Abstracts
Gespeichert in:
| Datum: | 2014 |
|---|---|
| Format: | Artikel |
| Sprache: | English |
| Veröffentlicht: |
Інститут молекулярної біології і генетики НАН України
2014
|
| Schriftenreihe: | Вiopolymers and Cell |
| Schlagworte: | |
| Online Zugang: | http://dspace.nbuv.gov.ua/handle/123456789/154614 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | Abstracts/ Вiopolymers and Cell. — 2014. — Т. 30, спецвипуск. — С. 1-23. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-154614 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1546142019-06-16T01:32:16Z Abstracts Materials of VIII annual Conference of Young Scientist of the Institute of Molecular Biology and Genetics NASU 2014 Article Abstracts/ Вiopolymers and Cell. — 2014. — Т. 30, спецвипуск. — С. 1-23. — англ. 0233-7657 http://dspace.nbuv.gov.ua/handle/123456789/154614 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Materials of VIII annual Conference of Young Scientist of the Institute of Molecular Biology and Genetics NASU Materials of VIII annual Conference of Young Scientist of the Institute of Molecular Biology and Genetics NASU |
| spellingShingle |
Materials of VIII annual Conference of Young Scientist of the Institute of Molecular Biology and Genetics NASU Materials of VIII annual Conference of Young Scientist of the Institute of Molecular Biology and Genetics NASU Abstracts Вiopolymers and Cell |
| format |
Article |
| title |
Abstracts |
| title_short |
Abstracts |
| title_full |
Abstracts |
| title_fullStr |
Abstracts |
| title_full_unstemmed |
Abstracts |
| title_sort |
abstracts |
| publisher |
Інститут молекулярної біології і генетики НАН України |
| publishDate |
2014 |
| topic_facet |
Materials of VIII annual Conference of Young Scientist of the Institute of Molecular Biology and Genetics NASU |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/154614 |
| citation_txt |
Abstracts/ Вiopolymers and Cell. — 2014. — Т. 30, спецвипуск. — С. 1-23. — англ. |
| series |
Вiopolymers and Cell |
| first_indexed |
2025-07-14T06:39:36Z |
| last_indexed |
2025-07-14T06:39:36Z |
| _version_ |
1837603411192709120 |
| fulltext |
1
USP1 as a potential partner of Bcr-Abl oncoprotein
S. V. Antonenko, G. D. Telegeev
s.antonenko999@yandex.ua
Bcr-Abl protein is a result of reciprocal translocation between chromosomes 9 and 22.
There are three Bcr-Abl chimeras known so far: p190, p210 and p230. The variant p210
causes the development of chronic myeloid leukemia. It is distinguished by the presence of
PH and DH domains. Based on mass spectrometry analysis, the ubiquitin specific protease 1
(USP1), which is a potential candidate for interaction with the PH domain of Bcr-Abl
oncoproteins, has been identified. USP1 belongs to the group of cysteine proteases and acts as
a deubiquitinating enzyme. USP1 consists of three domains: two intracellular peptidases and
ubiquitin carboxyl-terminal hydrolase. Bcr-Abl degrades in proteosomal way because of the
presence of NH2-ubiquitination site at the end of Bcr fragment. We suggest that USP1 may
prevent Bcr-Abl from degradation in proteosomes by deubiquitination, which in turn might
lead to the accumulation of the protein and disease progression. Thus, inhibiting USP1 can
contribute to the rapid destruction of Bcr-Abl in proteosomes and prevention of its
accumulation in cell.
Aim: to create recombinant genetic constructs in order to study the role of USP1 in
proteosomal degradation of Bcr-Abl.
Materials and methods. For amplification of USP1 fragment the following
oligonucleotide primers have been chosen: USP1 fwd
(AATTGCCTGGTGTCATACCTAGTG) and USP1 rev
(GAGAGACCAATAATATCCAGTAGC). Genetic construct pCMV-XL5-USP1 (obtained
from the Department of Molecular Genetics' bank, IMBG) has been used as the matrix
plasmid. The components of PCR conditions were set according to the manufacturer's
instructions (Thermo Scientific). We cloned the USP1 gene into vector pUC18 by Sma1 site.
Then the USP1 gene was cut from pUC18-USP1 at the KpN1 and EcoRI restriction sites and
subcloned to pCMV-HA and pECFP C-3-USP1. To check the availability and orientation of
the insert the following analytical methods were used: restriction, PCR.
Results. PCR sequence of USP1 was amplified with expected size (2343 bp). After
ligation reaction the pUC18-USP1 genetic construction was obtained. Then, after subcloning
pCMV, the HA-USP1 and pECFP C-3 constructs for mammalian expression were obtained.
The identity of obtained pUC18-USP1, pCMV HA-USP, pECFP C-3-USP1 to the expected
results, namely the absence of mutation, the correct reading frame, was confirmed by PCR
and restriction.
Conclusions. 1. The ubiquitin specific protease 1 is a potential candidate for
interaction with the Bcr-Abl protein. The activity of the USP1 protein may contribute to the
accumulation of oncoproteins in the cell that affects the disease progression.
2. We created pUC18-USP1 bearing the USP1 gene. We have made pCMV HA-USP1
and pECFP C-3-USP1 constructs which will be used for the mammalian expression of USP-1.
3. Protein expressed from these constructs will be used for studying the Bcr-Abl – USP-1
interaction and subsequent experiments.
2
Novel L-lactate conductometric biosensor based on lactate
dehydrogenase/pyruvate oxidase/NAD+-modified interdigiated platinum
electrodes
D. H. Chan, Y. I. Korpan
deni_chan_1990@yahoo.com
Aim. Development and evaluation of the conductometric biosensor with a bi-
enzyme membrane for sensitive and selective detection of L-lactic acid.
Methods. Conductometry, drop coating, cross-linking.
Results. We propose and report conductometric L-lactate selective conductometric
sensor based on lactate dehydrogenase (LDH)/pyruvate oxidase (PyrOx)/NAD+ bio-selective
membrane (BSM), fabricated using enzymes Layer-by-Layer drop coating and cross-linking via
glutaraldehyde vapors. L-lactate oxidation via LDH- and PyrOx-catalysed reactions, resulting in
the charged ions (acetate, H+ and HCO3
−) generation and causing the conductivity increase in the
BSM, is the basis of this work. The dependency of the developed biosensor output signals on pH
and buffer concentration as well as operational/storage stability and selectivity/specificity were
investigated. The limit of detection for L-lactate, calculated as three times the signal to noise
ratio, was equal to 0.025 mM.
Conclusions. An original and sensitive conductometric biosensor based on LDH and Pyr-
Ox enzymes with excellent electrochemical properties was developed for L-lactate determination
in model samples.
3
Investigation of intramolecular dynamics and conformational changes of
eukaryotic tyrosyl-tRNA synthetase in complexes with substrates
S. V. Chysta, A. I. Dragan, A. I. Kornelyuk
4istaya_sophia@mail.ru
Tyrosyl-tRNA synthetase (TyrRS) is one of the key enzymes of protein biosynthesis,
which catalyzes specific aminoacylation of the homologous tRNATyr. Mammalian TyrRS
consists of two structural modules: the N-terminal catalytic module (mini-TyrRS) and C-terminal
cytokine-like module (C-module). Local conformational changes of the TyrRS contribute to the
enzyme functioning, but their nature and specific role have not been studied yet. The mini-
TyrRS contains three tryptophan residues (Trp40, Trp87, Trp283) which could serve as intrinsic
probes sensitive to the enzyme structure. This, in turn, allows investigation of the mini-TyrRS
intramolecular dynamics and monitoring local conformational transitions in the protein structure.
The aim of this work was to study dynamic aspects of mini-TyrRS functioning and
characterization of local conformational changes due to the enzyme/substrate interaction.
Methods. Recombinant proteins were obtained by bacterial expression in E.coli
BL21(DE3)pLysE using standard methods. The fluorescence spectroscopy has been used to
explore the intramolecular dynamics of the mini-TyrRS in solution and study conformational
changes of the isolated protein. The visualization and analysis of the Trp residues local
environment have been performed using the PyMOL 1.3 program.
