Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion

Латентный мембранный белок 2А вируса Эпштейна-Барр является ключевым регулятором латентной фазы вирусной инфек- ции. Цель. Идентифицировать белки, способные связываться с пролин-обогащенными мотивами LMP2A. Методы. Анализ in silico при помощи программного обеспечения Scansite позволил предсказать вз...

Ausführliche Beschreibung

Gespeichert in:

Bibliographische Detailangaben
Datum:	2012
Hauptverfasser:	Dergai, O.V., Dergai, M.V., Tsyba, L.O., Yaruchik, A.M., Rynditch, A.V., Skrypkina, I.Ya.
Format:	Artikel
Sprache:	English
Veröffentlicht:	Інститут молекулярної біології і генетики НАН України 2012
Schriftenreihe:	Вiopolymers and Cell
Schlagworte:	Genomics, Transcriptomics and Proteomics
Online Zugang:	http://dspace.nbuv.gov.ua/handle/123456789/156852
Tags:	Tag hinzufügen Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:	Digital Library of Periodicals of National Academy of Sciences of Ukraine
Zitieren:	Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion / O.V. Dergai, M.V. Dergai, I.Ya. Skrypkina, L.O. Tsyba, A.M. Yaruchik, A.V. Rynditch // Вiopolymers and Cell. — 2012. — Т. 28, № 3. — С. 234-238. — Бібліогр.: 24 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine

id	irk-123456789-156852
record_format	dspace
spelling	irk-123456789-1568522019-06-20T01:25:18Z Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion Dergai, O.V. Dergai, M.V. Tsyba, L.O. Yaruchik, A.M. Rynditch, A.V. Skrypkina, I.Ya. Genomics, Transcriptomics and Proteomics Латентный мембранный белок 2А вируса Эпштейна-Барр является ключевым регулятором латентной фазы вирусной инфек- ции. Цель. Идентифицировать белки, способные связываться с пролин-обогащенными мотивами LMP2A. Методы. Анализ in silico при помощи программного обеспечения Scansite позволил предсказать взаимодействие амфифизина 1 (Amph1) и LMP2A. Использованы стандартные методы молекулярного клонирования, сайт-направленный мутагенез и тест на взаимодействие in vitro для последующего изучения структурных основ взаимодействия комплекса LMP2A/Amph1. Фракцию экзосом получали при помощи последовательных центрифугирований. Результаты. Показано, что изоформа LMP2A, но не LMP2АDNT взаимодействует с доменом SH3 Amph1. Выявленное взаимодействие опосредуется тремя разными пролин-обогащенными мотивами, расположенными в N-концевом участке LMP2A. Все три мотиваявляются взаимозаменяемыми, так как присутствия хотя бы одного из них оказывается достаточно для реализации связывания LMP2A с Amph1. Нами продемонстрировано связывание Amph1 и родственного ему Amph2 с LMP2A при помощи ко-иммунопреципитации эндогенных комплексов. Мутант LMP2A по пролиновым мотивам не взаимодействовал с Amph1, что привело к исчезновению его из фракции экзосом. Выводы. Латентный мембранный белок 2А вируса Эпштейна-Барр образует комплексы с эндоцитозными адаптерными белками Amph1 и Amph2. Идентифицированные новые партнеры LMP2A могут влиять на его внутриклеточный трафик и секрецию. Ключевые слова: вирус Эпштейна-Барр, LMP2A, амфифизин, экзосомы. Латентний мембранний білок 2А (LMP2A) вірусу Епштейна-Барр є важливим регулятором латентної фази вірусної інфекції. Мета. Ідентифікувати білки, які взаємодіють з пролін-збагаченими мотивами LMP2A. Методи. Аналіз in silico за допомогою програмного забезпечення Scansite дозволив передбачити можливість взаємодії амфіфізину 1 (Amph1) і LMP2A. Використано загально прийняті техніки молекулярного клонування, сайт-спрямований мутагенез і тест на взаємодію in vitro для подальшого дослідження структурних основ взаємодії комплексу LMP2A/Amph1. Фракцію екзосом отримано за допомогою послідовних центрифугувань. Результати. Показано, що ізоформа LMP2A, але не LMP2А DNT взаємодіє з доменом SH3 амфіфізину 1. Виявлена взаємодія опосередковується трьома різними пролін-збагаченими мотивами, розташованими в N-кінцевій ділянці LMP2A. Всі три мотиви є взаємозамінними, оскільки присутність хоча б одного з них є достатньою для реалізації зв’язування LMP2A з Amph1. Нами продемонстровано взаємодію Amph1 і високоспорідненого з ним Amph2 з LMP2A за допомогою ко-імунопреципітації ендогенних комплексів. Мутант LMP2A за проліновими мотивами не взаємодіяв з Amph1, що спричиняло зникнення його з фракції екзосом. Висновки. Латентний мембранний білок 2А