Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated
Aim. Determination of the Cckbr, Gast, Reg1α and Tgfb1 genes expression in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated. Methods. Experiments were carried out on white non-strain mail rats. Hypoacidic state was modeled through...
Gespeichert in:
| Datum: | 2012 |
|---|---|
| Hauptverfasser: | , , , , |
| Format: | Artikel |
| Sprache: | English |
| Veröffentlicht: |
Інститут молекулярної біології і генетики НАН України
2012
|
| Schriftenreihe: | Вiopolymers and Cell |
| Schlagworte: | |
| Online Zugang: | http://dspace.nbuv.gov.ua/handle/123456789/156801 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated / S.E. Vakal, K.O. Dvorshchenko, A.S. Dranitsina, T.V. Borodina, L.I. Ostapchenko // Вiopolymers and Cell. — 2012. — Т. 28, № 6. — С. 461-467. — Бібліогр.: 34 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-156801 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-1568012019-06-19T01:30:03Z Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated Vakal, S.E. Dvorshchenko, K.O. Dranitsina, A.S. Borodina, T.V. Ostapchenko, L.I. Genomics, Transcriptomics and Proteomics Aim. Determination of the Cckbr, Gast, Reg1α and Tgfb1 genes expression in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated. Methods. Experiments were carried out on white non-strain mail rats. Hypoacidic state was modeled through intraperitoneal injection of omeprazole during 28 days. Level of genes expression was determined by semi-quantitative RT-PCR. Results. The elevation of levels of Cckbr, Reg1α and Tgfb1 mRNAs, as well as the appearance of Gast gene expression in rat pancreas upon hypoacidic conditions were shown. The levels of Cckbr and Tgfb1 mRNAs with administration of multiprobiotic «Symbiter® acidophilic» concentrated under the same conditions were similar to the control, while the expression of Gast gene was not detected; at the same time, the level of Reg1α mRNA was higher than that in animals with hypoacidity. Conclusions. Long-term hypoacidity is accompanied by changes in the expression of Cckbr, Gast, Reg1α and Tgfb1 genes in rat pancreas, while upon administration of multiprobiotic «Symbiter® acidophilic» concentrated the pattern of expression for most of the studied genes is similar to the control. Keywords: hypoacidity, pancreas, gene expression, multiprobiotics. Мета. Дослідити експресію генів Cckbr, Gast, Reg1α і Tgfb1 у підшлунковій залозі щурів за умов тривалої гіпоацидності та при введенні мультипробіотика «Симбітер® ацидофільний» концентрований. Методи. Досліди проведено на білих нелінійних щурах-самцях. Гіпоацидний стан моделювали інтраперитонеальним введенням омепразолу протягом 28 діб. Рівень експресії генів визначали напівкількісним аналізом за допомогою ЗТ-ПЛР. Результати. Показано зростання рівня мРНК Cckbr, Reg1α і Tgfb1, а також появу експресії гена Gast у підшлунковій залозі щурів за гіпоацидних умов. При введенні мультипробіотика «Симбітер® ацидофільний» концентрований за тих самих умов вміст мРНК Cckbr та Tgfb1 виявився на рівні контрольних значень, експресії гена Gast не зафіксовано, а рівень мРНК Reg1 αперевищував цей показник тварин з гіпоацидним станом. Висновки. Стан тривалої гіпоацидності супроводжується зміною експресії генів Cckbr, Gast, Reg1α і Tgfb1 у підшлунковій залозі щурів, тоді як при введенні мультипробіотика «Симбітер® ацидофільний» патерн експресії більшості з досліджених генів подібний до контролю. Ключові слова: гіпоацидність, підшлункова залоза, експресія генів, мультипробіотики. Цель. Исследовать экспрессию генов Cckbr, Gast, Reg1α и Tgfb1 в поджелудочной железе крыс в условиях длительной гипоацидности, а также при введении мультипробиотика «Симбитер® ацидофильный» концентрированный. Методы. Исследования проведены на белых нелинейных крысах-самцах. Состояние гипоацидности моделировали интраперитонеальным введением омепразола в течение 28 дней. Уровень экспрессии генов определяли полуколичественным анализом с помощью ОТ-ПЦР. Результаты. Показано повышение уровня мРНК Cckbr, Reg1α и Tgfb1, а также появление экспрессии гена Gast в поджелудочной железе крыс в гипоацидных условиях. При введении мультипробиотика «Симбитер® ацидофильный» концентрированный в тех же условиях содержание мРНК Cckbr и Tgfb1 оказалось на уровне контрольных значений, экспрессия гена Gast не зафиксирована, а уровень мРНК Reg1α превышал этот показатель у животных с гипоацидным состоянием. Выводы. Состояние длительной гипоацидности сопровождается изменением экспрессии генов Cckbr, Gast, Reg1α и Tgfb1 в поджелудочной железе, тогда как при введении мультипробиотика «Симбитер® ацидофильный» концентрированный паттерн экспрессии большинства исследованных генов близок к контролю. Ключевые слова: гипоацидность, поджелудочная железа, экспрессия генов, мультипробиотики. 2012 Article Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated / S.E. Vakal, K.O. Dvorshchenko, A.S. Dranitsina, T.V. Borodina, L.I. Ostapchenko // Вiopolymers and Cell. — 2012. — Т. 28, № 6. — С. 461-467. — Бібліогр.: 34 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000137 http://dspace.nbuv.gov.ua/handle/123456789/156801 577.21:612.34:616.33-008.821.14 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Genomics, Transcriptomics and Proteomics Genomics, Transcriptomics and Proteomics |
| spellingShingle |
Genomics, Transcriptomics and Proteomics Genomics, Transcriptomics and Proteomics Vakal, S.E. Dvorshchenko, K.O. Dranitsina, A.S. Borodina, T.V. Ostapchenko, L.I. Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated Вiopolymers and Cell |
| description |
Aim. Determination of the Cckbr, Gast, Reg1α and Tgfb1 genes expression in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated. Methods. Experiments were carried out on white non-strain mail rats. Hypoacidic state was modeled through intraperitoneal injection of omeprazole during 28 days. Level of genes expression was determined by semi-quantitative RT-PCR. Results. The elevation of levels of Cckbr, Reg1α and Tgfb1 mRNAs, as well as the appearance of Gast gene expression in rat pancreas upon hypoacidic conditions were shown. The levels of Cckbr and Tgfb1 mRNAs with administration of multiprobiotic «Symbiter® acidophilic» concentrated under the same conditions were similar to the control, while the expression of Gast gene was not detected; at the same time, the level of Reg1α mRNA was higher than that in animals with hypoacidity. Conclusions. Long-term hypoacidity is accompanied by changes in the expression of Cckbr, Gast, Reg1α and Tgfb1 genes in rat pancreas, while upon administration of multiprobiotic «Symbiter® acidophilic» concentrated the pattern of expression for most of the studied genes is similar to the control.