Results. According to our analysis the Trp residues of the mini-TyrR are partially
solvent-exposed. The ratio of the solvent accessible surface area (ASA) of the Trp side-chain in
the native protein to the ASA in the "random coil" state for Trp40, Trp87 and Trp 283 is 8.8%,
62.1%, 56.6%, respectively. We also characterized the microenvironment of Trp40, Trp87 and
Trp283 in the 5 Å layer around the Trp residues. The computational analysis has shown that
there are seven residues in the region of Trp40: five hydrophobic and two hydrophilic residues;
seven residues in the region of Trp87: five hydrophobic and two negatively charged (Glu88,
Glu91) residues; six residues in the vicinity of Trp283: three negatively charged (Asp280,
Glu281, Asp308), and two positively charged (Arg279, Lys282).
To characterize properties of the tryptophans environment in the mini-TyrR we employed
fluorescence quenching by three quenchers: neutral molecule (acrylamide), I- anion (KI salt) and
Cs+ cation (CsCl salt). The quenching constants, Ks-v, were calculated from the slope of Stern-
Volmer plot and for mini-TyrRS they are: 13.22±0.5 M-1, 6.26±0.2 M-1, 3.75±0.2 M-1 for
acrylamide, I- and Cs+, respectively; while for free L-tryptophan the Ks-v constants are
16.37±0.01 M-1, 12.94±0.01 M-1, 2.87±0.01 M-1, respectively. The relative quenching
efficiencies (RQE) of mini-TyrRS fluorescence as compared to free L-Trp are 80% for
acrylamide, 48% for I-, and 129% for Cs+.
Conclusions. Fluorescence quenching of mini-TyrRS demonstrates that all three Trp
residues are accessible for the used quenchers, which is supported by our computational ASA
analysis. The protein fluorescence quenching curves are linear, which means that quenching of
fluorescence is a dynamic process. The enhanced relative fluorescence quenching efficiency of
Cs+ cations and decreased RQE of I- anions could be explained by negatively charged
surrounding of some Trp residues in the protein structure, which can attract the cationic and
repulse anionic quenchers. This assumption corroborated by our computational analysis data
indicated that the microenvironment of at least two Trp residues contains electronegative
residues in the vicinity: Trp87 (Glu88, Glu91) and Trp283 (Asp280, Glu281, Asp308).
Interestingly, the residues in a static protein structure are tightly packed, however the RQE of
acrylamide is high, RQE=80%. The observed high efficiency of quenching, i.e. an ability of
acrylamide molecules to penetrate deep into the protein structure could be a result of quite large
dynamic fluctuations of the mini-TyrRS structure.
4
Cloning murine interferon alpha in E.coli and optimization of its output in the
soluble form
V. Dotsenko, M. Obolenskaya
dotsdon@gmail.com
Background: Interferon alpha (IFNα) is a cytokine with antiviral, antiproliferative and
immunomodulatory activities. It is widely used in the treatment of viral hepatitis and
hematological malignancies. Despite its efficiency it has side effects of unknown mechanism like
depression, headache, fever, myalgia etc. The bioinformatical genome-wide search for target
genes of IFNα conducted in our lab has revealed three new genes encoding the proteins of
nervous synapses. We suggest the involvement of these genes in the development of side effects
of IFNα and intend to verify this idea.
Aim of the study: to clone the murine IFNα gene and express the protein in the sufficient
amount for in vitro and in vivo experiments.
Methods: The amplified coding sequence of mIFNα, type 11 (BC116870) was inserted in
the expression plasmid pET-24a(+) downstream of the IPTG–induced T7 promoter and cloned in
Rosetta (DE3) E.coli cells. The basic cultivation medium: 30mM NaCl, 7 mM NH4Cl, 9 mM
MgSO4, 0,5% w/v Yeast Extract, 1,1% w/v Tryptone, 0,2% w/v Glycerol. The basic lysis buffer:
25 mM HEPES pH 7.0, 500 mM NaCl, 10% w/v Glycerol, 0.025% w/v NaAzide, 0.5% w/v
CHAPS, 10 mM MgCl2. To optimize the output of soluble mIFNα11 the fractional factorial
design 27-4 with resolution IV was applied. The effect of seven variables: T C of cultivation (25
– 37 C), pH of the medium (6.8 – 7.4), concentration of glucose (0 – 1% w/v), trehalose (0 –
200 mM) and glycine (0 -200 mM) in the medium and glycine (0 – 200 mM) and CTAB (0 – 1%
w/v) additives in the lysis buffer was explored. The amount, identity and proper folding of the
soluble IFNα were controlled by 12% SDS–PAGE and the resistance of the Gasser’s ganglion
cells to the vesicular stomatitis virus. The statistical analysis was carried out in the R statistical
software (R version 2.8.0, http://www.rproject.org). The significant effect was considered at
p0.05.
Results: The IFNα output in dependence of seven variables may be described by
multiple regression model y=A+B·x1+C·x1
2+D·x2+E·x3+F·x5+G·x6+H·x7 with R2=0.91, where x1
- x7 – tested variables, A - H – the corresponding effect. The statistically significant influence on
the output had T C of cultivation and the concentration of three carbohydrates in the medium
while the optimal ones were 200 mM glycine added to the basic medium and cultivation at 25°C.
A 19 kDa protein similar to mature mIFNα11 was identified in the initial homogenate and
supernatant; both revealed a specific antiviral activity; the yield of the soluble mIFNα11 was 20
mg/L.
Conclusions: The fractional factorial design for optimization of the recombinant protein
output is a useful approach saving the time and cost of experiment. The pET-24a(+)–mIFNα11
recombinant is a promising construction for mIFNα11 output in the soluble form and in
appropriate amount for in vitro and in vivo experiments.
5
New approaches for inferring gene regulatory network and their application
A. Frolova
fshodan@gmail.com
Introduction. The gene regulatory network (GRN) reflects the interaction between its various
elements, genes or proteins, and provides the most complete information on the regulation of cell
functioning. The significant problems the scientists encounter are an accuracy of reconstruction
together with validation and computational complexity of the GRN inference, which means that
the time required to reconstruct GRN increases very quickly as a size of the data grows. Though
various formalisms are already proposed to reconstruct GRN the main challenges still remain.
Aim was to improve the accuracy of inference algorithms by applying ensemble method and to
validate obtained results using synthetic data based on the biological networks topology.
Results. The network inference methods have complementary advantages and limitations in
different contexts, which suggests that combining the results of multiple inference methods could
be a good strategy for improving predictions.
We studied different ways how to combine graphs (union, intersection) as well as edge scores
and how particular combinations affect the validation of the resulting networks. In order to get
reconstructed networks we used different inference software. One of such softwares is BNFinder
– a tool for inferring optimal Bayesian networks, which has been already successfully applied
not only to the reconstruction gene regulatory networks, but also to the linking expression data
with sequence motif information, identifying histone modifications connected to the enhancer
activity and to the predicting gene expression profiles of tissue-specific genes. As a result we got
a new parallel version of BNFinder, which we successfully tested in the Ukrainian GRID
infrastructure.
In addition to BNFinder we used MiNET R package, which implements information-theoretic
approaches to the infer gene regulatory networks: ARACNE, MRNET, MRNETB, CLR. Test
dataset, it provides, contains 100 samples and 50 genes generated by the publicly available
SynTReN generator using a yeast source network. Complementary to this validation of
algorithms we used the expression profiles with corresponding golden networks provided by
DREAM initiative - a Dialogue for Reverse Engineering Assessments and Methods. The
topologies of networks we used are generated by extracting modules from the known in vivo
gene regulatory network structures such as those of E.coli and S.cerevisiae.
The best result was obtained by the combination of two different algorithms – BNFinder and
MRNET. The characteristics of this combination (AUROC - area under receiver operating
characteristic and AUPR - area under precision recall) appeared substantially better than those of
each specified methods and their combinations.
Conclusion. Here we present the results of this study with the best-scored ensemble method –
undirected graph union with linear combination of scores.
