Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer?
Aim of this article is to determine the quantitative gene expression of KRAS codon 12 mutant, TACSTD2, Ku70 and SERIN1 in samples of tumor tissue and to relate them with clinical-pathological characteristics of colorectal cancer.
Gespeichert in:
| Datum: | 2011 |
|---|---|
| Hauptverfasser: | , , , , , |
| Format: | Artikel |
| Sprache: | English |
| Veröffentlicht: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2011
|
| Schriftenreihe: | Experimental Oncology |
| Schlagworte: | |
| Online Zugang: | http://dspace.nbuv.gov.ua/handle/123456789/32315 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? / T.L. Ghezzi, I.S. Brum, V. Biolchi, B. Garicochea, L.S. Fillmann, O.C. Corleta // Experimental Oncology. — 2011. — Т. 33, № 1. — С. 28–32. — Біліогр.: 33 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-32315 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-323152012-04-17T12:27:19Z Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? Ghezzi, T.L. Brum, I.S. Biolchi, V. Garicochea, B. Fillmann, L.S. Corleta, O.C. Original contributions Aim of this article is to determine the quantitative gene expression of KRAS codon 12 mutant, TACSTD2, Ku70 and SERIN1 in samples of tumor tissue and to relate them with clinical-pathological characteristics of colorectal cancer. 2011 Article Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? / T.L. Ghezzi, I.S. Brum, V. Biolchi, B. Garicochea, L.S. Fillmann, O.C. Corleta // Experimental Oncology. — 2011. — Т. 33, № 1. — С. 28–32. — Біліогр.: 33 назв. — англ. 1812-9269 http://dspace.nbuv.gov.ua/handle/123456789/32315 en Experimental Oncology Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Original contributions Original contributions |
| spellingShingle |
Original contributions Original contributions Ghezzi, T.L. Brum, I.S. Biolchi, V. Garicochea, B. Fillmann, L.S. Corleta, O.C. Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? Experimental Oncology |
| description |
Aim of this article is to determine the quantitative gene expression of KRAS codon 12 mutant, TACSTD2, Ku70 and SERIN1 in samples of tumor tissue and to relate them with clinical-pathological characteristics of colorectal cancer. |
| format |
Article |
| author |
Ghezzi, T.L. Brum, I.S. Biolchi, V. Garicochea, B. Fillmann, L.S. Corleta, O.C. |
| author_facet |
Ghezzi, T.L. Brum, I.S. Biolchi, V. Garicochea, B. Fillmann, L.S. Corleta, O.C. |
| author_sort |
Ghezzi, T.L. |
| title |
Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? |
| title_short |
Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? |
| title_full |
Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? |
| title_fullStr |
Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? |
| title_full_unstemmed |
Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? |
| title_sort |
is there any association between tacstd2, kiaa1253, ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? |
| publisher |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| publishDate |
2011 |
| topic_facet |
Original contributions |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/32315 |
| citation_txt |
Is there any association BETWEEN TACSTD2, KIAA1253, Ku70 and mutant kras gene expression and clinical-pathological features of colorectal cancer? / T.L. Ghezzi, I.S. Brum, V. Biolchi, B. Garicochea, L.S. Fillmann, O.C. Corleta // Experimental Oncology. — 2011. — Т. 33, № 1. — С. 28–32. — Біліогр.: 33 назв. — англ. |
| series |
Experimental Oncology |
| work_keys_str_mv |
AT ghezzitl isthereanyassociationbetweentacstd2kiaa1253ku70andmutantkrasgeneexpressionandclinicalpathologicalfeaturesofcolorectalcancer AT brumis isthereanyassociationbetweentacstd2kiaa1253ku70andmutantkrasgeneexpressionandclinicalpathologicalfeaturesofcolorectalcancer AT biolchiv isthereanyassociationbetweentacstd2kiaa1253ku70andmutantkrasgeneexpressionandclinicalpathologicalfeaturesofcolorectalcancer AT garicocheab isthereanyassociationbetweentacstd2kiaa1253ku70andmutantkrasgeneexpressionandclinicalpathologicalfeaturesofcolorectalcancer AT fillmannls isthereanyassociationbetweentacstd2kiaa1253ku70andmutantkrasgeneexpressionandclinicalpathologicalfeaturesofcolorectalcancer AT corletaoc isthereanyassociationbetweentacstd2kiaa1253ku70andmutantkrasgeneexpressionandclinicalpathologicalfeaturesofcolorectalcancer |
| first_indexed |
2025-07-03T12:49:49Z |
| last_indexed |
2025-07-03T12:49:49Z |
| _version_ |
1836630136721506304 |
| fulltext |
28 Experimental Oncology 33, 28–32, 2011 (March)
IS THERE ANY ASSOCIATION BETWEEN TACSTD2, KIAA1253,
KU70 AND MUTANT KRAS GENE EXPRESSION AND CLINICAL-
PATHOLOGICAL FEATURES OF COLORECTAL CANCER?
