sugasawa K, Iwai S, Hanaoka F,
Krauss G. The XPC-HR23B complex displays high
affinity and specificity for damaged DNA in a true-
equilibrium fluorescence assay. Biochemistry.
2002;41(21):6583–7.
6. Tapias A, Auriol J, Forget D, Enzlin JH, Schärer
OD, Coin F, Coulombe B, Egly JM. Ordered con-
formational changes in damaged DNA induced by
nucleotide excision repair factors. J Biol Chem.
2004;279(18):19074–83.
7. DellaVecchia MJ, Croteau DL, Skorvaga M, Dezhu-
rov SV, Lavrik OI, Van Houten B. Analyzing the
handoff of DNA from UvrA to UvrB utilizing DNA-
protein photoaffinity labeling. J Biol Chem.
2004;279(43):45245–56.
8. Buterin T, Meyer C, Giese B, Naegeli H. DNA qual-
ity control by conformational readout on the undam-
aged strand of the double helix. Chem Biol.
2005;12(8):913–22.
9. Trego KS, Turchi JJ. Pre-steady-state binding of
damaged DNA by XPC-hHR23B reveals a kinetic
mechanism for damage discrimination. Biochemis-
try. 2006;45(6):1961–9.
10. Maltseva EA, Rechkunova NI, Petruseva IO, Sil-
nikov VN, Vermeulen W, Lavrik OI. Interaction of
nucleotide excision repair factors RPA and XPA with
DNA containing bulky photoreactive groups imitating
damages. Biochemistry (Mosc). 2006;71(3):270–8.
11. Petruseva IO, Tikhanovich IS, Chelobanov BP,
Lavrik OI. RPA repair recognition of DNA contain-
ing pyrimidines bearing bulky adducts. J Mol
Recognit. 2008;21(3):154–62.
12. Evdokimov A, Petruseva I, Tsidulko A, Koroleva L,
Serpokrylova I, Silnikov V, Lavrik O. New syn-
thetic substrates of mammalian nucleotide excision
repair system. Nucleic Acids Res. 2013;41(12):e123.
13. Khodyreva SN, Lavrik OI. Photoaffinity labeling
technique for studying DNA replication and DNA
repair. Curr Med Chem. 2005;12(6):641–55.
14. Rechkunova NI, Lavrik OI. Nucleotide excision
repair in higher eukaryotes: mechanism of primary
damage recognition in global genome repair. Subcell
Biochem. 2010;50:251–77.
15. Maltseva EA, Rechkunova NI, Gillet LC, Petruseva IO,
Schärer OD, Lavrik OI. Crosslinking of the NER da-
ma ge recognition proteins XPC-HR23B, XPA and RPA
to photoreactive probes that mimic DNA damages.
Biochim Biophys Acta. 2007;1770(5):781–9.
16. Krasikova YS, Rechkunova NI, Maltseva EA, Petru-
seva IO, Silnikov VN, Zatsepin TS, Oretskaya TS,
Schärer OD, Lavrik OI. Interaction of nucleotide
excision repair factors XPC-HR23B, XPA, and RPA
with damaged DNA. Biochemistry (Mosc). 2008;
73(8):886–96.
17. Krasikova YS, Rechkunova NI, Maltseva EA, Petru-
seva IO, Lavrik OI. Localization of xeroderma pig-
mentosum group A protein and replication protein
A on damaged DNA in nucleotide excision repair.
Nucleic Acids Res. 2010;38(22):8083–94.
18. Evdokimov AN, Petruseva IO, Pestryakov PE,
Lavrik OI. Photoactivated DNA analogs of sub-
strates of the nucleotide excision repair system and
their interaction with proteins of NER-competent
extract of HeLa cells. Synthesis and application of
long model DNA. Biochemistry (Mosc). 2011;
76(1):157–66.
19. Evdokimov AN, Tsidulko AY, Popov AV, Vorobiev
YN, Lomzov AA, Koroleva LS, Silnikov VN, Petru-
seva IO, Lavrik OI. Structural basis for the recogni-
tion and processing of DNA containing bulky le-
sions by the mammalian nucleotide excision repair
system. DNA Repair (Amst). 2018;61:86–98.
20. Evdokimov AN, Lavrik OI, Petruseva IO. Model
DNA for investigation of mechanism of nucleotide
excision repair. Biopolym Cell. 2014; 30(3): 167–83.