6
Discovery and characterization of N-phenylthieno[2,3-d]pyrimidin-4-amines
as inhibitors of FGFR1
A. A. Gryshchenko, V. G. Bdzhola, A. O. Balanda , N. V. Briukhovetska, I. M. Kotey, T. P.
Ruban, L. L. Lukash, S. M. Yarmoluk
a.a.grischenko@imbg.org.ua
Aim. Fibroblast grow factor receptor 1 (FGFR1) is an important anti-cancer target that
plays crucial role in oncogenesis and oncogenic angiogenesis. FGFR1 has been shown to be
frequently amplified or overexpressed in various cancers, including breast, lung, prostate
cancers, myeloproliferative disorders. The role of FGFR1 in cancerogenesis makes it potential
therapeutic target for the treatment of cancers. Thienopyrimidine derivatives have been known as
protein kinase inhibitors. The aim of the present study was to develop thieno[2,3-d]pyrimidines-
based FGFR1 inhibitors and test their selectivity and antiproliferative activity.
Methods. The methods of the combinatorial synthesis, semiflexible docking, γ-32P-АТP
assay and MTT tests were used in this work.
Results. A series of 33 thieno[2,3-d]pyrimidines derivatives have been synthesized and
their biological activities as inhibitors of FGFR1 kinase were evaluated. The SAR study showed
that substitutions with phenyl in the 5- or 6- positions of the thienopyrimidine heterocycle and
substitutions with metahydroxyl group in N-phenyl ring increased the FGFR1 inhibition activity.
Molecular modeling studies revealed important structural features of thieno[2,3-d]pyrimidines
for binding affinities towards FGFR1 kinase domain. The most active compounds were 3-({6-
phenylthieno[2,3-d]pyrimidin-4-yl}amino)phenol and 3-({5-phenylthieno[2,3-d]pyrimidin-4-
yl}amino)phenol (IC50 0.16 and 0.18 µM respectively). These compounds displayed a good
selectivity profile against a panel of 6 kinases. These active FGFR1 inhibitors have also
antiproliferative activity in human myeloma cell line KG1 with GI50 26.2 and 16.2 µM
respectively.
Conclusions. Thieno[2,3-d]pyrimidines derivatives were discovered as potent and
selective FGFR1 kinase inhibitors with anticancer activity. The obtained results can be used in
further development of FGFR1 inhibitors.
7
Role of cytoskeletal reorganization in BCR/ABL-induced signaling pathways.
D. S. Gurianov, G. D. Telegeev
dmitriy.gurianov@gmail.com
Background. Cytoskeleton reorganization is one of the ways, in which the cell
coordinates its architecture with the signaling pathways. BCR protein is involved in the
membrane stretching and following cytoskeleton changes during axon guidance. The presence of
DH and PH domains in the BCR is important for this purpose. The first one has GTPase activity
which is necessary for the molecular switching and the second one is known for its lipid-binding
activity and involvement in cytoskeleton reorganization. However, little is known about a
specific role of the PH domain of BCR, and how it acts as a part of BCR/ABLp210, the fusion
protein with constitutive tyrosine-kinase activity that is a triggering factor for the chronic
myeloid leukemia development. Previously D. Miroshnichenko et al. showed that it is able to
bind several proteins from K562 lysate, that are a part of the cytoskeleton or involved in its
reorganization.
Aim. The aim of our research was to verify whether the PH domain of BCR interacts
with cortactin and keratin 10.
Methods. For recombinant protein expression, the genetic constructs from previous study
were used. Specifically, pcDNAhisMaxC-PH and pECFP-CTTN were used for PEI transfection
of 293T cells. For bacterial expression, pET32a-PH, pGEX4T2-CTTN, and pGEX4T2-KRT10
were employed. The sequences of PH domain and KRT10 were expressed using IPTG induction
at 220C, and the sequence of CTTN was expressed at 370C using autoinduction according to
Strudier et al. The affinity purification of his-tagged PH was done with Ni-NTA agarose, the
GST-tagged KRT10 and CTTN were purified using glutathione sepharose. A theoretical chance
of protein solubility in E.coli was calculated according to the logistic regression model of Diaz
and Harrison. The expression and purification efficiency of his-tagged PH domain and GST-
tagged KRT10 and CTTN was estimated by PAGE and Western-blot. The expression of ECFP-
CTTN was estimated by the wide-field fluorescent microscopic analysis.
Results. Western-blot confirmed the efficient purification of PH domain from E.coli
lysate, and expression of PH in 293T cell line. The efficiency of purification of GST-CTTN from
E.coli lysate was confirmed by PAGE and Western Blot. The expression of ECFP-CTTN was
confirmed, it is localized predominantly at the cell periphery. GST-KRT10 was insoluble when
expressed in E.coli despite the optimization of expression temperature, E.coli strain, additives to
lysis buffer and growth media. A theoretical chance of GST-KRT10 insolubility in E.coli is 95%.
Conclusions. The obtained recombinant GST-cortactin and his-PH can be used for far-
Western blot analysis of a possible protein-protein interaction. The localization of ECFP-CTTN
indicates its possible role in the cytoskeleton-membrane reorganization. A partial expression of
KRT10 in E.coli is a strategy to overcome insolubility. Co-immunoprecipitation of his-PH and
ECFP-CTTN may be performed to determine the presence or absence of interaction inside the
cell.
8
Gene expression signature for glioblastoma subtypes and participation of
CHI3L1 gene in malignant transformation
A. Iershov
yklsorok@gmail.com
Aim. Glioblastoma is the most aggressive intracranial malignancy characterized by high
invasiveness, recurrence, and poor response on chemo- and radiotherapy. Heterogeneous
character of glioblastoma eliminates the value of single molecular markers. Data from high-
throughput gene expression analysis allows to identify characteristic gene expression profiles
(signatures), associated with specific tumor properties, that could be used in clinics for diagnosis
and prognosis. «Mesenchymal» subtype of gliobastoma is characterized by overexpression of the
set of genes, and among them the gene, encoding chitinase-3-like protein 1 (CHI3L1), involved
in abnormal cell proliferation and tumor angiogenesis. Clarification of the mechanisms of
CHI3L1 regulation and structure-functional characterization of the protein could shed light on
the process of malignant transformation.
Methods. We used cluster analysis and self-organizing map approach using data on gene
expression to search for glioblastoma intratumor differences. To study regulation of CHI3L1
level by p53, we overexpressed TP53 in U87 glioblastoma cell line, treated U87 cells with
resveratrol to activate p53 pathway or sirtinol to increase p53 stability. We used homology
modeling and site-directed mutagenesis to detect regions of CHI3L1, responsible for the cell
growth in soft agar.
Results. Distribution of glioblastoma on two subgroups on the basis of the expression of
416 genes, selected in our work, could represent two routes of glioma development, leading to
the formation of the subtype with increased expression of either «proliferative» or «proneural»
genes. Ectopic expression of TP53 in glioblastoma U87 cells led to decreased CHI3L1 protein
level. This effect was also achieved either by activation of p53 by antitumor agent resveratrol or
by inhibiting p53 degradation mediated by sirtuin SIRT1, using specific inhibitor sirtinol. To
study structural peculiarities of CHI3L1, we compared 3D structures of CHI3L1 and its closest
homolog CHI3L2, and showed the presence of unique positively charged amino acid cluster 144-
RRDKQH-149, located on the protein surface of CHI3L1. Site-directed mutagenesis of potential
CHI3L1 heparin-binding region revealed that residues Arg144, Arg145, and Lys147 are crucial
for the binding. Soft agar assay demonstrated that mutation in heparin-binding site significantly
decreased colony formation efficiency after stable transfection of 293 cells.
Conclusions. We demonstrated the existence of «proliferative» and «proneural»
glioblastoma subtypes, that could be determined on the basis of the expression of 416 genes. As
p53 was found to decrease CHI3L1 expression in glioblastoma cells, inactivation of p53 in
tumors could lead to the overexpression of CHI3L1, and, consequently, increase CHI3L1-
mediated pathological effects, such as abnormal cell proliferation and angiogenesis. CHI3L1 can
enhance malignant properties of 293 cells after its ectopic expression, and its heparin-binding
site can be responsible for substrate-independent cell growth.