вірусу Епштейна-Барр утворює комплекси з ендоцитозними адаптерними білками Amph1 і Amph2. Ідентифіковані нові партнери LMP2A можуть впливати на його внутрішньоклітинний трафік та секрецію. Ключові слова: вірус Эпштейна-Барра, LMP2A, амфіфізин, екзосоми. Latent membrane protein 2A (LMP2A) of Epstein-Barr virusisimplicated in the regulation of viral latency. The aim of the current study was to identify proteins interacting with proline-rich motifs of LMP2A. Methods. In silico prediction with Scansite allowed to recognize amphiphysin 1 (Amph1) as a binding partner of LMP2A. Molecular cloning techniques, site-directed mutagenesis, in vitro binding assay made it possible to study the interaction interface of Amph1/LMP2A complex. Sequential centrifugation steps were used to isolate an exosomal fraction. Results. LMP2A but not LMP2DNT mutant has been found to bind the SH3 domain of Amph1 via three distinct proline-rich motifs located in the N-terminal tail. All three motifs seem to be interchangeable as the presence of at least one of them was sufficient to mediate LMP2A/Amph1 interaction. Furthermore, the binding of LMP2A to Amph1 and related protein amphiphysin 2 was demonstrated by co-immunoprecipitation of endogenous complexes. We have found that inability of LMP2A mutant to bind Amph1 leads to the vanishing of the viral protein from the exosomal fraction. Conclusions. The latent membrane protein 2A of Epstein-Barr virus forms complexes with endocytic adaptor proteins Amph1 and Amph2. Described interaction might be involved in the regulation of intracellular traffic and secretion of LMP2A. Keywords: EBV, LMP2A, Amphiphysin, exosomes. 2012 Article Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion / O.V. Dergai, M.V. Dergai, I.Ya. Skrypkina, L.O. Tsyba, A.M. Yaruchik, A.V. Rynditch // Вiopolymers and Cell. — 2012. — Т. 28, № 3. — С. 234-238. — Бібліогр.: 24 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000054 http://dspace.nbuv.gov.ua/handle/123456789/156852 577.22 en Вiopolymers and Cell Інститут молекулярної біології і генетики НАН України
institution	Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection	DSpace DC
language	English
topic	Genomics, Transcriptomics and Proteomics Genomics, Transcriptomics and Proteomics
spellingShingle	Genomics, Transcriptomics and Proteomics Genomics, Transcriptomics and Proteomics Dergai, O.V. Dergai, M.V. Tsyba, L.O. Yaruchik, A.M. Rynditch, A.V. Skrypkina, I.Ya. Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion Вiopolymers and Cell
description	Латентный мембранный белок 2А вируса Эпштейна-Барр является ключевым регулятором латентной фазы вирусной инфек- ции. Цель. Идентифицировать белки, способные связываться с пролин-обогащенными мотивами LMP2A. Методы. Анализ in silico при помощи программного обеспечения Scansite позволил предсказать взаимодействие амфифизина 1 (Amph1) и LMP2A. Использованы стандартные методы молекулярного клонирования, сайт-направленный мутагенез и тест на взаимодействие in vitro для последующего изучения структурных основ взаимодействия комплекса LMP2A/Amph1. Фракцию экзосом получали при помощи последовательных центрифугирований. Результаты. Показано, что изоформа LMP2A, но не LMP2АDNT взаимодействует с доменом SH3 Amph1. Выявленное взаимодействие опосредуется тремя разными пролин-обогащенными мотивами, расположенными в N-концевом участке LMP2A. Все три мотиваявляются взаимозаменяемыми, так как присутствия хотя бы одного из них оказывается достаточно для реализации связывания LMP2A с Amph1. Нами продемонстрировано связывание Amph1 и родственного ему Amph2 с LMP2A при помощи ко-иммунопреципитации эндогенных комплексов. Мутант LMP2A по пролиновым мотивам не взаимодействовал с Amph1, что привело к исчезновению его из фракции экзосом. Выводы. Латентный мембранный белок 2А вируса Эпштейна-Барр образует комплексы с эндоцитозными адаптерными белками Amph1 и Amph2. Идентифицированные новые партнеры LMP2A могут влиять на его внутриклеточный трафик и секрецию. Ключевые слова: вирус Эпштейна-Барр, LMP2A, амфифизин, экзосомы.
format	Article
author	Dergai, O.V. Dergai, M.V. Tsyba, L.O. Yaruchik, A.M. Rynditch, A.V. Skrypkina, I.Ya.
author_facet	Dergai, O.V. Dergai, M.V. Tsyba, L.O. Yaruchik, A.M. Rynditch, A.V. Skrypkina, I.Ya.
author_sort	Dergai, O.V.