Keywords: hypoacidity, pancreas, gene expression, multiprobiotics. |
| format |
Article |
| author |
Vakal, S.E. Dvorshchenko, K.O. Dranitsina, A.S. Borodina, T.V. Ostapchenko, L.I. |
| author_facet |
Vakal, S.E. Dvorshchenko, K.O. Dranitsina, A.S. Borodina, T.V. Ostapchenko, L.I. |
| author_sort |
Vakal, S.E. |
| title |
Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated |
| title_short |
Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated |
| title_full |
Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated |
| title_fullStr |
Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated |
| title_full_unstemmed |
Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated |
| title_sort |
expression of cckbr, gast, reg1α, tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «symbiter® acidophilic» concentrated |
| publisher |
Інститут молекулярної біології і генетики НАН України |
| publishDate |
2012 |
| topic_facet |
Genomics, Transcriptomics and Proteomics |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/156801 |
| citation_txt |
Expression of Cckbr, Gast, Reg1α, Tgfb1 genes in rat pancreas upon long-term hypoacidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated / S.E. Vakal, K.O. Dvorshchenko, A.S. Dranitsina, T.V. Borodina, L.I. Ostapchenko // Вiopolymers and Cell. — 2012. — Т. 28, № 6. — С. 461-467. — Бібліогр.: 34 назв. — англ. |
| series |
Вiopolymers and Cell |
| work_keys_str_mv |
AT vakalse expressionofcckbrgastreg1atgfb1genesinratpancreasuponlongtermhypoacidityandwithadministrationofmultiprobioticsymbiteracidophilicconcentrated AT dvorshchenkoko expressionofcckbrgastreg1atgfb1genesinratpancreasuponlongtermhypoacidityandwithadministrationofmultiprobioticsymbiteracidophilicconcentrated AT dranitsinaas expressionofcckbrgastreg1atgfb1genesinratpancreasuponlongtermhypoacidityandwithadministrationofmultiprobioticsymbiteracidophilicconcentrated AT borodinatv expressionofcckbrgastreg1atgfb1genesinratpancreasuponlongtermhypoacidityandwithadministrationofmultiprobioticsymbiteracidophilicconcentrated AT ostapchenkoli expressionofcckbrgastreg1atgfb1genesinratpancreasuponlongtermhypoacidityandwithadministrationofmultiprobioticsymbiteracidophilicconcentrated |
| first_indexed |
2025-07-14T09:08:00Z |
| last_indexed |
2025-07-14T09:08:00Z |
| _version_ |
1837612747419811840 |
| fulltext |
UDK 577.21:612.34:616.33-008.821.14
Expression of Cckbr, Gast, Reg1α, Tgfb1 genes
in rat pancreas upon long-term hypoacidity
and with administration of multiprobiotic «Symbiter®
acidophilic» concentrated
S. E. Vakal, K. O. Dvorshchenko, A. S. Dranitsina, T. V. Borodina, L. I. Ostapchenko
Educational and scientific center «Institute of Biology»
Taras Shevchenko National University of Kyiv
2, building 12, Akademika Hlushkova Ave., Kyiv, 03022
serxio88@ukr.net
Aim. Determination of the Cckbr, Gast, Reg1α and Tgfb1 genes expression in rat pancreas upon long-term hypo-
acidity and with administration of multiprobiotic «Symbiter® acidophilic» concentrated. Methods. Experiments
were carried out on white non-strain mail rats. Hypoacidic state was modeled through intraperitoneal injection
of omeprazole during 28 days. Level of genes expression was determined by semi-quantitative RT-PCR. Results.
The elevation of levels of Cckbr, Reg1α and Tgfb1 mRNAs, as well as the appearance of Gast gene expression in
rat pancreas upon hypoacidic conditions were shown. The levels of Cckbr and Tgfb1 mRNAs with administration
of multiprobiotic «Symbiter® acidophilic» concentrated under the same conditions were similar to the control,
while the expression of Gast gene was not detected; at the same time, the level of Reg1α mRNA was higher than that
in animals with hypoacidity. Conclusions. Long-term hypoacidity is accompanied by changes in the expression
of Cckbr, Gast, Reg1α and Tgfb1 genes in rat pancreas, while upon administration of multiprobiotic «Symbi-
ter® acidophilic» concentrated the pattern of expression for most of the studied genes is similar to the control.