9
Characteristics of new spliced isoform of ribosomal protein S6 kinase 1 –
S6K1Δ15
O. M. Klipa, O. M. Garifulin, L. O. Savinska, V. V. Filonenko
klipa_olga@mail.ru
The ribosomal proteins S6 kinases (S6K1 and S6K2) are members of the PI3/Akt/mTOR
pathway and play an important role in the transcription, translation, cell growth/size and
metabolism. Recently, the link between expression of S6K1 splicing isoform-2 (p31) and
oncogenic transformation of cells has been reported (Karni 2007, 2013). We have identified
another spliced isoform of S6K1 with a deleted last exon (called S6K1∆15) and confirmed its
expression in cell lines and tissues at mRNA level.
The Aim
To examine oncogenic activity and place of S6K1∆15 in PI3K/mTOR/S6K signaling
pathway as well as to determine its subcellular localization.
Methods
The investigation was performed on model HEK293 cells with stable expression of
S6K1∆15. To define subcellular localization of S6K1∆15 we used immunofluorescent
microscopy and nuclear/cytoplasm fractionation. The proliferative activity and viability under
serum starvation were examined by MTT and LDH tests respectively. Soft agar assay with
subsequent data estimation using Image J software has been used to evaluate anchorage-
independent cell growth. To determine the signaling activity of S6K1∆15 we analyzed an effect
of rapamycin (specific inhibitor of mTOR) treatment and serum starvation on phosphorylation of
S6K1 and its substrate - S6 protein by Western blot in cells expressing S6K1∆15.
Results
No significant impact of S6K1∆15 overexpression on proliferative activity of cells was
found. However, the expression of studied S6K1 isoform caused an increase in cell viability
under serum starvation compared to the control cells (transfected by empty vector). The
efficiency of colony formation of the cells overexpressing S6K1∆15 was slightly higher (15.4%)
than the control cells (12.7%) but the size of colonies formed by the cells overexpressing the
spliced isoform was smaller than in control. Using cells fractionation we determined that the
major part of recombinant protein S6K1∆15 was located in cytoplasm. Additionally, the
inhibition of nuclear export by leptomycin B, did not lead to the accumulation of S6K1∆15 in
nucleus. However, according to the data of IF microscopy, S6K1∆15 was detected in both
cytoplasm and nucleus. Unexpectedly, we found that the phosphorylation of T389 S6K1∆15 was
not sensitive to the rapamycin treatment or serum starvation as opposed to the full-length forms
of S6K1. At the same time the phosphorylation of S6 protein remained sensitive to rapamycin
and starvation despite the presence of phosphorylated S6K1∆15.
Conclusions
S6K1∆15 did not show evident oncogenic activity, though it could slightly increase an ability
of cells to anchorage-independent growth and to survival under the serum starvation. The
regulation of S6K1∆15 and its activity toward a substrate had obvious differences in comparison
with well-known S6K1. The protein of S6K1∆15 is located preferably through the cytoplasm,
but existence of the nuclear pull cannot be excluded.
10
Colocalization of mTOR kinase and cytokeratins in the human
epithelial cells
V. Kosach, O. Cherednyk, V. Filonenko, A. Khoruzhenko
kosach.viktoriia@gmail.com
Background. Mammalian Target of Rapamycin (mTOR) is a serine/threonine protein kinase,
which integrates signals from hormones, growth factors, cytokines and nutrients. mTOR plays an
important role in multiple cellular events, such as protein biosynthesis, growth, proliferation and
survival. Nowadays, mTOR inhibitors are considered as perspective anti-cancer and anti-aging
drugs. It was shown that rapamycin inhibited migration and invasion of malignant cells, but the
mechanism of this phenomenon was not fully understood. For the first time we revealed and
clarified the colocalization of mTOR kinase and cytokeratins in the human epithelial cells.
Aim. Investigation and confirmation of the mTOR kinase colocalization with the cytokeratins.
Methods. Anti-N-terminal mTOR antibodies were generated in our laboratory and tested by
western blot and immunocytochemistry in the presence of the antigen polypeptide. Different
human epithelial cell lines, such as MCF-7, MCF-10A, HeLa, HepG2, A549, and also
histological sections of the normal and malignant human breast tissues were used in the research.
Colocalization of mTOR and intermediate cytokeratins was studied by double
immunofluorescent analysis and then visualized with confocal or fluorescent microscopy. To
verify interconnection of mTOR kinase and cytokeratins we performed co-immunoprecipitation
and proximity ligation assay (PLA).
Results. Earlier we revealed the strong colocalization of mTOR kinase and cytokeratins in the
human MCF-7 cell line using the anti-N-terminal mTOR antibodies, generated in our laboratory.
To confirm obtained data, we have shown that anti-N-terminal mTOR antibodies, specifically
recognized mTOR kinase in western blot and immunofluorescent analysis. To exclude the
possibility of cross reaction of the antibodies against N-terminus of mTOR and cytokeratins (№
4, 5, 6, 8, 10, 13, 18) the amino acid sequences of N-terminal region of mTOR (24-120 a.a.) and
every mentioned cytokeratins were compared using protein BLAST
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). There was no significant homology of compared
sequences. Confocal microscopy revealed colocalization of mTOR kinase and cytokeratins in a
set of human cell lines and epithelial cells of the human breast tissue samples. Also the use of a
series of the alternative fixation and permeabilization protocols did not alter the link between
mTOR kinase and keratins. Comparison of the anti-N-terminal mTOR antibodies, generated in
our laboratory, with commercially available ones have shown that both tested antibodies
recognized mTOR kinase at the fibrils of the intermediate filaments. Co-immunoprecipitation
revealed that different types of anti-mTOR antibodies precipitated keratins from lysates of MCF-
7 cells. Obtained data were also confirmed by PLA.
Conclusions. For the first time we discovered and confirmed the colocalization of mTOR
kinase and cytokeratins in the set of the human cell lines, normal and malignant breast tissue
samples.
11
Comparative analysis of immunophenotype and in vitro differentiation
potential of hematopoietic progenitors cells from fetal hematopoietic tissues
M. D. Kuchma1,2, V. A. Shablii1,2, V. M. Kyryk 3, A. N. Svitina 2, Yu. M. Shablii 2, Yu. K.
Prokopets2, T. M. Indichenko2, L. L. Lukash1, G. S. Lobyntseva2
Institute of Molecular Biology and Genetics National Academy of Science of Ukraine1,
Institute of Cell Therapy2,
State Institute of Genetics and Regenerative Medicine of National Academy of Medical Science
of Ukraine3, Kiev, Ukraine
kuchma@gmx.com
Aim. The aim of our study was to investigate the immunophenotype characteristics and
potential to differentiation in vitro of hematopoietic progenitor cells (HPCs) from placental
tissue in comparison with HPC from cord blood and fetal liver.
Methods. All tissues were received according to the women’s informed consent. Term
and fetal placental tissues were enzymatically digested, fetal liver was mechanically digested and
cells from all sourses were harvested for FACS analyses with the antibodies: anti-CD34, anti-
CD45, anti-CD45RA, anti-CD90, anti-CD31, anti-CD235, anti-CD7, anti-CD19, anti-СD33,
anti-CD14 (BD, USA). CFU analysis was performed with culture medium MethoCult (StemCell
Tech., Canada) and agar-containing medium.
Results. It has been shown that HPCs from placental tissue were characterized by
phenotypic heterogeneity unlike cord blood and fetal liver, namely they contain the populations
such as CD34+++CD45low/-, CD34++CD45low/- (very early progenitors that express CD133),
CD34+/lowCD45low/-, CD34++CD45+ and CD34+/lowCD45+ (late progenitors). Majority of HPCs
from placental tissue and umbilical cord blood remained uncommitted in contrast to fetal liver.
Placental tissue in compare to cord blood had higher amount of later myeloid
(CD34+CD45lowCD14+SSClow) and erythroid (CD34+CD45lowCD235+SSClow) progenitors,
tendency to higher content of T- lymphoid (CD34+CD45lowCD7+SSClow) progenitors and
similarities in the amount of myeloid (CD34+CD45lowCD33+SSClow) and B-lymphoid
(CD34+CD45lowCD19+SSClow) progenitors. Fetal liver had higher level of myeloid, T- lymphoid
and B-lymphoid progenitors in compare to placenta and cord blood and the same level of
erythroid progenitors. Placental HPCs have similar potential for differentiation in vitro in
comparison with cord blood HPCs as gave rise to BFU-E, CFU-E, CFU-M, CFU-G, CFU-GM
and CFU-GEMM. For the first time we have shown that umbilical cord blood and placental
tissue in addition to BFU-E and CFU-E contain high proliferative HPCs that give rise to the flat
erythroid colonies in semisolid mediums.