21. Dezhurov SV, Khodyreva SN, Plekhanova ES, Lav-
rik OI. A new highly efficient photoreactive analogue
of dCTP. Synthesis, characterization, and application
in photoaffinity modification of DNA binding pro-
teins. Bioconjug Chem. 2005;16(1):215–22.
22. Petruseva IO, Tikhanovich IS, Maltseva EA, Saf-
ronov IV, Lavrik OI. Photoactivated DNA analogs
of substrates of the nucleotide excision repair system
and their interaction with proteins of NER-compe-
tent HeLa cell extract. Biochemistry (Mosc).
2009;74(5):491–501.
23. Manley JL, Fire A, Cano A, Sharp PA, Gefter ML.
DNA-dependent transcription of adenovirus genes
in a soluble whole-cell extract. Proc Natl Acad Sci
U S A. 1980;77(7):3855–9.
116
A. Popov, A. Evdokimov, N. Lukyanchikova et al.
24. Kropachev K, Kolbanovskii M, Cai Y, Rodríguez F,
Kolbanovskii A, Liu Y, Zhang L, Amin S, Patel D,
Broyde S, Geacintov NE. The sequence dependence
of human nucleotide excision repair efficiencies of
benzo[a]pyrene-derived DNA lesions: insights into
the structural factors that favor dual incisions. J Mol
Biol. 2009;386(5):1193–203.
25. Krzeminski J, Kropachev K, Kolbanovskiy M, Ree-
ves D, Kolbanovskiy A, Yun BH, Geacintov NE,
Amin S, El-Bayoumy K. Inefficient nucleotide exci-
sion repair in human cell extracts of the N-
(deoxyguanosin-8-yl)-6-aminochrysene and 5-(de-
oxyguanosin-N(2)-yl)-6-aminochrysene adducts
derived from 6-nitrochrysene. Chem Res Toxicol.
2011;24(1):65–72.
26. Ding S, Kropachev K, Cai Y, Kolbanovskiy M, Du-
randina SA, Liu Z, Shafirovich V, Broyde S, Geacin-
tov NE. Structural, energetic and dynamic properties
of guanine(C8)-thymine(N3) cross-links in DNA
provide insights on susceptibility to nucleotide exci-
sion repair. Nucleic Acids Res. 2012;40(6):2506–17.
27. Mu H, Kropachev K, Wang L, Zhang L, Kolbanovs-
kiy A, Kolbanovskiy M, Geacintov NE, Broyde S.
Nucleotide excision repair of 2-acetylaminofluo-
rene- and 2-aminofluorene-(C8)-guanine adducts:
molecular dynamics simulations elucidate how le-
sion structure and base sequence context impact
repair efficiencies. Nucleic Acids Res. 2012;40(19):
9675–90.
28. Araújo SJ, Nigg EA, Wood RD. Strong functional in-
teractions of TFIIH with XPC and XPG in human
DNA nucleotide excision repair, without a preassem-
bled repairosome. Mol Cell Biol. 2001;21(7):2281–91.
29. Mu D, Hsu DS, Sancar A. Reaction mechanism of
human DNA repair excision nuclease. J Biol Chem.
1996;271(14):8285–94.
30. RRocha JC, Busatto FF, Guecheva TN, Saffi J. Role
of nucleotide excision repair proteins in response to
DNA damage induced by topoisomerase II inhibi-
tors. Mutat Res Rev Mutat Res. 2016;768:68–77.
31. Bowden NA. Nucleotide excision repair: why is it
not used to predict response to platinum-based che-
motherapy? Cancer Lett. 2014;346(2):163–71.
32. Clauson C, Schärer OD, Niedernhofer L. Advances
in understanding the complex mechanisms of DNA
interstrand cross-link repair. Cold Spring Harb Per-
spect Biol. 2013;5(10):a012732.
33. De Silva IU, McHugh PJ, Clingen PH, Hartley JA.
Defining the roles of nucleotide excision repair and
recombination in the repair of DNA interstrand
cross-links in mammalian cells. Mol Cell Biol.
2000;20(21):7980–90.
34. Sarasin A, Dessen P. DNA repair pathways and hu-
man metastatic malignant melanoma. Curr Mol
Med. 2010;10(4):413-8.