Keywords: hypoacidity, pancreas, gene expression, multiprobiotics.
Introduction. Acid-related disorders are the most pre-
valent among gastroenterological diseases at present.
In recent decades, proton-pump inhibitors (PPI) of the
gastric parietal cells, such as omeprazole, remain the
most effective therapeutic agents for this group of dis-
orders [1].
It is proved for now that upon long-term use of PPIs
the state of hypoacidity develops, which is accompanied
by hypergastrinemia [2, 3]. It was shown in clinical trials
that hypergastrinemia of any etiology may lead to the
development of gastric atrophy and metaplasia, as well
as sporadic tumors in other regions of gastrointestinal
tract (GIT) and associated organs [2, 4, 5]. Furthermore,
there is an evidence of an increased risk of acute pancre-
atitis development upon long-term use of PPIs [6].
According to scientific literature, the increased ex-
pression of Reg1α gene encoding eponymous protein is
associated with regeneration of pancreatic islet cells and
diabetogenesis upon the damage of gland [7, 8]. More-
over, it is shown that co-expression of Cckbr gene (co-
des gastrin/cholecystokinin receptor type B) and Gast
gene (codes hormone gastrin) is common in human pan-
creatic adenocarcinoma [9, 10]. Tgfb1 gene encoding
isoform 1 of the transforming growth factor β (TGF-β1)
is expressed in pancreatic cells upon normal condi-
tions, but it is proved that its increased expression is as-
sociated with carcinogenesis and acute pancreatitis [11].
The development of dysbiosis is one of the key con-
sequences of long-term hypoacidity. Colonization of GIT
by opportunistic microbiota appears to be the stable
sources of endogenous infection and additionally pro-
motes gastric carcinogenesis [3, 5]. It is proved in clini-
461
ISSN 0233–7657. Biopolymers and Cell. 2012. Vol. 28. N 6. P. 461–467 doi 10.7124/bc.000137
Institute of Molecular Biology and Genetics, NAS of Ukraine, 2012
cal trials that probiotics are able not only to cure dysbio-
tic states, but also to reduce the damage ratio of GIT im-
mediately [12, 13].
Multiprobiotics of «Symbiter®»» group (hereinafter
referred to as Symbiter) are characterized by complexi-
ty, a wide array of bioactivity and composition maxi-
mally close to the natural microbial populations of hu-
man and animals [13].
Analysis of scientific literature showed a lack of data
on the pattern of above mentioned genes expression in
pancreas upon experimental or natural hypoacidity. Da-
ta on the effect of probiotics on gene expression in pan-
creas upon these conditions are also absent.
The aim of current investigation was to determine
the expression of Cckbr, Gast, Reg1α and Tgfb1 genes
in rat pancreas upon long-term injection of omeprazole
and with administration of Symbiter.
Materials and methods. The International recom-
mendations on performance of medical and biological
investigations with the use of animals according to Eu-
ropean Convention for the Protection of Vertebrate Ani-
mals Used for Experimental and other Scientific Pur-
poses were followed. Experiments were carried out on
white non-strain male rats with initial weight around
180–200 g.
All animals were divided into four groups. Rats in-
jected with 0.2 ml of physiological solution abdomi-
nally and 0.5 ml of water for injections orally were used
as a control (first group). Hypoacidity (second group)
was modeled by everyday intraperitoneal injection of
omeprazole (14 mg/kg) during 28 days [14]. The third ex-
perimental group simultaneously with omeprazole obtai-
ned Symbiter (manufactured by LLC «O. D. Prolisok»,
Ukraine) orally (0.14 ml/kg). Animals of the fourth
group were treated with the same dose of Symbiter du-
ring 28 days. The number of animals in each experimen-
tal group was 8.
RNA was isolated following Chomczynski and Sac-
chi [15]; cDNA was synthesized in 20 µl of reaction
mix containing 2 µg of RNA, 1 mM dNTP, 200 U of re-
verse transcriptase RevertAid M-MLV, corresponding
buffer, 20 U of ribonuclease inhibitor, 20 pmol of re-
verse primer. Synthesis was carried out in the follow-
ing conditions: 70 °С – 5 min, further 37 °С – 5 min,
42 °С – 1 h. Polymerase chain reaction was performed in
30 µl of reaction mix containing 10 µl of cDNA, PCR buf-
fer, 200 µM of each dNTP, 30 pmol (1.0 µM) of each
primer, 2.5 mM of MgCl2 and 1.5 U of Taq DNA polyme-
rase. PCR amplifications consisted of the initial denatu-
ring step of 94 oС for 4 min, followed by 35 cycles (for β-
actin – 30 cycles) of 94 oС for 45 s, appropriate annealing
temperature for suitable time: Cckbr (184 b. p., 59 oС –
45 s), Gast (274 b. p., 52 oС – 40 s), Reg1α (608 b. p.,
48 oС – 45 s), Tgfb1 (298 b. p., 52 oС – 45 s) and β-actin
(521 b. p., 49 oС – 40 s) (gene used as the internal cont-
rol of reaction due to its constitutive expression); the fi-
nal extension step at 72 oС for 1 min 15 s (for Cckbr, Reg1α
and Tgfb1) or 1 min (for β-actin and Gast). Further fill-in
of PCR products was performed upon 72 oС for 5 min.