Conclusions. The investigation have shown the presence of HPCs in different stage of
differentiation and all types of lineage HPCs in placental tissue similarly to cord blood and fetal
liver. Such facts evidence that placental hematopoiesis continue during all term of gestation.
Placental tissue contains significantly lower number of lineage committed HPCs in compare to
fetal liver but significantly higher in compare to cord blood that makes placenta an attractive
source of HPCs for medicine.
12
Regulation of the O6-methylguanine-DNA methyltransferase (MGMT)
transcription by hormones
Z. M. Nidoieva, A. P. Iatsyshyna, L. L. Lukash
zarinanidoeva@i.ua
Aim. The human DNA repair enzyme O6-methylguanine-DNA methyltransferase
(MGMT) removes alkylation adducts from the O6-guanine in DNA, preventing point mutations
and cell death. On the other hand, it plays a crucial role in the resistance of cancer cells to
alkylating agents of chemotherapy. Combination of the chemotherapy and the hormone therapy
is widely-used for the treatment of many types of cancer. For example, glucocorticoids,
estrogens, progesterone and their antagonists are used during treatment of breast, endometrial,
kidney, brain and other cancers. Currently, little is known about effects of hormones on the
MGMT transcription. Only glucocorticoids (e.g. dexamethasone used in clinic) are known to up-
regulate the MGMT transcription and cause resistance to the alkylating chemotherapy.
Therefore, the aim of this study was to search hormone response elements (HREs) within
the human MGMT promoter.
Methods. We performed in silico analysis to predict HREs within the promoter region of
the human MGMT gene (acc. number at GenBank Х61657.1, 1157 bp). We used the JASPAR
Core database, as well Cister, LASAGNA-Search, MAPPER, NHR-scan, NUBIScan, Paint,
PROMO, PromoterScan, SignalScan, SiteGA, Tfscan, TFSEARCH and Tfsitescan programs.
We used the RT-qPCR assay to determine levels of mRNA coding for the human MGMT
protein in HEK293, Hep-2 and HepG2 cell lines after treatment with hormones. Nine
housekeeping genes (ACTB, B2M, GAPDH, 18S, TBP, TOP, HMBS, YWHAZ, RPLPO) were
used to detect the most suitable reference genes for each model. To select them obtained results
were analysed by NormFinder software (Andersen et al., 2004), as well as GeNorm algorithm
(VBA macros for Microsoft Excel and qbase+ software at Biogazelle). RPLPO and HMBS are
the most stable during cell treatment by estrogen.
Results. We predicted several novel HREs within the MGMT promoter, localization of
which was confirmed by two and more programs. Among them are such, which bind
homodimers and/ or heterodimers of steroid hormone receptors, including glucocorticoid
receptor, progesterone receptor, estrogen receptor, as well as thyroid hormone receptor-like
factors.
We confirmed two predicted by Harris and colleagues (Harris et al., 1991) glucocorticoid
responsive elements in positions 28-42 and 63-77 of Х61657.1, as well as predicted many novel
ones. Also, we revealed potential binding sites for progesterone and estrogen receptors.
Conclusions. Thereby, we predicted novel cis-regulatory HREs within the human MGMT
gene promoter using in silico analysis. To study their functional role in the regulation of this
gene transcription, we designed promoter constructs for the luciferase assay.
13
Recombinant CK2a and CK2α' subunits differ in their sensitivity to same
inhibitors
O. V. Ostrynska*, V. G. Bdzhola, O. P. Kukharenko and S. M. Yarmoluk
o.v.sovetova@gmail.com
CK2 is a serine/threonine protein kinase that have tetrameric structure consisting of two
regulatory (β) and two catalytic (α and/or α') subunits. Despite the similar enzymatic properties
of the last ones in experiments in vitro they have different localization in the cell and exhibit
differences in tissue-specific expression and function. It has recently been shown that CK2α and
CK2α' are involved in various pathological conditions independently of each other. [1].
Therefore, isoform-selective inhibitors of CK2 will be a significant tool for studying of
individual catalytic subunits role in cellular processes and its regulation.
Aim. The aim of our research is to evaluate of activity of protein kinase CK2
submicromolar inhibitors from different chemical classes towards its catalytic subunits.
Methods. Evaluation of activity of 19 potent CK2 inhibitors was carried out on the
previously obtained CK2α and CK2α´ recombinant proteins.
Results. The biochemical experiment shown the same compounds had different effect
on catalytic subunits. The most isoform-selective inhibitor was 4`-hydroxyflavone derivative
with IC50 = 0.020 μM (CK2α) and 0.003 μM (CK2α′). To explain this difference the complexes
of this compound with CK2α and CK2α´ ATP-binding site have been analysed with molecular
modelling methods.
Conclusions. Thus, obtained results can be used to further optimization and development
of CK2 isoform-selective inhibitors.
1. Litchfield DW. Protein kinase CK2: structure, regulation and role in cellular decisions
of life and death. Biochem. J. 2003; 369: 1-15.
14
Genes with altered expression in prostate cancer as putative biomarkers of
invasion and metastasis
E. E. Rosenberg, G. V. Gerashchenko, V. I. Kashuba
kalirra@mail.ru
Introduction: Prostate-specific antigen screening is used for prostate cancer diagnosis,
but there is a need for more specific biomarkers to distinguish dormant from metastatic tumors at
an early stage. Prostate cancer cell lines with different invasion and metastatic ability could be
valuable models for such investigations.
Aim: to find differentially expressed genes in prostate cancer cell lines with different
invasion and metastatic ability and in adenoma and prostate carcinoma as putative biomarkers of
cancer invasion and metastasis.
Methods: Q-PCR was used to analyze expression of 65 cancer-related genes in
androgen-dependent (AD) LNCaP and androgen-independent (AI) DU145, PC3 prostate cancer
cell lines compared to normal PNT2 cell line. Cancer PathFinder RT2 Profiler PCR array (84
genes) was used to determine difference in gene expression between LNCaP and PC3 cell lines.
NotΙ-microarray was used to examine gene expression in prostate adenoma and carcinoma
biopsy samples.
Results: Expression of 29 genes was changed in LNCaP cell line, 20 genes - in DU145
and 16 genes - in PC3 compared to PNT2. Most changes undergo genes of cell adhesion
(CDH1), invasiveness and metastasis (IL8, CXCL2), cell cycle control (P16, CCNE1). These
genes might be used to create diagnostic panels for invasive metastatic prostate tumors. 36 from
the 84 investigated genes have altered expression in PC3 compared to LNCaP. Genes involved in
angiogenesis (PDGF, TGFB1, THBS1), invasiveness and metastasis (MET, MMP1, PLAU), and
counteracting apoptosis (BCL2, BCL2L1) were over-expressed in PC3 cell line. Among them 7
genes (MET, MMP1, PLAU, SERPINE1, EPDR1, TGFB1, VEGFA) were selected for further
investigations in cancer invasion and metastasis. Genes for detection of prostate adenoma, AI
and AD carcinoma (BHLHE40, FOXP1, LOC285205, ITGA9, RBSP3) and discrimination
between prostate adenoma and carcinoma (FAM19A4, CAND2, MAP4, KY, LRRC58); AI and
AD carcinoma (LOC440944/SETD5, VHL, CLCN2, OSBL10/ZNF860, LMCD1) according to
obtained NotΙ-microarray data were selected.
Conclusions: Obtained results of gene expression in prostate cancer cell lines evidence
that main signaling pathways involved in transition to AI type of prostate cancer are cell
adhesion, cell cycle control, angiogenesis, invasion and metastasis pathways. Genes with altered
expression in AI prostate cancer cell lines PC3, DU145 compared with AD cell line LNCaP
might be putative biomarkers of prostate cancer invasion and metastasis. However, all selected
genes need further validation.