title	Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion
title_short	Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion
title_full	Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion
title_fullStr	Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion
title_full_unstemmed	Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion
title_sort	amphiphysin 1 and 2 interact with latent membrane protein 2a of epstein-barr virus and regulate its exosomal secretion
publisher	Інститут молекулярної біології і генетики НАН України
publishDate	2012
topic_facet	Genomics, Transcriptomics and Proteomics
url	http://dspace.nbuv.gov.ua/handle/123456789/156852
citation_txt	Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion / O.V. Dergai, M.V. Dergai, I.Ya. Skrypkina, L.O. Tsyba, A.M. Yaruchik, A.V. Rynditch // Вiopolymers and Cell. — 2012. — Т. 28, № 3. — С. 234-238. — Бібліогр.: 24 назв. — англ.
series	Вiopolymers and Cell
work_keys_str_mv	AT dergaiov amphiphysin1and2interactwithlatentmembraneprotein2aofepsteinbarrvirusandregulateitsexosomalsecretion AT dergaimv amphiphysin1and2interactwithlatentmembraneprotein2aofepsteinbarrvirusandregulateitsexosomalsecretion AT tsybalo amphiphysin1and2interactwithlatentmembraneprotein2aofepsteinbarrvirusandregulateitsexosomalsecretion AT yaruchikam amphiphysin1and2interactwithlatentmembraneprotein2aofepsteinbarrvirusandregulateitsexosomalsecretion AT rynditchav amphiphysin1and2interactwithlatentmembraneprotein2aofepsteinbarrvirusandregulateitsexosomalsecretion AT skrypkinaiya amphiphysin1and2interactwithlatentmembraneprotein2aofepsteinbarrvirusandregulateitsexosomalsecretion
first_indexed	2025-07-14T09:10:28Z
last_indexed	2025-07-14T09:10:28Z
_version_	1837612903480426496
fulltext	234 GENOMICS, TRANSCRIPTOMICS AND PROTEOMICS UDC 577.22 Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion O. V. Dergai, M. V. Dergai, I. Ya. Skrypkina, L. O. Tsyba, A. M. Yaruchik, A. V. Rynditch State Key Laboratory of Molecular and Cellular Biology Institute of Molecular Biology and Genetics, NAS of Ukraine 150, Akademika Zabolotnoho Str., Kyiv, Ukraine, 03680 o.dergai@gmail.com Aim. Latent membrane protein 2A (LMP2A) of Epstein-Barr virus is implicated in the regulation of viral latency. The aim of the current study was to identify proteins interacting with proline-rich motifs of LMP2A. Methods. In silico prediction with Scansite allowed to recognize amphiphysin 1 (Amph1) as a binding partner of LMP2A. Mo- lecular cloning techniques, site-directed mutagenesis, in vitro binding assay made it possible to study the inter- action interface of Amph1/LMP2A complex. Sequential centrifugation steps were used to isolate an exosomal fraction. Results. LMP2A but not LMP2∆NT mutant has been found to bind the SH3 domain of Amph1 via three distinct proline-rich motifs located in the N-terminal tail. All three motifs seem to be interchangeable as the presence of at least one of them was sufficient to mediate LMP2A/Amph1 interaction. Furthermore, the binding of LMP2A to Amph1 and related protein amphiphysin 2 was demonstrated by co-immunoprecipitation of endoge- nous complexes. We have found that inability of LMP2A mutant to bind Amph1 leads to the vanishing of the viral protein from the exosomal fraction. Conclusions. The latent membrane protein 2A of Epstein-Barr virus forms complexes with endocytic adaptor proteins Amph1 and Amph2. Described interaction might be involved in the regulation of intracellular traffic and secretion of LMP2A. Keywords: EBV, LMP2A, Amphiphysin, exosomes. Introduction. Epstein-Barr virus (EBV) is a member of the herpesvirus family and one of the most common hu- man viruses [1]. EBV is associated with a number of hu- man malignancies, such as Burkitt’s lymphoma [2], Hodgkin’s lymphoma [3] and nasopharyngeal carcino- ma [4]. Only restricted set of viral genes is expressed wi- thin the latent phase: LMP1, LMP2A, LMP2B, EBNAs and EBERs. Latent membrane proteins (LMPs) are key players in transformation and survival of infected cells [5]. EBV latency is regulated by LMP2A and LMP2B [5]. LMP2A is a transmembrane protein comprising 12 transmembrane segments and two cytosolic tails. The