T.L. Ghezzi1,*, I.S. Brum2, V. Biolchi2, B. Garicochea3, L.S. Fillmann4, O.C. Corleta1
1Postgraduate Program in Medicine: Surgical Sciences, Federal University of Rio Grande do Sul, Ramiro
Barcelos Street 2400 , Porto Alegre, RS, 90035-003, Brazil
2Laboratory of Endocrine and Tumoral Molecular Biology, Federal University of Rio Grande do Sul,
Sarmento Leite Street 500, Porto Alegre, RS, 90050-170, Brazil
3Institute of Biomedical Research of Sao Lucas Hospital, Pontificia Catholic University of Rio Grande
do Sul, Ipiranga Avenue 6690, Porto Alegre, RS, 90610-000, Brazil
4Colorectal Surgery Division of Sao Lucas Hospital, Pontificia Catholic University of Rio Grande do Sul,
Ipiranga Avenue 6690, Porto Alegre, RS, 90610-000, Brazil
Aim: To determine the quantitative gene expression of KRAS codon 12 mutant, TACSTD2, Ku70 and SERIN1 in samples of tumor
tissue and to relate them with clinical-pathological characteristics of colorectal cancer. Methods: Samples of tumor and normal tis-
sue of patients surgically treated for colorectal cancer between July 2005 and July 2009 were stored in a tissue bank. These samples
were studied with the technique of real-time polymerase chain reaction in respect to expression of the following genes: KRAS codon
12 mutation, TACSTD2, Ku70, and SERIN1. Results: Tumor samples of 37 patients were studied. The mean age was 65.5 years.
Twenty one patients (56.8%) were male. Nine patients (24.3%) were classified as TNM stage I, 11 patients (29.8%) as TNM stage II,
eight patients (21.6%) as TNM stage III and nine patients (24.3%) as TNM stage IV. The Ku70 expression in poorly-differentiated
tumors is significantly higher than in well and moderately-differentiated tumors (2.76 vs. 1.13; p < 0.05). SERIN1, TACSTD2 and
KRAS codon 12 mutation are not associated with clinical-pathological characteristics of colorectal cancer. Conclusion: Ku70 expres-
sion in poorly-differentiated tumors is significantly higher than in well and moderately-differentiated colorectal tumors.
Key Words: gene expression, neoplasm staging, polymerase chain reaction, intestine, molecular biology.
Genetic disorders play a key role in the colorectal
carcinogenesis, either in its initiation or its progression
[1]. During the last years experts in colorectal cancer
(CRC) have focused its attention mainly over the KRAS
gene. KRAS mutations are observed in around 40%
of CRC [2–5]. About 90% of these mutations occur in the
codons 12 (70–80%) and 13 (20–30%) [2, 6, 7]. It has
been demonstrated that mutations on codon 12 are as-
sociated with a poorer prognosis of CRC [3]. For this
reason, many authors currently are looking for new genes
potentially associated to the clinical-pathological fea-
tures and the prognosis of patients with CRC.
The tumor-associated calcium signal transducer
(TACSTD2), also known as TROP2, is located on chro-
mosome 1 (1p32–1p31) [5]. TACSTD2 overexpression
has been observed in most human carcinomas and
proposed as a possible stimulus for growth and tumor
development [8–14]. Its overexpression has been as-
sociated with decreased overall survival, increased rate
of CRC-related-death, and higher risk of liver metastasis
[8, 15, 16]. The Ku70 protein is a homonymous polypep-
tide of 70 kDa. It is an antiapoptotic protein that plays
an essential role in the repair of DNA double strand break
damage induced by ionizing radiation in mammalian cells
[17–19]. It was demonstrated that Ku70 expression is as-
sociated with decreased disease-free-survival in CRC
and with impaired response to radiotherapy in rectal can-
cer patients [20–21]. The SERIN1 expression, not widely
studied yet, seems also related to the prognosis of CRC
patients, specifically with the overall survival at 36 months
[22]. The aim of this study is to evaluate the association
between KRAS codon 12 mutation, TACSTD2, Ku70 and
SERIN1 expression, and clinical-pathological characte-
ristics with prognostic relevance.