15
Comparative analysis of nuklex and nucleinat influence on the expression of
some genes encoding the innate immunity system components
A. O. Rybenchuk, G. V. Gerashchenko, Z. Yu. Tkachuk,
alinarybenchuk@gmail.com
Aim. Oligoribonucleotides, dsRNA and ssRNA interact with receptors and trigger
signaling pathways that lead to the activation of transcription factors that initiate gene
transcription of interferon, 2'-5'OAS / RNase L system, protein kinases, cytokines and other
factors of innate immunity. The aim of our study was to compare the Nuclex and Nucleinat
influence, on gene expression of some genes encoding the innate immunity system components.
These substances were produced from yeast oligoribonucleic acid.
Methods. The gene expression of IFNα, IFNβ, MX1, OAS1 and RNASEL were studied in
lung cells of influenza virus infected mice by RT-PCR method.
Results. Significant increasing of the IFNα and IFNβ genes expression was observed
upon the Nuclex injection into mice for prevention and for treatment, in comparison with the
control group of animals. Besides, the expression of IFNα gene was increased in 2.5 times, when
Nucleinat was injected for prevention and in 1.25 when it was injected for treatment, in
comparison with animals which were treated by Nuclex . It is interesting to note, that the
expression of IFNβ gene in a case, when the animals were injected by Nucleinat, in comparison
with the Nuclex, was in two times higher, for both, prevention and treatment. It is important to
note the presence of differences in the expression of Mx1 gene in mice that received these
substances. Separately, when Nuclex was injected for prevention, the expression of this gene was
in 1.4 times higher than in the case of Nucleinat prevention. When these substances were
injected to animals infected with influenza virus for treatment, the Mx1 gene expression was
higher more than in two times than, in case, when Nuclex was used. The OAS1 gene expression
increased almost in 19 times when Nuclex was injected for prevention, in comparison with the
control group of mice. When Nucleinat was treated for prevention, the OAS1 gene expression
was increased in 1.6 times compared with animals which were treated by Nuclex. In contrast, the
RNASEL gene expression decreased in the case of Nuclex and Nucleinat injection. It should be
noted that the injection of Nucleinat for treatment leads to the decreasing of RNASEL gene
expression in 1.4 times, compared with the Nuclex injection. The similar tendency in expression
of these genes was observed for influenza infected animals.
Conclusion. These features of gene expression of mice infected with influenza virus
show us the differences in the typical clinical manifestations of Nuclex and Nukleinat drugs.
Despite of their common origin from yeast ribonucleic acid Nuclex exhibit antiviral properties
and Nucleinat - to immunomodulatory properties.
16
Clinoptilolite application in the conductometric biosensors
O. Y. Saiapina, S. V. Dzyadevych, N. Jaffrezic-Renault, A. Errachid, A. Walcarius
osayapina4@gmail.com
At present ammonium is widely determined in clinical medicine, water quality
monitoring, and research (e.g., the accurate measurement of ammonium is fundamental to
understanding of nitrogen biochemistry in aquatic ecosystems). Determination of urea and
arginine, compounds of the diagnostic relevance for variety of the metabolic disorders, has
become possible due to just determination of ammonium ions generated in the enzymatic
decomposition of the formers (with urease and arginase/urease reactions respectively) by the
electrochemical sensors. Therefore the search of the selective probes for ammonium is of great
importance for the development of the highly sensitive and reliable sensors for determination of
ammonium itself and improvement of performance of the enzyme biosensors.
Aim. The analytical characteristics of the RClt-based urease biosensor and the RClt-
based biosensor for arginine were studied and compared.
Methods. The scope of this study is the influence of the raw form of the natural zeolite
Romanian clinoptilolite (RClt) on conductivity of the ammonium- and sodium-based aqueous
solutions, phosphate buffer solution, and phosphate buffer solution, in which ammonium was
injected afterwards. Coefficients of selectivity of a RClt-modified pair of electrodes were
calculated in the aqueous solutions of NH4
+, Na+, K+, Mg2+, Ca2+, and Al3+ ions and the
phosphate buffer (according to the Fixed Interference Method).
Results. It was shown that zeolite being introduced to 0.01 mM NH4NO3 and 0.01 mM
NaNO3 aqueous solutions significantly increased the overall conductivity of the solutions (8.3
times and 13.4 times respectively). The progressive increase in the conductivity of the obtained
suspensions (suspension “ammonium+zeolite” and suspension “sodium+zeolite”) was observed
with time and at the increasing concentrations of both ions in the distilled water comprising
zeolite (5% m/v). However the introduction of zeolite to the phosphate buffer solution (5 mM
KH2PO4-Na2HPO4) decreased the conductivity of the buffer, and the ammonium ions injected to
this suspension further did not cause the perceptible shift in the background conductivity. This
was only observed when the concentration of ammonium in the buffer reached the point of 0.2
mM testifying for the retention of the ammonium-dependent signal due to the competitive ion-
exchange processes on zeolite if compared with the conductivities of the pure buffer solution at
the same ammonium concentrations (the G growth in the buffer solution with no zeolite was
observed when the ammonium concentration in the buffer reached the point of 0.04 mM).
Conclusion. Comparison of coefficients of selectivity of the RClt-modified pair of
electrode shows that Na+ and K+ ions have the interference effect on the ammonium uptake onto
RClt in the aqueous solutions but not in the buffer solution. Incorporation of RClt to the selective
elements of the conductometric biosensors for urea and arginine results in the significant
increase in the biosensor’s sensitivity.
17
Conformational changes of human tyrosyl-tRNA synthetase in the complex
with tyrosyl-adenylate studied by molecular dynamics simulations
O. V. Savytskyi and A. I. Kornelyuk
savytskyi@moldyngrid.org
Tyrosyl-tRNA synthetase (TyrRS) is a key enzyme of protein biosynthesis, which
catalyzes the aminoacylation of tRNATyr via tyrosyl-adenylate intermediate formation. Once
formed, the aminoacyl-adenylate is stabilized by specific interactions at the enzyme active site.
Aim. In this work we have studied the conformational changes in human tyrosyl-tRNA
synthetase induced by tyrosyl-adenylate formation using computational MD simulations.
Methods. 100 ns MD simulations were performed using grid services of the MolDynGrid
virtual laboratory (http://moldyngrid.org/). Three-dimension structure of HsTyrRS was
constructed in Modeller 9.7 using structure templates (PDB codes: 1N3L, 1NTG and 1OPL for
interdomain linker). Tyrosyl-adenylate intermediate from the crystal structure of tyrosyl-tRNA
synthetase of Bacillus stearothermophilus (PDB code: 3TS1) was used as a template. The full-
length HsTyrRS structure in the complex with tyrosyl-adenylate was constructed and optimized
in AutoDock 4 and MGLTools 1.5. Localization of the potassium ion (K+) corresponds to the
coordinates from crystal structure of human mini-TyrRS (PDB code: 1Q11). The 100 ns MD
trajectory of HsTyrRS with tyrosyl-adenylate and K+ complex was computed using NAMD 2.10
software in Charmm27 force field. The Distributed Analyzer Script was used for analytical tools
automation (Savytskyi et al, 2011).
Results. Root mean square deviation (RMSD) analysis shows relaxation period after 20
ns of time. Tyrosyl-adenylate binds at the active site via hydrogen bonds interactions with more
than 10% of time: Thr42 – 76.08%, Asp173 – 76.08%, Tyr39 – 71.24%, Trp40 – 46.14%,
Gln170 – 42.46%, Ala43 – 16.85%, Asn212 – 16.33% and Val215 – 13.49%. The lowest values
(~ 0.06 nm) of root mean square fluctuation (RMSF) in active site were observed for the
catalytic KMSSS loop in monomer A in the complex with substrate, while in monomer B
without substrate they were much higher (~ 0.2 nm). A novel antiparallel β-sheet formation at
the Ala355-Val363 region of the interdomain linker was revealed for 3-100 ns time interval.
Also, the β-turn formation in Pro365- Arg367 region was revealed for 40-90 ns time interval at
the interdomain linker.