N-terminal tail is responsible for LMP2A signalosome assembly and signaling, while C-terminal one mediates clusterization of LMP2A molecules [6, 7]. Cytosolic N- and C-terminal tails of LMP2A contain phosphotyrosi- ne-containing (pY) and proline-rich motifs (PRMs). Through the pY-motifs LMP2A interacts with SH2- and PTB-containing proteins [8]. Due to the binding of tyrosine kinases Syk and Lyn, LMP2A mimics activa- ted receptors and establishes its own signaling [9–11]. LMP2A-induced signaling events were uncovered in B-cells, epithelial cells and fibroblasts [5, 10]. LMP 2A activates AKT kinase providing anti-apoptotic and pro-survival signals [11, 12]. Much attention was paid to mitogenic signaling but knowledge about LMP2A internalization and traffic in EBV-positive cells is un- clear so far. Despite the presence of five putative PRMs no inter- actions with the SH3 domains have been reported. Here ISSN 0233–7657. Biopolymers and Cell. 2012. Vol. 28. N 3. P. 234–238  Institute of Molecular Biology and Genetics, NAS of Ukraine, 2012 235 AMPHIPHYSIN INTERACT WITH PROTEIN 2A OF EBV AND REGULATE ITS EXOSOMAL SECRETION we report the identification of amphiphysins 1 and 2 as protein partners of LMP2A. Inability of LMP2A mutant to interact with Amph1 affects the secretion of LMP2A on exosomes produced by HEK293 cells sug- gesting a putative role of Amph1 in LMP2A traffic. Materials and methods. Antibodies. A monoclonal antibody against FLAG epitope (clone M2) was purcha- sed from «Sigma» (USA); a monoclonal anti-Omni (D- 8) antibody and rabbit polyclonal anti-Omni antibodies (M-21) were from «Santa Cruz» (USA). DNA constructs. The construct carrying wild type LMP2A CDS [13] was used as a template for PCR amp- lification of LMP2A of wild type (1–497 aa residues), LMP2A∆NT mutant (105–497 aa residues) and derived P-to-A point mutant constructs with subsequent cloning into pcDNA4 His/MaxC («Invitrogen», USA). Site-spe- cific mutations were introduced with primer-extension method. LMP2A P2 mutant was generated using the following primers: For 5'-AACACCGCCACCGCAGC GAACGATGAGGAA, Rev 5'-TTCCTCATCGTTCG CTGCGGTGGCGGTGTT, LMP2A P3 mutant: 5'-TG AAGAGGCCGCAGCGGCTTATGAGGACCCA, Rev 5'-TCCTCATAAGCCGCTGCGGCCTCTTCATTAG, LMP2A P4 mutant: 5'-TGACGGGCTCGCTGCCGC TGCCTACTCTCCAC, Rev 5'-GTGGAGAGTAGGC AGCGGCAGCGAGCCCGTCA. The LMP2A P3 + P4 and LMP2A P2 + P3 + P4 were obtained by combining of P-to-A substitution in mentioned motifs (Fig. 1, A). The SH3 domains of Amph 1, PI3Kp85α, Src and endophilin were described previously [14–16]. Full- length CDS of Amph 1 and Amph 2 were amplified by PCR from human embryonal brain cDNA using the High Fidelity PCR enzyme mix. The PCR products were cloned into the pcDNA4 His/MaxC vector to generate Omni-Amph 1 Omni-Amph 2 respectively. All PCR- generated DNA fragments were sequenced to confirm fidelity. Immunoprecipitation. For immunoprecipitation (IP) the cells were lysed in IP buffer (20 mM Tris-HCl, pH 7.5, 0.5 % NP-40, 150 mM NaCl, 10 % glycerol, 1 mM PMSF and protease inhibitor cocktail («Roche», Fran- ce)). The HEK293 cell lysate was mixed with antibo- dies (0.5 µg) and protein A/G Agarose beads («Santa Cruz Biotechnology», USA) prewashed in IP buffer. After overnight incubation at 4 °C the beads were wa- shed three times with IP buffer. The bound proteins we- re eluted by boiling in 30 µl of Laemmli sample buffer (150 mM Tris-HCl, pH 6.8, 2.5 % glycerol, 10 % SDS, 3 % β-mercaptoethanol and 0.5 % bromophenol blue) and analyzed by SDS-PAGE and Western blotting. Cell culture and transfection. HEK293 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 % fetal calf serum («Sigma»), 50 U/ml penicillin and 100 µg/ml strepto- mycin. The cells were transiently transfected using po- lyethyleneimine transfection reagent (JetPEI, Polyplus Transfection) and processed 24 h after transfection. Protein expression, pull-down assays and Western blot analyses were carried out as described previously [14]. Exosome preparation. Exosomes were isolated as previously described [17] with minor modifications. In brief, HEK293 cells were grown to 60–70 % confluen- ce on 10 cm plates, washed twice with 1 × PBS to remo- ve secreted exosome