Нерепаровані аналоги субстатті ексцизійної
репарації нуклеотидів і їх застосування для
придушення активності цієї системи
О. О. Попов, А. М. Євдокимов,
Н. В. Лук'янчикова, І. О. Петрусева, О. І. Лаврик
У наших попередніх дослідженнях було показано, що
ДНК з об'ємним похідним Fap-dC є складнорепарова-
ним субстратом для системи ексцизійної репарації
нуклеотидів (Ерн). З'єднання такого типу можуть ста-
новити особливий інтерес як можливі селективні ін-
гібітори системи Ерн, значно знижуючи ефективність
репарації ДНК шляхом зв'язування білкових чинників,
залучених до даного процесу. Цей підхід може бути
потенційно корисний для підвищення ефективності
хіміотерапії. Мета. Дане дослідження спрямоване на
пошук ДНК-структур, що містять множинні об'ємні
аддукти, які з найбільшою ефективністю можуть при-
гнічувати активність системи. Методи. Фермен та тив-
ний синтез ДНК, ПЛР, приготування Ерн-компетентних
клітинних екстрактів, реакція вирізання, що каталізу-
ється білками Ерн in vitro, ВЕРХ. Результати.
Проведено підбір умов синтезу протяжних модельних
ДНК з множинним включенням нерепарованого по-
шкодження Fap-dC. Отримано ряд ДНК-структур, що
містить в своєму складі різну кількість модифікованих
ланок. Показано, що всі отримані ДНК пригнічують
активність системи Ерн in vitro. Обрана ДНК-
структура, яка пригнічує NER найбільш високою ефек-
тивністю. Висновки. Модельні ДНК з нерепаровани-
ми ушкодженнями, здатні високою ефективністю при-
гнічувати NER, можуть розглядатися в якості інгібіто-
рів системи Ерн. Виявлені в даній роботі закономір-
ності потенційно можуть бути використані для
117
Unrepairable substrates of nucleotide excision repair and their application to suppress the activity of this repair system
проведення як фундаментальних, так і прикладних
досліджень.
К л юч ов і с л ов а: репарація, Ексцизійна репарація
нуклеотидів, нерепаріруемие пошкодження ДНК, мо-
дельні ДНК-субстрати
Нерепарируемые аналоги субстатов
эксцизионной репарации нуклеотидов и их
применение для подавления активности этой
системы
А. А. Попов, А. Н. Евдокимов, Н. В. Лукьянчикова,
И. О. Петрусева, О. И. Лаврик
В наших предыдущих исследованиях было показано,
что ДНК с объемным производным Fap-dC является
труднорепарируемым субстратом для системы эксци-
зионной репарации нуклеотидов (ЭРН). Соединения
такого типа могут представлять особый интерес как
возможные селективные ингибиторы системы ЭРН,
значительно снижая эффективность репарации ДНК
путем связывания белковых факторов, вовлеченных в
этот процесс. Этот подход может быть потенциально
полезен для повышения эффективности химиотерапии.
Цель. Текущее исследование направлено на поиск
ДНК-структур, содержащих множественные объемные
аддукты, которые с наибольшей эффективностью мо-
гут подавлять активность системы. Методы: фермен-
тативный синтез ДНК, ПЦР, приготовление ЭРН-
компетентных клеточных экстрактов, реакция выреза-
ния, катализируемая белками ЭРН in vitro, ВЭЖХ.
Результаты: был проведен подбор условий синтеза
протяженных модельных ДНК с множественным вклю-
чением нерепарируемого повреждения Fap-dC.
Получен ряд ДНК-структур, содержащий в своем
составе различное количество модифицированных
звеньев. Было показано, что все полученные ДНК
подавляют активность системы ЭРН in vitro. Была
выбрана ДНК-структура, которая ингибирует NER
наиболее высокой эффективностью. Выводы: модель-
ные ДНК с нерепарируемыми повреждениями, спо-
собные высокой эффективностью подавлять NER,
могут рассматриваться в качестве ингибиторов систе-
мы ЭРН. Обнаруженные в настоящей работе законо-
мерности потенциально могут быть использованы для
проведения не только фундаментальных, но и приклад-
ных исследований.
К л юч е в ы е с л ов а: эксцезионная репарация ну-
клеотидов, нерепарируемые повреждения ДНК, мо-
дельные ДНК-субстраты.
Received 03.01.2019
|