MATERIALS AND METHODS
Population and samples. This is a cross-sectional
study which enrolled patients with CRC who were
surgically treated at the Division of Colorectal Surgery
of Hospital São Lucas, Pontificia Catholic University
of Rio Grande do Sul, between July 2005 and July
2009. Samples of 1 cm2 were taken from the center
of the resected tumor, immediately frozen in liquid
nitrogen, and subsequently stored in a tissue bank
at — 80 °C as described previously [23–25]. Patients
who underwent neoadjuvant radiochemotherapy, with
familial adenomatous polyposis, hereditary nonpol-
yposis CRC, inflammatory bowel disease, synchronic
or previous CRCs, any synchronic or previous cancer,
incomplete data or with no expression of the positive
control gene (β2-microglobulin) were excluded. All pa-
tients signed an informed consent form for the collec-
tion, storage and studying of their samples. The study
protocol was approved by the local ethics committee.
Received: November 22, 2010.
*Correspondence:Fax: +55-21-51 33118151
E-mail: tiago.lealghezzi@ieo.it/tlghezzi@terra.com.br
Abbreviations used: CRC – colorectal cancer; CEA – carcinoembryonic
antigen; PCR – polymerase chain reaction; AJCC – American Joint
Committee on Cancer
Exp Oncol 2011
33, 1, 28–32
29 Experimental Oncology 33, 28–32, 2011 (March)
Clinical staging and pathological examination.
Preoperative oncological workup included colonoscopy,
computerized tomography and/or ultrasonography
of the abdomen, and chest radiography and/or com-
puterized tomography. Right and left-sided cancers
were defined as cancer located respectively proximal
and distal to the splenic flexure. Rectal cancer was
defined as that situated under the sacral promontory.
Pathological examinations were performed by the same
pathologist according to the International Classification
of Diseases for Oncology. Gene expression was com-
pared to the following clinical-pathological features:
age, gender, race, preoperative measurement of the
carcinoembryonic antigen (CEA), tumor location, TNM
classification, American Joint Committee on Cancer
(AJCC) stage, liver and lung metastasis, tumor grade,
vascular invasion, and mucus production [26].
Technique of molecular analysis. The RNA extrac-
tions were performed with Trizol (Trizol® Reagent, Invi-
trogen, USA) from a sample of 100 mg of tumor tissue,
according to the manufacturer’s instructions. The quantity
and quality of RNA were determined with spectropho-
tometry (Gene Quant®, Pharmacia Biotech, USA), from
duplicate aliquots of 1 ml of solution. The synthesis
of complementary DNA (cDNA) was performed from
2 mg of the total RNA through polymerase chain reaction
(PCR) with reverse transcription (SuperScript First-Strand
Synthesis System®, Invitrogen, USA). The real-time PCRs
were performed with the DNA Engine Opticon 2 Real-Time
PCR System® (Bio-Rad, USA). The final volume per reac-
tion was 25 μl, containing 2 μl of cDNA diluted 10 times,
0.1 μM of primer sense and antisense, 12.5 μl of Platinun-
SybrGreen qPCR Supermix-UDG® and ultrapure water
q.s.p. β2-microglobulin served as a positive control in each
experiment, while PCR reagents without template were run
in parallel as no template controls. The conditions of the
reactions were: 94 °C (2 min), 94 °C (50 s), X °C (45 s),
72 °C (45 s), followed by 45 cycles with a final extension
of 2 min at 72 °C and melting curve of 56 to 96 °C (increas-
ing by 0.5 °C each 10 s). Primers sequences were TAC-
STD2 (sense: TGACCTCCAAGTGTCTGCTG/ antisense:
GTCGTAGAGGCCATCGTTGT), Ku70 (sense: CCACAG-
GAAGAAGAGTTGGA / antisense: CTGCTCTGGAGTTGC-
CATGA), SERIN1 (sense: TGATGGATCACTGGAGGATG /
antisense: AGCATGAAGTGAAAGAAGGA) and KRAS
codon 12 (sense: GACTGAATATAAACTTGTGG / antisense:
CCAGGTCCTGGTAAGAAACT). The annealing tempera-The annealing tempera-
ture was 57 °C for all genes, except for SERIN1 (54 °C).