The following primers were used in reactions: for
Cckbr – forward – GCAAGCACGAGTATGGCAAA
and reverse – TAGCACGGACCAGGTTTGTT; for
Gast – forward – GCCCAGCCTCTCATCATC and re-
verse – GGGGACAGGGCTGAAGTG; for Reg1α –
forward – AGCCTGCAGAGATTGTTGAC and rever-
se – CCATAGGGCAGTGAGGCAAG; for Tgfb1 –
forward – CTTCAGCTCCACAGAGAAGAACTGC
and reverse – CACGATCATGTTGGACAACTGCTCC;
for β-actin – forward – TGGGACGATATGGAGAAGAT
and reverse – ATTGCCGATAGTGATGACCT. Sepa-
ration of PCR products was performed electrophoreti-
cally in 1.6 % agarose gel with 0.5 × TВЕ buffer follow-
ing Sambrook et al. [16]. For semi-quantitative analy-
sis of amplicons expression based on densitometry the
ImageJ 1.45s program was used. The indices of mRNA
expression were calculated for each sample following
Konturek et al. [17].
Statistical processing of experimental data was per-
formed with analysis of variance [18]. Probability of dif-
ference between the control and test measurements was
assessed with Student’s t-test. The difference between
compared data was treated as probable if р < 0.05. All cal-
culations and graph plotting were carried out in «Origin-
Lab Origin 8.6» and «Microsoft Excel 2003» programs.
Results and discussion. It was established that the
mRNA level of Cckbr gene in the control was 0.578 ±
± 0.054 in relation to β-actin (Figure, A). In animals trea-
ted only with omeprazole for 28 days this parameter
was 1.7 times higher in comparison with the control,
while upon simultaneous administration of multipro-
biotic Symbiter the level of Cckbr mRNA was two ti-
mes lower than in the animals injected with omepra-
462
VAKAL S. E. ET AL.
zole. In the animals treated only with Symbiter this pa-
rameter was 0.437 ± 0.041.
On the one hand, the indicated high level of Cckbr
mRNA may be caused by the intensification of this ge-
ne expression only in pancreatic endocrine cells, but on
the other hand, it may also be explained by the gain of
expression in cells of exocrine pancreas [19]. This idea
is supported by the literature data, according to which
the expression of Cckbr gene in normal pancreas is
shown for endocrine cells of α and δ subtypes (in both
human and rat) [9, 20, 21]. Moreover, there are also the
data on low Cckbr gene expression in pancreatic acinar
cells in normal conditions [20, 21], while no correspon-
ding mRNA is detected in duct cells.
In recent years, some data on the association bet-
ween enormous expression of Cckbr gene and a num-
ber of pancreatic pathologies including acute pancrea-
titis were obtained [9, 20]. Furthermore, it was shown
the relation between the Cckbr expression in acinar
cells and carcinoma of this cellular type and pancreatic
ducts adenocarcinoma [22]. Thus, the overexpression
of Cckbr gene in pancreatic acinar cells is considered to
be associated with carcinogenesis at the moment [20].
Unfortunately, the conditions of our experiment do not
allow us to separate the role of specific cells in the estab-
lished increase of gastrin receptor gene expression.
mRNA of Gast gene was not detected in rat pancreas
of the control group (Figure, B). At the same time, upon
long-term hypoacidity the expression of this gene was
observed, since its mRNA was revealed in the samples
of rat pancreases. The level of Gast gene mRNA in these
conditions was 0.568 ± 0.067. All the while, expression
of gastrin was observed neither in the third group (ome-
prazole + Symbiter), nor in the fourth (Symbiter).
Gastrin is expressed exclusively in enteroendocrine
G-cells of gastric antrum mucosa and in proximal part
of duodenum [21, 23]. According to the literature, «ad-
ventive» expression of gastrin may be associated with
the development of gastrinoma; it is a common peculia-
rity of Zollinger-Ellison syndrome [23]. Moreover, it
has been recently shown that in human pancreatic ade-
nocarcinoma the co-expression of gastrin and CCKBR
proteins is observed [10, 20].
The gastrin mRNA was found only in pancreatic
samples of animals treated with omeprazole during 28
days (Figure, B). At the same time, an increased level
of the Cckbr mRNA was established upon these condi-
tions (Figure, A), thus suggesting the co-expression of
the corresponding genes. However, an increase of the
Cckbr gene mRNA level may be limited only to endo-
crine cells, without any involvement of exocrine part of
the pancreas [9, 20], so there is no sufficient basis for a
suggestion about ductal adenocarcinoma existence upon
long-term gastric hypoacidity. Further investigations are
needed for the clarification of this aspect.
The investigation of Reg1α gene expression pattern
showed that in the control the mRNA level was 0.211 ±
± 0.045 (Figure, C). In animals treated only with ome-
prazole for 28 days, the level of Reg1α mRNA was
0.414 ± 0.047, which is 2 times higher than the control
values. Upon simultaneous administration of multipro-
biotic Symbiter this parameter was 1.7 times higher than
in animals of the second group. In animals treated only
with Symbiter, similarly to the control, the level of Reg1α
gene mRNA was 0.154 ± 0,012.
The Reg1α gene encodes a regenerative protein,
which provides the formation of endocrine islands and
regeneration of pancreatic tissue upon pathological con-
ditions, and is also involved in the differentiation of
pancreatic cells upon regeneration [7, 21]. This protein
is constitutively expressed in pancreatic acinar cells,
but not in islet or duct cells [8].