and metabolites and supplied with fresh complete medium. Then cells were transfected with 15 µg of plasmid DNA. 24 h post-transfection cul- ture medium was collected and cleared by centrifuga- tion at 10,000 g for 10 min to remove apoptotic cells and cell fragments. Exosomes were further isolated by centrifugation at 70,000 g for 2 h (exosome fraction). Cells were lysed as described above; pelleted exosome fraction was solubilized in Laemmli buffer and analy- zed by Western blotting. Results and discussion. The aim of the current stu- dy was to identify proteins that bind directly PRMs lo- cated in LMP2A cytosolic tails. The canonical binding site for SH3 domains is PXXP (where X-any amino acid) [18]. Five motifs fitting PXXP consensus were found in the primary structure of LMP2A protein: four motifs (designated P1–P4) in the N-terminal domain and one (P5) in the C-terminal one. In silico analysis with Scansite service (www.scansite.mit.edu) eviden- ced for the presence of at least four motifs (P2, P3, P4 and P5) for binding the SH3 domain of endocytic adap- tor protein Amph1. To validate this interaction we per- formed GST pull-down assay. We have found that the SH3 domain of Amph1 bound Omni-LMP2A, while it was unable to interact with LMP2A∆NT variant that represents the LMP2B isoform, an important negative regulator of LMP2A-dependent signaling (Fig. 1, B). Thus, P5 motif is dispensable to mediate interaction 236 DERGAI O. V. ET AL. between LMP2A and Amph1. We also tested ability of LMP2A to bind the SH3 domains of other proteins: en- dophilin, Src kinase and p85 regulatory subunit of PI3K. As Fig. 1, C, shows, LMP2A failed to interact with the proteins mentioned above. This fact could evidence for the specificity of LMP2A/Amph1 interaction. Further, we decided to determine which of four po- tential PRMs found in the N-terminus of LMP2A me- diates this interaction. For this aim, prolines in motifs P2, P3 and P4 individually or in combinations P3 + + P4, P2 + P3 + P4 were substituted for alanines. The P1 motif was considered less probable for binding be- cause the sequence of this PRM differs significantly from the consensus. The core motif in P1 is flanked with numerous glycines that is very unusual for classic PRMs, which are typically surrounded with charged amino acid residues [18]. The individual mutations in motifs P2, P3 and P4 had moderate effect on LMP2A binding to the SH3 domain of amphiphysin 1 (Fig. 1, D). P3 + P4 LMP2A mutant also bound to the SH3 domain of Amph1 (Fig. 1, D, lane 5) whereas P2 + P3 + P4 mutant of LMP2A was unable to interact with Amph1 (Fig. 1, E). Thus, one can suggest that Amph1 can bind any of three PRMs (P2–P4) in the N-terminal tail of LMP2A. All three mo- tifs seem to be interchangeable as presence of at least one of them was sufficient to mediate LMP2A/Amph1 complex formation. Moreover, LMP2A was shown to form a complex in vivo with Amph1 as well as with a highly related Amph2 (Fig. 2, A) in HEK293 cells transiently transfected with corresponding recombinant plasmids. The data obtai- ned may link LMP2A to the endocytic compartment, enabling viral protein to be effectively internalized from the cell surface. Previously, LMP2A was detected in the cytoplasm in the association with different types of vesicles presumably derived from the plasma mem- brane. LMP2A is secreted on exosome pathway by dif- ferent cell types [17]. Exosomes are membrane vesicles of endocytic origin after they have passed through mul- tivesicular body [19]. We decided to determine whe- 72 56 35 25 72 56 35 25 35 25 72 56 35 35 25 56 45 35 LMP2A P1 P2 P3 P4 P5 PPSP PTPP PPPPY PPPPY PPTP PPSP ATAA PPPPY PPPPY PPTP LMP2A∆NT (LMP2B) LMP2A P2 LMP2A P3 LMP2A P4 LMP2A P3+P4 LMP2A P2+P3+P4 PPTP PPSP PTPP AAAAY PPPPY PPTP PPSP PTPP PPPPY AAAAY PPTP PPSP PTPP AAAAY AAAAY PPTP PPSP ATAA AAAAY AAAAY PPTP TCL GST Amph1 TCL GST Amph1 LMP2A LMP2A∆NT ← Omni-LMP2A ← Omni-LMP2A∆NT ← GST-SH3-Amph1 ← GST Endo- philin Src p85a GST TCL ← Omni-LMP2A ← GST-SH3 ← GST GST P2 P3 P4 P3+P4 LMP2A ← Omni-LMP2A GST TCL wt P2+P3+P4 LMP2A ← Omni-LMP2A ← GST-SH3-Amph1 ← GST kDa kDa kDa kDa A B C D E ← GST ← GST-SH3-Amph1 Fig. 1. LMP2A interacts with