Statistical analysis. The SPSS® software, version
15.0, was used for statistical analysis. Mann — Whitney
and the Kruskal — Wallis tests were used to compare
categorical and quantitative variables, respectively. Pear-
son’s correlation coefficient was used to compare non-
parametric quantitative variables. The p values < 0.05 were
considered to indicate statistical significance.
RESULTS AND DISCUSSION
In molecular study samples from 37 patients were
analyzed. The exclusion criterion adopted aimed to select
a homogeneous sample, composed exclusively of sub-
jects with sporadic CRC. Once it is known that the chemo-
radiotherapy reduces the amount of tumor cells and
interferes in the performance of the PCR assay, we de-
cided to exclude patients who underwent preoperative
chemoradiotherapy. That is the reason why the sample
studied showed fewer rectal tumors (18.9%) than usually
described in other publications [6]. The sample fixation
in formalin can chemically modified the DNA structure
and interfere in the reaction efficiency. For this reason,
we used fresh frozen samples instead of formalin-fixed
paraffin-embedded tumor samples [27]. Patients’
demographic and clinical data and tumor pathological
features are summarized in Table 1. Two patients (5.4%)
had peritoneal implants diagnosed during the surgery,
while one patient (2.7%) had lung metastasis discovered
during the clinical staging.
Table 1. Clinical-pathological characteristics
N = 37 (%)
Gender
• Male
• Female
21(56.8)
16 (43.2)
Age (years) a 65.5 (12.1)
Race
• Caucasian
• African-American
• Asian
34 (91.9)
1 (2.7)
2 (5.4)
Preoperative CEA (ng/mL) b 2.5 (1.0; 5.4)
Tumor location
• Right colon
• Left colon
• Rectum
12 (32.4)
18 (48.7)
7 (18.9)
Category T (TNM)
• T1
• T2
• T3
• T4
7 (18.9)
2 (5.4)
27 (73.0)
1 (2.7)
Category N (TNM)
• N0
• N1
• N2
20 (54.1)
13 (35.1)
4 (10.8)
Category M (TNM)
• M0
• M1
9 (24.4)
28 (75.6)
Liver metastasis
• Absence
• Presence
31 (83.6)
6 (16.2)
AJCC stage
• I
• II
• III
• IV
7 (24.3)
11 (29.8)
8 (21.6)
9 (24.3)
Tumor grade
• G1 or G2
• G3
35 (94.6)
2 (5.4)
Vascular invasion
• Presence
• Absence
7 (18.9)
30 (81.1)
Mucus production
• Presence
• Absence
5 (13.5)
32 (86.5)
Note: G1: well-differentiated; G2: moderately-differentiated; G3: poorly-dif--differentiated; G2: moderately-differentiated; G3: poorly-dif-; G2: moderately-differentiated; G3: poorly-dif-moderately-differentiated; G3: poorly-dif-
ferentiated; amean (standard deviation) value expressed; bmedian (25% and
75% quartile) value expressed.
Male patients with CRC showed a higher TACSTD2 and
SERIN1 expression than women (TACSTD2 = 2.04 vs.
0.56, p = 0.381; and SERIN1 = 1.79 vs. 1.59, p = 0.415).
This tendency is opposite to that observed in respect
to Ku70 expression (male: 1.02 vs. female: 1.18, p =
0.307) and KRAS codon 12 mutation (male: 0.42 vs.
30 Experimental Oncology 33, 28–32, 2011 (March)
female: 0.48, p = 0.817). Despite these facts the associa-
tions between gene expressions and gender were not
statistically significant. TACSTD2, SERIN1 and KRAS co-
don 12 mutation expressions were inversely proportional
to patient’s age (rs = – 0.217, rs = – 0.193 and rs = – 0.146,
respectively) and were also not statistically significant
(p = 0.332, p = 0.306 and p = 0.460 respectively).