The increased level of Reg1α mRNA upon 28-day
injection of omeprazole (Figure, C) may be connected
with the regeneration of pancreas upon its damage and
formation of new endocrine cells [7, 8, 21]. A higher le-
vel of mRNA upon simultaneous administration of ome-
prazole and Symbiter (in comparison with animals of the
second group) indicates the intensification of regene-
rative processes in pancreas, which can promote more
rapid regeneration of damaged tissues (primarily – en-
docrine cells).
The level of TGF-β1 mRNA was 0.485 ± 0.054 in
the control (Figure, D). Upon long-term hypoacidity its
level was 1.4 times higher in comparison with the cont-
rol. At the same time, upon simultaneous administra-
tion of Symbiter the level of TGF-β1 mRNA was 1.7 ti-
mes lower than in animals of the second group. In the
fourth group this parameter was lower than in the cont-
rol and amounted to 0.417 ± 0.051.
On the one hand, TGF-β1 is a potent oncosuppres-
sor in normal cells and, on the other hand, is an oncopro-
463
EXPRESSION OF Cckbr, Gast, Reg1α, Tgfb1 GENES IN RAT PANCREAS UPON LONG-TERM HYPOACIDITY
moter in malignant cells [11]. Any disturbances in the
expression of above mentioned protein may increase
the risk of pancreatic carcinogenesis [11, 24]. The in-
crease in TGF-β1 mRNA level in rat pancreas upon
long-term hypoacidity was shown in our experiment.
So, another assumption can be made about the existen-
ce of carcinogenesis in rat pancreas upon long-term ad-
ministration of omeprazole.
Analysis of the recent scientific literature and the
results of our experiments allow us to point out several
possible mechanisms of the long-term hypoacidity ef-
fects on genes expression in the cells of rat pancreas.
464
VAKAL S. E. ET AL.
M 1 2 3 4 N-PCR
Tgfb1Reg1α
*
#
0
0,1
0,3
0,5
0,7
0,9
R
el
a
ti
ve
ex
p
re
ss
io
n
(C
C
K
B
R
/β
-a
ct
in
)
1 2 3 4
1 2 3 4
*
#
0
0,1
0,3
0,5
0,7
R
el
a
ti
ve
ex
p
re
ss
io
n
(G
a
st
ri
n
/β
-a
ct
in
)
*
#
0
0,2
0,4
0,6
0,8
R
el
a
ti
ve
ex
p
re
ss
io
n
(T
G
F
-β
1
/β
-a
ct
in
)
-
*
*/#
0
0,2
0,4
0,6
0,8
R
el
a
ti
ve
ex
p
re
ss
io
n
(R
eg
1
α/
β-
a
ct
in
)
M 1 2 3 4 N-PCR
1 2 3 4
1 2 3 4
A B
C
D M 1 2 3 4 N-PCR M 1 2 3 4 N-PCR
Cckbr Gast
Level of Cckbr (A), gastrin (B), Reg1α (C) and transforming growth factor β (D) mRNA in rat pancreas upon long-term hypoacidity and with ad-
ministration of multiprobiotic «Symbiter® acidophilic» concentrated: М – molecular mass marker; 1 – control; 2 – omeprazole; 3 – omeprazole +
+ Symbiter; 4 – Symbiter; N-PCR – negative PCR control; *p < 0.05 in relation with control; #p < 0.05 in comparison with animals treated with
omeprazole
Omeprazole can directly affect pancreatic cells.
However, up to date there are no clear data about the
possibility of such action. In particular, it was shown
that omeprazole inhibits proliferation and modulates
autophagy of several cell lines of pancreatic cancer [25].
However, these data are not appropriate for physiolo-
gical conditions of a whole organism.
Another mechanism is the indirect effect of hypo-
acidity. As a consequence of low acid secretion in sto-
mach, the qualitative and quantitative composition of
GIT microbial population is disturbed, i. e. the patho-
logical state of dysbiosis develops leading to formation
of an endogenous infection source, including close quar-
ters of the pancreas [26, 27]. There are rare assump-
tions in the literature about possible colonization of
pancreatic ducts by dysbiotic microbiota, that during
its livelihoods produce a number of bioactive substan-
ces, and among them N-nitroso compounds, the carci-
nogenicity of which is proved at the moment [28].
The effect of hypergastrinemia is of particular inte-
rest. The increase of serum gastrin is a compensatory
response to the suppression of gastric acid secretion,
since gastrin is a physiological stimulator of this pro-
cess. According to the literature, in normal conditions
the receptor for gastrin (CCKBR) is expressed predomi-
nantly in endocrine pancreatic cells – in both human
and rat [20].
The excess of gastrin in blood upon hypoacidity
may form a substantial burden on pancreatic endo-
crine cells, thus changing the pattern of signal molecu-
les secretion from these cells [29]. Aside from that, in-
creased concentrations of gastrin can affect the peri-
pheral blood lymphocytes, inducing the secretion of
IFN-γ and IL-2, and also changing the activity of some
intracellular enzymes, that may modulate the activity
of these immune cells and their effects on the target
cells [30].
Probably, the constellation of above mentioned fac-
tors exists, thus forming the image obtained in our expe-
riment. It cannot also be excluded that a role of each fac-
tor varies depending on individual peculiarities of the
organism, functional state of immune system, the whole
term of hypoacidic state, etc.