the SH3 domain of Amph1: A – schematic presentation of LMP2A and derived mutants (grey rectangles represent transmembrane segments, P1–P5 de- signated proline-rich motifs); B – lysates of HEK293 cells transiently transfected with Omni-LMP2A or Omni-LMP2A∆NT were incubated with the GST-SH3 domain of Amph1 or GST alone immobilized on gluta- thione Sepharose beads (protein complexes were eluted and analyzed by Western blotting; proteins were visualized as indicated in the figure; TCL – total cell lysate); C – GST- fused SH3 domains of specified pro- teins were used as a bait to precipi- tate Omni-LMP2A; D, E – GST- SH3 domain of Amph1 or GST alo- ne coupled to glutathione-Sepharose beads were incubated with lysates of cells transfected with indicated at the figure LMP2A point mutants; B, D – WB: anti-Omni, Ponceau S stai- ning; C, E – WB: nti-Omni, Coomas- sie staining ther inability of LMP2A to interact with Amph1 affects secretion of LMP2A on exosomes produced by HEK 293 cells. The wild type LMP2A was found in the exo- somal fraction as well as inside of cells, while LMP2A P2 + P3 + P4 had not been detected on exosomes (Fig. 2, B). These data imply a role of interaction between LMP2A and Amph1 for intracellular traffic of LMP2A. The current comprehension of composition of the LMP2A-mediated signalosome and mechanisms of its traffic through the cell remains unclear. Amphiphysins are adaptor proteins that have been implicated in clath- rin-mediated endocytosis, regulation of actin cytoskele- ton and cellular signaling [20–23]. Amph2 was shown to bind Myc oncoprotein and to function as onco-sup- pressor [24]. It is possible to speculate that the role of LMP2A in lymphogenesis is not restricted to providing pro-survival stimuli for the cells but also involves dere- gulation of Amph2/BIN function that leads to the inhibi- tion its tumor-suppressing activity. Answers for this question might help to improve the- rapy of EBV-associated lymphomas and make our know- ledge deeer in the field of host-pathogen interactions. Acknowledgements. We are grateful to Dr. O. S’edin for providing expertise and help in ultracentrifugation procedures. We thank Dr. G. Winberg and Dr. L. Mats- kova for generous gift of pCMV-FLAG-LMP2A plas- mid and for stimulating discussions. This work was sup- ported by INTAS Grant (N 05-1000004-7762). OVD is a fellow of Visby Scholarship of Swedish Institute. О. В. Дер гай, М.В. Дер гай, І. Я. Скрип ки на, Л. О. Циба, А. М. Яру чик, А. В. Рин дич Амфіфізин 1 и 2 взаємодіють з ла тен тним мем бран ним білком 2А (LMP2A) вірусу Епштей на-Барр і ре гу лю ють його сек рецію Ре зю ме Ла тен тний мем бран ний білок 2А (LMP2A) вірусу Епштей на-Барр є важ ли вим ре гу ля то ром ла тен тної фази вірус ної інфекції. Мета. Іден тифіку ва ти білки, які взаємодіють з пролін-зба га че ни ми мо- ти ва ми LMP2A. Ме то ди. Аналіз in silico за до по мо гою про грам - но го за без пе чен ня Scansite доз во лив пе ре дба чи ти мож ливість взаємодії амфіфізину 1 (Amph1) і LMP2A. Ви ко рис та но за галь но при й няті техніки мо ле ку ляр но го кло ну ван ня, сайт-спря мо ва ний му та ге нез і тест на взаємодію in vitro для под аль шо го дослід- жен ня струк тур них основ взаємодії ком плек су LMP2A/Amph1. Фракцію ек зо сом от ри ма но за до по мо гою послідов них цен три фу- гувань. Ре зуль та ти. По ка за но, що ізо фор ма LMP2A, але не LMP2А ∆NT взаємодіє з до ме ном SH3 амфіфізину 1. Ви яв ле на взаємодія опо се ред ко вується трьо ма різни ми пролін-зба га че ни ми мо ти ва - ми, роз та шо ва ни ми в N-кінцевій ділянці LMP2A. Всі три мо ти ви є взаємо замінни ми, оскільки при сутність хоча б од но го з них є до- стат ньою для реалізації зв’я зу ван ня LMP2A з Amph1. Нами про де- мо нстро ва но взаємодію Amph1 і ви со кос порідне но го з ним Amph2 з LMP2A за до по мо гою ко-іму ноп ре ципітації ен до ген них комп- лексів. Му тант LMP2A за проліно ви ми мо ти ва ми не взаємодіяв з Amph1, що спри чи ня ло зник нен ня його з фракції ек зо сом. Вис нов- ки. Ла тен тний мем бран ний білок 2А вірусу Епштей на-Барр утво- рює ком плек си з ен до ци тоз ни ми адап тер ни ми білка ми Amph1 і Amph2. Іден тифіко вані нові пар тне ри LMP2A мо