Conclusions. The conformational changes at both the active site and the interdomain
linker of human tyrosyl-tRNA synthetase in the complexes with substrates were observed during
MD simulations. The active site of monomer A in the complex with substrates reveals more
compact conformation with lower values of RMSF in comparison with free monomer B. Some
local conformational changes (antiparallel β-sheet and turn formations) have been observed at
the linker. These findings support the idea that the secondary structure formation in the
interdomain linker could take a part in the interdomain compactization in human tyrosyl-tRNA
(Savytskyi et al, 2013).
Acknowledgments. This work was supported by National Academy of Sciences of Ukraine. A. Rayevsky and V.
Kitam are acknowledged for the discussion on the methodology. O. S. was supported by the Federation of European
Biochemical Societies for Youth Travel Funds (Y/10/35, Y/11/38, Y/13/24).
18
Characterization of MMSC cultures from umbilical cord matrix cultivated in
various gas mixtures and under standard conditions
N. S. Shuvalova, V. A. Kordium
riyena@yandex.ru
Aim. The aim of present work was to study the changes in MMSC from umbilical cord
matrix (UC-MMSC) cultures, cultivated in various gas mixtures, and to determine optimal
conditions of cultivation, using the data about proliferative potential, morphology, and the
characterization of surface markers expression and reactive oxygen species production.
Methods. From the first passage UC-MMSC were plated on plastic flacks and Petri
dishes, d=35 mm, at a density 15,000 per dish and 50, 000 per flack, and cultivated for 4
passages under nitrogen-based gas mixture (3% oxygen, 4% carbon dioxide, 93% nitrogen -
NM) and argon-based gas mixture (3% oxygen, 4% carbon dioxide, 93% argon - AM) for 7
days before replating. Control group was maintained under standard CO2 incubator
conditions. Cell numbers, morphology and the surface markers (CD90, CD73, CD105) were
analyzed at each passage. Reactive oxygen species (ROS) formation in cells was detected by
using a fluorescent probe, 2',7'-diclorofluorescin diacetate.
Results. Compared to the cultures maintained under atmospheric oxygen concentration,
the UC-MMSC, both in AM and NM, had higher proliferation rates, the effect slightly more
pronounced in NM. Cells’ morphology in both gas mixtures was less heterogeneous
compared to that in CO2 incubator at every analyzed passage. The surface marker analysis
showed that both AM and NM prevented loosing surface markers by UC-MSC population at
3-4 passage, AM slightly more effective. The measurement of ROS production showed no
correlations between passages and used gas mixtures, and varied depending on donor.
Conclusions. Under standard cultivation conditions the decrease of surface marker protein
expression and the proliferation rate can be observed, alongside with the morphology of
cultures becoming more heterogeneous, that shows the degenerative processes in culture.
Using both gas mixtures helped to preserve the proliferation rate and morphological
characteristics of culture. The effects of mixtures differed: AM preserved the levels of surface
markers expression, and NM appeared to have beneficial effect on preventing the proliferation
rate decrease and morphological changes in cultures. ROS production showed no correlation
with passage, and appeared to be more donor-dependent.
19
Expression of recombinant human Calmodulin in insect cells and its
purification
O. Yu. Skorobogatov, I. Yu. Zhukov, Z. Yu. Tkachuk
skorobogatov.alx@gmail.com
Aim. It has been shown earlier, that dephosphorylated 2'-5'-linked triadenylates (2'-5'A3) are
capable of tuning the Ca2+-binding properties of Calmodulin (CaM) – crucial participant of Ca2+
mediated signaling. Binding of 2'-5'A3 to this protein caused significant (3 orders of magnitude)
change in its affinity to Calcium ions (Tkachuk et al., 2011). For the purposes of more detailed
analysis of this phenomenon, namely usage of NMR for locating the binding site for 2'-5'A3, it
has been decided to obtain the recombinant human CaM.
Usage of initially obtained pET21a plasmid vector (L. Kovacic), fused with the gene of human
CaM1, for the transformation of E. coli BL21(DE3), was not successful. We hypothesize, that it
could be due the C-terminal location of the 6xHis-tag. As it has been shown by the Western
Blotting, the application of the anti-6xHis antibodies at the favorable concentrations, provided by
the developers, resulted in nearly transparent bands on the nitrocellulose. That, in turn, led us to
the conclusion, that the product of the plasmid at the unusually high concentrations was toxic for
bacterial cells, which caused cleavage of either the His-tag, or the part of the C-terminal domain
within Calmodulin globule, containing the His-tag.
After sequencing the plasmid our hypothesis was proved, since no signs of cloning mistakes or
mutations were present. At this point we decided to use another expression system, which would
not react to the presence of the abnormal CaM concentration in the same way.
Methods. In order to achieve this goal, CaM1 gene was first amplified, using the pET21a
plasmid vector that we possessed. After that, it was cloned into the destination vector, suitable
for further co-infection of the insect cells with the Autographa californica nucleopolyhedrovirus
(AcMNPV) DNA. High affinity metal chromatography was used afterwards in order to extract
the protein from insect cell lysate.
Results. Firstly, we have managed to clone the CaM1 into the destination vector, which later
was used for transformation of DH10Bac E. coli cells, containing the baculovirus “shuttle”
vector. Recombinant vector, containing CaM1, was thus generated. Secondly, we used this
recombinant product to infect the sf9 insect cells, derived from the pupal ovarian tissue of the
fall army worm spodoptera frugiperda, where the CaM1 was overexpressed for 72 hours.
Thirdly, we have extracted and purified the CaM from the cell lysate with the use of High
affinity metal chromatography, namely Ni-NTA resin. Further analysis on polyacrylamide gel
electrophoresis has shown, that the purity of the protein was around 95%.
Conclusion. We have managed to obtain the highly pure recombinant human protein
Calmodulin, expressed in the insect cells and suitable for further usage in various biochemical
and biophysical experiments. We believe, that the usage of an eukaryotic organism as an
expression system is strongly suggested, since it allows to avoid undesirable post translational
protein modifications, which are common for prokaryotic systems.
Firstly, we are planning to apply the CD spectroscopy to investigate the impact of 2'-5'A3 binding
on Calmodulin’s secondary structure. Later, we will carry out the study of more precise
investigation of the Ca2+ affinity changes, caused by 2'-5'A3 binding. Taking into account the CD
data obtained, we will make a decision concerning the usage of Small angle X-ray scattering
(SAXC) for further investigation of the 2'-5'A3–CaM complex.
References.
1. Tkachuk et al. (2011) The effect of 2'-5'-oligoadenylates on calcium binding to Calmodulin, 17-th International
Symposium on Calcium-Binding Proteins and Calcium Function in Health & Disease, (July 16-21, Beijing, China),
Book of Abstracts, p. 41.
20
Expression of CHI3L1 in plasmid vector, vector DNA itself, and cytotoxic
drug temozolomide promote karyotype and phenotype evolution of tumor
cells
A. A. Stepanenko1, V. P. Baklaushev2, K. V. Korets1, S. V. Andreeva1, D. O. Mykytenko1, Y. S.
Vassetzky3, V. P. Chekhonin2, V. M. Kavsan1
1State Key Laboratory of Molecular and Cellular Biology, Department of Biosynthesis of Nucleic
Acids, Institute of Molecular Biology and Genetics, Zabolotngo Str. 150, Kyiv 03680, Ukraine
2Department of Medicinal Nanobiotechnology, Pirogov Russian State Medical University,
Ostrovitianov str. 1, Moscow 117997, Russia
3CNRS UMR8126, Université Paris-Sud 11, Institut de Cancérologie Gustave Roussy, Villejuif
94805, France
a.a.stepanenko@gmail.com
Chromosome instability (CIN) is the driver and catalyzer of cellular immortalization,
malignant transformation, metastasis, and drug resistance. CIN refers to the rate of karyotype
changes in cell population and implies both the clonal (CCAs) and non-clonal (NCCAs)
chromosome aberrations, which comprise the whole chromosome and segmental chromosome
instability (translocations, breaks, deletions, and amplifications).
Aim. To study the patterns of CCAs/NCCAs after genotoxic stress (integration of foreign
DNA into genome, overexpression of cancer-associated gene CHI3L1, and long-term treatment
with cytotoxic drug temozolomide) and to establish the link between changes of karyotype and
malignant phenotype, we used a panel of cell lines with different intrinsic pattern of
CCAs/NCCAs.