Among probable mechanisms of Symbiter’s action
on gene expression in rat pancreas, firstly, it should be
pointed out its ability to liquidate dysbiosis and bacte-
rial colonization of GIT – it was observed in a number
of investigations [13]. As a consequence, the burden of
pathogenic microbiota is removed from GIT and asso-
ciated organs.
Furthermore, Lutgendorff et al. [31] showed that
multicomponent probiotics are able to increase de novo
synthesis of the main low-molecular cellular antioxi-
dant – reduced glutathione, and thus to raise its content
in both GIT and pancreas. It is proved for now that an
oxidative stress plays crucial role at the beginning stage
of acute pancreatitis [32]. On the experimental model
of acute pancreatitis Lutgendorff et al. indicated that the
preliminary treatment with probiotics can ameliorate the
rate of oxidative stress, inflammatory processes and da-
mage of the pancreas [31].
The reduction of gastrin level in the blood upon ad-
ministration of Symbiter has recently been observed
[33]. Such effect may be associated with the decrease in
pro-inflammatory cytokines IL-1β and IFN-γ levels in
blood upon administration of probiotic, since it was
shown that above mentioned cytokines promote the
hypergastrinemia development through stimulation of
gastrin gene expression in G-cells [34]. Based on these
data, it may be suggested that observed effects of Sym-
biter are linked not only with normalization of GIT mic-
robiota, but also with restriction of hypergastrinemia
effects.
However, the final acceptance or rejection of this
suggestion requires further investigations, which will
allow us to explicitly distinguish the consequences of
hypergastrinemia and bacterial colonization of GIT.
In summary, final elucidation of molecular me-
chaisms underlying the changes in expression of the
Cckbr, Gast, Reg1α and Tgfb1 genes in rat pancreas
upon long-term hypoacidity and with administration of
multiprobiotic Symbiter requires further more speciali-
zed and selective experiments.
Conclusions. Thus, we have shown that long-term
experimental hypoacidity is accompanied by changes in
the expression of Cckbr, Gast, Reg1α and Tgfb1 genes
in rat pancreas, while upon administration of multipro-
biotic «Symbiter® acidophilic» the expression pattern of
most of these genes is similar to the control. Based on
these data, it can be assumed that there is some poten-
tial risk of pancreatic carcinogenesis upon long-term
use of omeprazole (and probably other PPIs).
465
EXPRESSION OF Cckbr, Gast, Reg1α, Tgfb1 GENES IN RAT PANCREAS UPON LONG-TERM HYPOACIDITY
С. Є. Ва кал , К. О. Двор щен ко, А. С. Драни ци на, Т. В. Бо родіна,
Л. І. Остап чен ко
Експресія генів Cckbr, Gast, Reg1α і Tgfb1 у підшлун ковій
за лозі щурів за умов три ва лої гіпо а цид ності та при вве денні
муль тип робіот и ка «Симбітер® аци дофільний» кон цен тро ва ний
Ре зю ме
Мета. Дослідити експресію генів Cckbr, Gast, Reg1α і Tgfb1 у під-
шлун ковій за лозі щурів за умов три ва лої гіпо а цид ності та при вве-
денні муль тип робіот и ка «Симбітер® аци дофільний» кон цен тро -
ва ний. Ме то ди. Досліди про ве де но на білих нелінійних щу рах-сам -
цях. Гіпо а цид ний стан мо де лю ва ли інтра пе ри то не аль ним вве ден-
ням омеп ра зо лу про тя гом 28 діб. Рівень експресії генів виз на ча ли
напівкількісним аналізом за до по мо гою ЗТ-ПЛР. Ре зуль та ти. По-
каза но зрос тан ня рівня мРНК Cckbr, Reg1α і Tgfb1, а та кож по я -
ву експресії гена Gast у підшлун ковій за лозі щурів за гіпо а цид них
умов. При вве денні муль тип робіот и ка «Симбітер® аци дофіль-
ний» кон цен тро ва ний за тих са мих умов вміст мРНК Cckbr та
Tgfb1 ви я вив ся на рівні кон троль них зна чень, експресії гена Gast
не зафіксо ва но, а рівень мРНК Reg1α пе ре ви щу вав цей по каз ник
тварин з гіпо а цид ним ста ном. Вис нов ки. Стан три ва лої гіпо-
ацид ності суп ро вод жується зміною експресії генів Cckbr, Gast,
Reg1α і Tgfb1 у підшлун ковій за лозі щурів, тоді як при вве денні
муль тип робіот и ка «Симбітер® аци дофільний» па терн експресії
більшості з дослідже них генів подібний до кон тро лю.
Клю чові сло ва: гіпо а цидність, підшлун ко ва за ло за, експресія
генів, муль тип робіот и ки.