жуть впли ва ти на його внутрішньоклітин ний трафік та сек рецію. Клю чові сло ва: вірус Эпштей на-Бар ра, LMP2A, амфіфізин, ек зо соми. А. В. Дер гай, Н. В. Дер гай, И. Я. Скрип ки на, Л. А. Циба, А. М. Яру чик, А. В. Рын дич Амфифизин 1 и 2 вза и мо де йству ют с ла тентным мем бран ным бел ком 2А (LMP2A) ви ру са Эпштей на-Барр и ре гу ли ру ют его сек ре цию Ре зю ме Ла тен тный мем бран ный бе лок 2А ви ру са Эпштей на-Барр яв ля - ет ся клю че вым ре гу ля то ром ла тен тной фазы ви рус ной ин фек - ции. Цель. Иден ти фи ци ро вать бел ки, спо соб ные свя зы вать ся с про лин-об ога щен ны ми мо ти ва ми LMP2A. Ме то ды. Анализ in silico при по мо щи про грам мно го об ес пе че ния Scansite по зво лил пред ска зать вза и мо де йствие ам фи фи зи на 1 (Amph1) и LMP2A. Исполь зо ва ны стан дар тные ме то ды мо ле ку ляр но го кло ни ро ва - ния, сайт-на прав лен ный му та ге нез и тест на вза и мо де йствие in vitro для по сле ду ю ще го из уче ния струк тур ных основ вза и мо де - йствия ком плек са LMP2A/Amph1. Фрак цию эк зо сом по лу ча ли при по мо щи по сле до ва тель ных цен три фу ги ро ва ний. Ре зуль та ты. По ка за но, что изо фор ма LMP2A, но не LMP2А∆NT вза и мо дей- ству ет с до ме ном SH3 Amph1. Вы яв лен ное вза и мо де йствие опос - ре ду ет ся тре мя раз ны ми про лин-об ога щен ны ми мо ти ва ми, рас - по ло жен ны ми в N-кон це вом учас тке LMP2A. Все три мо ти ва 237 AMPHIPHYSIN INTERACT WITH PROTEIN 2A OF EBV AND REGULATE ITS EXOSOMAL SECRETION 72 5672 56 120 100 72 56 120 100 72 56 72 56 kDa ← FLAG-LMP2A ← Omni-Amph1 ← Omni-Amph2 ← FLAG-LMP2A ← Omni-Amph1 ← Omni-Amph2 ← Omni- LMP2A IP: anti-Omni TCL Cells Exosomes kDa A B Fig. 2. Amph1 and 2 form complex with LMP2A in vivo: A – HEK293 cells were co-tranfected with FLAG-LMP2A and Omni-Amph1 or Om- ni-Amph2 (the lysates of transfected cells were subjected to immuno- precipitation with rabbit polyclonal anti-Omni antibodies; proteins we- re eluted, resolved by SDS-PAGE and immunoblotted with indicated antibodies: Omni-Amph1 and Omni-Amph2 detected with mouse mo- noclonal anti-Omni, FLAG-LMP2A with mouse monoclonal anti- FLAG); B – immunodetection of Omni-LMP2A and its mutant in ly- sates of transfected cells and exosomal fraction 238 DERGAI O. V. ET AL. яв ля ют ся вза и мо за ме ня е мы ми, так как при су тствия хотя бы одно- го из них ока зы ва ет ся дос та точно для ре а ли за ции свя зы ва ния LMP2A с Amph1. Нами про де мо нстри ро ва но свя зы ва ние Amph1 и ро дствен но го ему Amph2 с LMP2A при по мо щи ко-им му ноп ре ци - пи та ции эн до ген ных ком плек сов. Му тант LMP2A по про ли но вым мо ти вам не вза и мо де йство вал с Amph1, что при ве ло к ис чез но ве - нию его из фрак ции эк зо сом. Вы во ды. Ла тен тный мем бран ный бе лок 2А ви ру са Эпштей на-Барр об ра зу ет ком плек сы с эн до ци - тоз ны ми адап тер ны ми бел ка ми Amph1 и Amph2. Иден ти фи ци ро - ван ные но вые пар тне ры LMP2A мо гут вли ять на его внут рик ле- точ ный тра фик и сек ре цию. Клю че вые сло ва: ви рус Эпштей на-Барр, LMP2A, ам фи фи зин, эк зо сомы. REFERENCES 1. Kieff E., Liebowitz D. Epstein-Barr virus and its replication // Fields virology / Eds B. N. Fields, D. M. Knipe.–New York: Raven Press, 1990.–P. 1889–1920. 2. Callan M. F., Tan L., Annels N., Ogg G. S., Wilson J. D., O’Callaghan C. A., Steven N., McMichael A. J., Rickinson A. B. Direct visualization of antigen-specific CD8+T cells during the primary immune response to Epstein-Barr virus in vivo // J. Exp. Med.–1998.–187, N. 9.–P. 1395–1402. 3. Chapman A. L., Rickinson A. B. Epstein-Barr virus in Hodgkin’s disease // Ann. Oncol.–1998.–9, Suppl. 5.–S 5–16. 4. Chen F., Hu L. F., Ernberg I., Klein G., Winberg G. Coupled transcription of Epstein-Barr virus latent membrane protein (LMP)-1 and LMP-2B genes in nasopharyngeal carcinomas // J. Gen. Virol.–1995.–76, pt 1.–P. 131–138. 5. Thorley-Lawson D. A. Epstein-Barr virus: exploiting the immu- ne system // Nat. Rev. Immunol.–2001.–1, N 1.–P. 75–82. 6. Longnecker R., Kieff E. A second Epstein-Barr virus membrane protein (LMP2) is expressed in latent infection and colocalizes with LMP1 // J. Virol.–1990.–64, N 5.–P. 2319–2326. 