Methods. Cell lines were karyotyped using Giemsa differential staining of chromosomes.
To evaluate the individuality of cell lines and to establish the patterns of CCAs/NCCAs, the
following karyotype parameters of 20 metaphases were analyzed: total line-specific chromosome
number, total number of marker chromosomes per cell line, line-specific marker chromosomes,
total number of NCCAs per cell line, total frequencies of NCCAs per cell line, and variations of
non-clonal markers between individual cells in cell line. Array comparative genome
hybridisation (aCGH) was applied to elucidate sub-chromosomal changes. Phase-contrast
morphology analysis, MTT proliferation test, growth in soft agar assay, invasion assay, qRT-
PCR, and Western blotting were used for phenotype analysis.
Results. Overexpression of the transfected oncogene CHI3L1, foreign DNA integration
itself into genome, or temozolomide treatment promoted karyotype and phenotype changes.
Karyotypes of cell lines after genotoxic stress evolved stochastically and were individual with
different patterns of CCAs/NCCAs. The pattern of CCAs/NCCAs of cells depended on the
nature of genotoxic stress and intrinsic pattern of CCAs/NCCAs of cells. Phenotype changes
paralleled karyotype evolution, were unpredictable and diverse in the derivatives of cell lines.
Conclusion. Karyotype changes and heterogeneity determine the complex malignant
phenotype of tumor cells.
21
The interaction of truncated forms of translation elongation factor eEF1Bγ
with eEF1Bα and eEF1Bβ.
T. V. Trosiuk, V. F. Shalak
chafran@mail.ru
Introduction. Elongation factor-1 (eEF1), which is responsible for aminoacyl-tRNA
transfer to the ribosome, consists of two components: eEF1A - a G-protein forming a ternary
complex with aminoacyl-tRNA and eEF1B - a guanine-nucleotide exchange factor. eEF1B – is a
complex that includes α, β and γ subunits. Both eEF1Bα and eEF1Bβ catalyze the GDP/GTP
exchange on eEF1A, whereas eEF1Bγ is a structural subunit. In higher eukaryotes, the eEF1B
complex can also contain a unique enzyme, the valine-tRNA synthetase (VRS-eEF1H complex).
Several models of VRS-eEF1H organization have been proposed, but they are contradictory to
each other. Thus, the general purpose of my work is to define the mode all subunits interact with
each other to form the complex. Here, we present the results of the expression and purification of
several eEF1Bγ truncated forms and their interaction with eEF1Bα and eEF1Bβ.
Methods. All recombinant truncated forms of eEF1Bγ were expressed in Rosetta DE3
bacterial strain and purified by the affinity chromatography (Ni-NTA, glutathione sepharose or
MBPTrap columns). The aggregation state of eEF1Bγ deletion mutants and their interaction with
protein partners was analyzed by gel filtration on Superose 6 column.
Results. We expressed and purified to homogeneity a set of truncated forms of eEF1Bγ.
Unfortunately, some of them formed soluble aggregates that did not dissociate on monomers
even after denaturation-renaturation procedure. However, we succeeded in obtaining in
monomeric state of two C-terminal fragments of eEF1Bγ comprising amino acids 263-437 and
228-437 which correspond to C-terminal domain and C-terminal domain with linker region,
respectively. The N-terminal fragments of eEF1Bγ comprising amino acids 1-33 and 1-230 (N-
terminal domain) fused with glutathione S-transferase were obtained in the form of dimers.
Other truncated forms of eEF1Bγ comprising amino acids 1-93, 1-165, 33-437 and 93-437 were
obtained as high molecular weights aggregates. We showed that both C-terminal fragments of
eEF1Bγ interacted with neither eEF1Bα nor eEF1Bβ subunits. Whereas, the N-terminal domain
of eEF1Bγ formed stable complex with both eEF1Bα and eEF1Bβ proteins simultaneously. The
truncated form of eEF1Bγ containing amino acids 1-33 fuse to GST doesn’t interact with either
of the abovementioned partners.
Conclusions. The N-terminal domain of eEF1Bγ could not be divided on separate
subdomains most probably due to the high content of hydrophobic amino acids. Both eEF1Bα
and eEF1Bβ subunits interact with the N-terminal domain of eEF1Bγ simultaneously and, thus,
their interaction sites are not overlapping.
22
Investigation of complexation in rna mixtures with mannitol, sorbitol and
lactose using ir spectroscopy and chemometric data analysis
M. M. Vivcharyk1, S. M. Levchenko1, Z. Yu. Tkachuk1 , O. O. Ilchenko2
1Institute of Molecular Biology and Genetics of NASU, Kyiv, 150, Ac. Zabolotnogo St., Kyiv,
Ukraine, 01601e-mail: vivcharykma11@rambler.ru
2Faculty of Radiophysics, National Taras Shevchenko University of Kyiv,64, Volodymyrska St.,
Kyiv, Ukraine, 01601
Aim. It’s well known that new immunomodulation medicine – Nucleinat contains RNA
and lactose, but new antiviral medicine– Nuclex contains RNA and mannitol. The optimal ratios
between RNA and sugar alcohols that caused their biological activity previously were estimated
using biological methods. The main aim of our investigation is to obtain the possibility of
complexation in RNA-sugar alcohol mixtures.
Methods. As IR spectra are very sensitive to structural changes caused by intermolecular
interaction between components of the mixture we choose this method in our investigations.
Chemometric analysis was used for the determination of quantitative information from IR
spectra, such as number and concentration of species in the mixture [1,2]. Our approach is based
on a three-component MCR-ALS analysis of the FTIR spectra of RNA mixtures. The graphical
user interface (GUI) in the MATLAB environment developed by Tauler et al. [3] was used for
calculations.
Results and Conclutions. The optimal ratio (the complexation is almost 100%) in RNA-
mannitol mixture is 3:1 correspondingly. In a case of RNA-lactose mixture the complexation
decreased to 30% and in RNA-sorbitol mixture – to 20%. So the optimal ratio in RNA-mannitol
mixture obtained by FTIR spectroscopy and biological methods are in a good coincidence.
Under these conditions we have the best complexation and biological activity at the same time.
The replacement of lactose for mannitol leads to the appearance of new biological properties –
antiviral activity.
References
[1] R. Wehrens, Chemometrics with R, Springer-Verlag Berlin, 2011.
[2] O.O. Ilchenko, A.M. Kutsyk and V.V. Obukhovsky, J. Atom. Mol. Phys. subm. for
publication
[3] J. Jaumot, R. Gargalloa, A. de Juan, R. Tauler, “A graphical user-friendly interface
for MCR-ALS: a new tool for multivariate curve resolution in MATLAB”, Chemometrics and
Intelligent Laboratory Systems, vol. 76, pp. 101–110, 2005.
23
Ammonium Ion Selective Copper/Polyaniline-based Nanocomposite
for Creatinine and Urea Biosensing
M. Zhybak, V. Beni, A. P. F. Turner, Y. Korpan
m.zhybak@gmail.com
Aim. Application of ammonium ions sensitive and selective nanocomposite for
creatinine and urea biosensing.
Methods. Electrodeposition, electropolymerization, differential pulse
voltammetry, cyclic voltammetry, chronoamperometric detection, enzyme
immobilization.
Results. We propose and report amperometric urea and creatinine biosensors
based on ammonium ions selective Copper/Polyanyline (PANI) nanocomposite. The
proposed nanocomposite reveals high sensitivity and specificity towards ammonium
ions with response range between 5 and 100 μM and a detection limit of 0.5 μM. To
demonstrate its suitability as transducer in biosensors, creatinine and urea biosensors
were fabricated by immobilising creatinine deiminase or urease, respectively, on the
nanocomposite surface. The response range of the creatinine biosensor was 2 to 100
μM, which fits well with the normal levels of creatinine in healthy people (30-150 µM).
The urea biosensor had a response range of 5 to 100 µM. A limit of quantification of 1
µM was achieved for both biosensors.
Conclusions. Ammonium ions selective Copper/Polyaniline-based chemosensor was
successfully applied for the development of creatinine and urea biosensors.
|