С. Е. Ва кал, Е. А. Двор щен ко, А. С. Дра ни ци на, Т. В. Бо ро ди на,
Л. И. Остап чен ко
Экспрес сия ге нов Cckbr, Gast, Reg1α и Tgfb1 в под же лу доч ной
же ле зе крыс в усло ви ях дли тель ной ги по а цид нос ти и при
вве де нии муль тип ро би о ти ка «Сим би тер® аци до филь ный»
кон цен три ро ван ный
Ре зю ме
Цель. Иссле до вать экс прес сию ге нов Cckbr, Gast, Reg1α и Tgfb1 в
под же лу доч ной же ле зе крыс в усло ви ях дли тель ной ги по а цид нос -
ти, а так же при вве де нии муль тип ро би о ти ка «Сим би тер® аци -
до филь ный» кон цен три ро ван ный. Ме то ды. Иссле до ва ния про ве-
дены на бе лых не ли ней ных кры сах-сам цах. Сос то я ние ги по а цид -
нос ти мо де ли ро ва ли ин тра пе ри то не аль ным вве де ни ем омеп ра-
зола в те че ние 28 дней. Уро вень экс прес сии ге нов опре де ля ли полу-
коли чес твен ным ана ли зом с по мощью ОТ-ПЦР. Ре зуль та ты. По-
казано по вы ше ние уров ня мРНК Cckbr, Reg1α и Tgfb1, а так же по-
явле ние экс прес сии гена Gast в под же лу доч ной же ле зе крыс в ги-
по а цид ных усло ви ях. При вве де нии муль тип ро би о ти ка «Сим би -
тер® аци до филь ный» кон цен три ро ван ный в тех же усло ви ях со -
дер жа ние мРНК Cckbr и Tgfb1 ока за лось на уров не кон троль ных
зна че ний, экс прес сия гена Gast не за фик си ро ва на, а уро вень мРНК
Reg1α пре вы шал этот по ка за тель у жи вот ных с ги по ацид ным со -
сто я ни ем. Вы во ды. Сос то я ние дли тель ной ги по а цид нос ти со -
про вож да ет ся из ме не ни ем экс прес сии ге нов Cckbr, Gast, Reg1α и
Tgfb1 в под же лу доч ной же ле зе, тог да как при вве де нии муль ти-
про би о ти ка «Сим би тер® аци до филь ный» кон цен три ро ван ный
пат терн экс прес сии боль ши нства ис сле до ван ных ге нов бли зок к
кон тро лю.
Клю че вые сло ва: ги по а цид ность, под же лу доч ная же ле за, экс -
прес сия ге нов, муль тип ро би о ти ки.
REFERENCES
1. Shin J. M., Vagin O., Munson K., Kidd M., Modlin I. M., Sachs G.
Molecular mechanisms in therapy of acid-related diseases //
Cell. Mol. Life Sci.–2008.–65, N 2.–P. 264–281.
2. Thomson A. B., Sauve M. D., Kassam N., Kamitakahara H. Safety
of long-term use of proton pump inhibitors // World J. Gastro-
enterol.–2010.–16, N 19.–P. 2323–2330.
3. Williams C., McColl K. E. Review article: proton pump inhibi-
tors and bacterial overgrowth // Aliment. Pharmacol. Ther.–2005.–
23, N 1.–P. 3–10.
4. Jensen R. T. Consequences of long-term proton-pump blockade:
insights from studies of patients with gastrinomas // Basic Clin.
Pharmacol. Toxicol.–2006.–98, N 1.–P. 4–19.
5. Waldum H. L., Gustafsson B., Fossmark R., Qvigstad G. Antiul-
cer drugs and gastric cancer // Dig. Dis. Sci.–2005.–50, N 1.–
S. 39–44.
6. Vakal S., Borodina T., Dvorshchenko C. Modern ideas about the
impact of gastric acid secretion blockers on the risk of acute
pancreatitis development // Bulletin of Taras Shevchenko
National University of Kyiv.–2012.–N 60.–P. 45–48.
7. Chen S., Zhong J., Zhou Q., Lu X., Wang L., Si J. The regenera-
tive gene Iα is overexpressed in atrophic gastritis rats with hyper-
gastrinemia // Gastroenterol. Res. Pract.–2011.–2011.–P. 403956.
8. Sanchez D., Mueller C. M., Zenilman M. E. Pancreatic regenera-
ting gene I and acinar cell differentiation: influence on cellular
lineage // Pancreas.–2009.–38, N 5.–P. 572–577.
9. Cayrol C., Clerc C., Bertrand C., Gigoux V., Portolan G., Four-
my D., Dufresne M., Seva C. Cholecystokinin-2 receptor mo-
dulates cell adhesion through beta 1-integrin in human pancrea-
tic cancer cells // Oncogene.–2006.–25, N 32.–P. 4421–4428.
10. Harris J. C., Gilliam A. D., McKenzie A. J., Evans S. A., Gra-
bowska A. M., Clarke P. A., McWilliams D. F., Watson S. A. The
biological and therapeutic importance of gastrin gene expres-
sion in pancreatic adenocarcinomas // Cancer Res.–2004.–64,
N 16.–P. 5624–5631.
11. Truty M. J., Urrutia R. Transforming growth factor-beta: what
every pancreatic surgeon should know // Surgery.–2007.–141,
N 1.–P. 1–6.
12. Culligan E. P., Hill C., Sleator R. D. Probiotics and gastrointes-
tinal disease: successes, problems and future prospects // Gut
Pathog.–2009.–1, N 1.–P. 19.
13. Iankovsky D., Dyment G. Microbiota and human health.–Kyiv:
LLC «Chervona Ruta-Turs», 2008.–552 p.
14. Tsyriuk O. I., Beregova T. V. Effect of omeprazole-induced
hypergastrinemia on the basal gastric secretion in rats // Bulletin
of biological and medical issues.–2007.–N 3.–P. 38–43.
15. Chomczynski P., Sacchi N. Single-step method of RNA isolation
by acid guanidiniumthiocyanate-phenol-chloroform extraction
// Anal. Biochem.–1987.–162, N 1.–P. 156–159.
16. Sambrook J., Russell D. Molecular cloning: a laboratory manu-
al.–New York: Cold Spring Harbor Lab. press, 2000.–2344 p.