7. Matskova L., Ernberg I., Pawson T., Winberg G. C-terminal do- main of the Epstein-Barr virus LMP2A membrane protein con- tains a clustering signal // J. Virol.–2001.–75, N 22.–P. 10941– 10949. 8. Rovedo M., Longnecker R. Epstein-Barr virus latent membrane protein 2A preferentially signals through the Src family kinase Lyn // J. Virol.–2008.–82, N 17.–P. 8520–8528. 9. Ingham R. J., Raaijmakers J., Lim C. S., Mbamalu G., Gish G., Chen F., Matskova L., Ernberg I., Winberg G., Pawson T. The Epstein-Barr virus protein, latent membrane protein 2A, co-opts tyrosine kinases used by the T cell receptor // J. Biol. Chem.– 2005.–280, N 40.–P. 34133–34142. 10. Merchant M., Longnecker R. LMP2A survival and develop- mental signals are transmitted through Btk-dependent and Btk- independent pathways // Virology.–2001.–291, N 1.–P. 46–54. 11. Swart R., Ruf I. K., Sample J., Longnecker R. Latent membrane protein 2A-mediated effects on the phosphatidylinositol 3-Kina- se/ Akt pathway // J. Virol.–2000.–74, N 22.–P. 10838–10845. 12. Matskova L. V., Helmstetter C., Ingham R. J., Gish G., Lindholm C. K., Ernberg I., Pawson T., Winberg G. The Shb signalling scaffold binds to and regulates constitutive signals from the Eps- tein-Barr virus LMP2A membrane protein // Oncogene.–2007.– 26, N 34.–P. 4908–4917. 13. Winberg G., Matskova L., Chen F., Plant P., Rotin D., Gish G., Ingham R., Ernberg I., Pawson T. Latent membrane protein 2A of Epstein-Barr virus binds WW domain E3 protein-ubiquitin ligases that ubiquitinate B-cell tyrosine kinases // Mol. Cell. Biol.–2000.–20, N 22.–P. 8526–8535. 14. Dergai M., Skrypkina I., Dergai O., Tsyba L., Novokhatska O., Filonenko V., Drobot L., Rynditch A. Identification and charac- terization of a novel mammalian isoform of the endocytic adap- tor ITSN1 // Gene.–2011.–485, N 2.–P. 120–129. 15. Dergai M., Tsyba L., Dergai O., Zlatskii I., Skrypkina I., Kova- lenko V., Rynditch A. Microexon-based regulation of ITSN1 and Src SH3 domains specificity relies on introduction of charged amino acids into the interaction interface // Biochem. Biophys. Res. Commun.–2010.–399, N 2.–P. 307–312. 16. Dergai O., Novokhatska O., Dergai M., Skrypkina I., Tsyba L., Moreau J., Rynditch A. Intersectin 1 forms complexes with SGIP1 and Reps1 in clathrin-coated pits // Biochem. Biophys. Res. Commun.–2010.–402, N 2.–P. 408–413. 17. Ikeda M., Longnecker R. Cholesterol is critical for Epstein-Barr virus latent membrane protein 2A trafficking and protein stabili- ty // Virology.–2007.–360, N 2.–P. 461–468. 18. Zarrinpar A., Bhattacharyya R. P., Lim W. A. The structure and function of proline recognition domains // Sci. SRKE.–2003.– 2003, N 179.–re8. 19. Keller S., Sanderson M. P., Stoeck A., Altevogt P. Exosomes: from biogenesis and secretion to biological function // Immunol. Lett.–2006.–107, N 2.–P. 102–108. 20. Yamada H., Ohashi E., Abe T., Kusumi N., Li S. A., Yoshida Y., Watanabe M., Tomizawa K., Kashiwakura Y., Kumon H., Matsui H., Takei K. Amphiphysin 1 is important for actin polymeriza- tion during phagocytosis // Mol. Biol. Cell.–2007.–18, N 11.– P. 4669–4680. 21. Wu Y., Liang S., Oda Y., Ohmori I., Nishiki T., Takei K., Matsui H., Tomizawa K. Truncations of amphiphysin I by calpain inhi- bit vesicle endocytosis during neural hyperexcitation // EMBO J.–2007.–26, N 12.–P. 2981–2990. 22. Shang W. H., Adachi Y., Nakamura A., Copeland T., Kim S. R., Kamata T. Regulation of amphiphysin1 by mitogen-activated protein kinase: its significance in nerve growth factor recep- tor-mediated endocytosis // J. Biol Chem.–2004.–279, N 39.– P. 40890–40896. 23. Peter B. J., Kent H. M., Mills I. G., Vallis Y., Butler P. J., Evans P. R., McMahon H. T. BAR domains as sensors of membrane curvature: the amphiphysin BAR structure // Science.–2004.– 303, N 5657.–P. 495–499. 24. Lundgaard G. L., Daniels N. E., Pyndiah S., Cassimere E. K., Ahmed K. M., Rodrigue A., Kihara D., Post C. B., Sakamuro D. Identification of a novel effector domain of BIN1 for cancer sup- pression // J. Cell. Biochem.–2011.–112, N 10.–P. 2992–3001. Received 10.05.11

Amphiphysin 1 and 2 interact with latent membrane protein 2A of Epstein-Barr virus and regulate its exosomal secretion

Institution

Ähnliche Einträge