17. Konturek P., Brzozowski T., Pierzchalski P., Kwiecien S., Pajdo
R., Hahn E. G., Konturek S. J. Activation of genes for spasmoly-
tic peptide, transforming growth factor alpha and for cyclooxy-
genase (COX)-1 and COX-2 during gastric adaptation to aspirin
damage in rats // Aliment. Pharmacol. Ther.–1998.–12, N 8.–
P. 767–777.
18. Fowler J., Cohen L., Jarvis P. Practical statistics for field biolo-
gy.–New York: Wiley, 1998.–272 p.
19. Ashurst H. L., Varro A., Dimaline R. Regulation of mammalian
gastrin/CCK receptor (CCK2R) expression in vitro and in vivo //
Exp. Physiol.–2008.–93, N 2.–P. 223–236.
466
VAKAL S. E. ET AL.
20. Morisset J., Laine J., Bierant M., Julien S. What are the pancrea-
tic target cells for gastrin and its CCKB receptor? Is this a couple
for cancerous cells? // Med. Sci. Monit.–2004.–10, N 10.–
RA 242–246.
21. Physiology of the gastrointestinal tract / Eds K. E. Barrett, F. K.
Ghishan, J. L. Merchant J. etc.–New York: Acad. Press, 2006.–
Vol. 1–2.–2080 p.
22. Clerc P., Leung-Theung-Long S., Wang T. C., Dockray G. J.,
Bouisson M., Delisle M. B., Vaysse N., Pradayrol L., Fourmy
D., Dufresne M. Expression of CCK2 receptors in the murine
pancreas: proliferation, transdifferenciation of acinar cells and
neoplasia // Gastroenterology.–2002.–122, N 2.–P. 428–437.
23. Burkitt M. D., Varro A., Pritchard D. M. Importance of gastrin
in the pathogenesis and treatment of gastric tumors // World J.
Gastroenterol.–2009.–15, N 1.–P. 1–16.
24. Rane S. G., Lee J. H., Lin H. M. Transforming growth factor-be-
ta pathway: role in pancreas development and pancreatic disease
// Cytokine Growth Factor Rev.–2006.–17, N 1–2.–P. 107–119.
25. Udelnow A., Kreyes A., Ellinger S., Landfester K., Walther P.,
Klapperstueck T., Wohlrab J., Henne-Bruns D., Knippschild U.,
Wurl P. Omeprazole inhibits proliferation and modulates auto-
phagy in pancreatic cancer cells // PLoS One.–2011.–6, N 5.–
e20143.
26. Canani R. B., Terrin G. Gastric acidity inhibitors and the risk of in-
testinal infections // Curr. Opin. Gastroenterol.–2010.–26, N 1.–
P. 31–35.
27. Mancilla A. C., Madrid S. A. M., Hurtado H. C., Orellana B. C.,
Pena Z. M., Tobar A. E., Berger F. Z. Small intestine bacterial
overgrowth in patients with chronic pancreatitis // Rev. Med.
Chil.–2008.–136, N 8.–P. 976–980.
28. Risch H. A. Etiology of pancreatic cancer, with a hypothesis
concerning the role of N-nitroso compounds and excess gastric
acidity // J. Natl Cancer Inst.–2003.–95, N 13.–P. 948–960.
29. Shinozaki H., Funakoshi A., Amagase H., Nakano I. Effect of hu-
man gastrin-releasing peptide (hGRP) on the pancreatic exocri-
ne and endocrine secretion in healthy subjects // Nihon Shokaki-
byo Gakkai Zasshi.–1988.–85, N 12.–P. 2673–2678.
30. Kimakovytch O. V., Vorobets Z. D. Effect of omeprazole on the
activity of glutathione system’s enzymes in peripheral blood
lymphocytes // Bukovinian medical bulletin.–2005.–9, N 2.–
P. 112–114.
31. Lutgendorff F., Trulsson L. M., van Minnen L. P., Rijkers G. T.,
Timmerman H. M., Franzen L. E., Gooszen H. G., Akkermans L.
M., Soderholm J. D., Sandstrom P. A. Probiotics enhance pan-
creatic glutathione biosynthesis and reduce oxidative stress in
experimental acute pancreatitis // Am. J. Physiol. Gastrointest.
Liver Physiol.–2008.–295, N 5.–P. 1111–1121.
32. Rau B., Poch B., Gansauge F., Bauer A., Nussler A. K., Nevalainen
T., Schoenberg M. H., Beger H. G. Pathophysiologic role of oxy-
gen free radicals in acute pancreatitis: initiating event or mediator
of tissue damage? // Ann. Surg.–2000.–231, N 3.–P. 352– 360.
33. Falaleeva T. M., Virchenko O. V., Beregova T. V., Iankovsky D.
S. Correction of stress-induced changes in hypothalamic-pitui-
tary-adrenal system by multiprobiotic «Symbiter» // World of
medicine and biology.–2012.–N 1.–P. 173–178.
34. Suzuki T., Grand E., Bowman C., Merchant J. L., Todisco A.,
Wang L., Del Valle J. TNF-alpha and interleukin 1 activate gast-
rin gene expression via MAPK- and PKC-dependent mechanisms
// Am. J. Physiol. Gastrointest. Liver. Physiol.–2001.–281, N 6.–
P. G1405–1412.
Received 10.09.12
467
EXPRESSION OF Cckbr, Gast, Reg1α, Tgfb1 GENES IN RAT PANCREAS UPON LONG-TERM HYPOACIDITY
|