The Ku70 quantitative expression was directly pro-
portional to patient’s age, but with a low grade of cor-
relation (rs = 0.041), and no statistical significance
(p = 0.824). Fig. illustrates Ku70 real-time PCR results.
Distal tumors presented higher expression
of TACSTD2 (rectum = 4.99 vs. left colon = 1.67 vs.
right colon = 0.57, p = 0.236), while proximal tumors
tend to present higher expression of Ku70 (right colon
= 1.85 vs. left colon = 1.13 vs. rectum = 0.78, p = 0.413).
SERIN1 and KRAS codon 12 mutation did not show
a pattern of quantitative gene expression according
to tumor localization (right colon = 1.88 and 0.48 vs. left
colon = 2.78 and 0.22 vs. rectum = 2.00 and 0.69, p =
0.747 and 0.337, respectively). Gene expressions and
CEA preoperative measurement showed low correlation
and no statistically significant association. Data regard-
ing the correlation between gene expression and quan-
titative variables, age and CEA, are shown in Table 2.
Table 2. Correlation between quantitative variables and gene expressions
TACSTD2 KU70 SERIN1 KRAS codon 12
rs p rs p rs p rs p
Age -0.217 0.332 0.041 0.824 -0.193 0.306 -0.146 0.460
CEA 0.088 0.729 -0.108 0.607 0.210 0.337 -0.351 0.118
TACSTD2 and Ku70 quantitative expression were
lower in tumors with vascular invasion on histopathol-
ogy examination (0.04 vs. 0.95, p = 0.557; and 0.72 vs.
1.18; p = 0.381, respectively). This finding is contrary
to that observed in respect to SERIN1 (4.90 vs. 1.37, p
= 0.649) and KRAS codon 12 mutation (0.48 vs. 0.42,
p = 0.874) expressions. The Ku70 expression in poorly-
differentiated tumors is statistically higher than in well
and moderately-differentiated tumors (2.76 vs. 1.13,
p = 0.030). No association was observed between
tumor grade and TACSTD2, SERIN1 and KRAS codon
12 mutation. Lower quantitative expression of all genes
was observed among tumors with intra or extra-cellular
mucus production (TACSTD2 = 0.33 vs. 0.95, p = 0.312;
Ku70 = 0.90 vs. 1.17, p = 0.392; SERIN1 = 1.29 vs.
1.92, p = 0,839): KRAS codon 12 mutation = 0.33 vs.
0.45, p = 0.762).
With regard to category T, tumors with deep-
er invasion of the colorectal wall revealed higher
TACSTD2 expression (T1 = 0.48 vs. T2 = 1.16 vs. T3 =
2.47, p = 0.409). KU70, SERIN1 and mutant KRAS did
not show any expression trend. The only patient with
T4 tumor was excluded from the analysis. TACSTD2,
Ku70 and SERIN1 quantitative expression showed
no statistically significant association with category
N (TACSTD2: N0 = 0.79 vs. N1 = 4.21 vs. N2 = 0.22,
p = 0.536; Ku70: N0 = 1.18 vs. N1 = 0.86 vs. N2 = 1.36,
p = 0.567; SERIN1: N0 = 2.03 vs. N1 = 1.45 vs. N2 = 0.46,
p = 0.606; KRAS codon 12 mutation: N0 = 0.45 vs. N1 =
1.32 vs. N2 = 0.01, p = 0.254). Data concerning the oc- Data concerning the oc-Data concerning the oc-
currence of systemic metastasis (category M) and TNM
staging were not statistically associated with TACSTD2,
Ku70 and SERIN1 expressions, and are presented in table
3. Patients with liver metastasis presented higher gene
expression levels (TACSTD2 = 8.45 vs. 0.63, p = 0.693;
Ku70 = 1.89 vs. 1.13, p = 0.256; SERIN1 = 1.88 vs. 1.69,
p = 0.219). The exception was mutant KRAS (0.02 vs.
0.54, p = 0.264). These data and the analysis of all the
other categorical variables are represented in Table 3.
Temperature
y = -0.24 x + 7.39; R^2 = 0.957
Cycle C(T) Cycle
60
20 30 30
0
0.01
0.0075
0.005
0.0025
0
-1
-2
3540 40
65 70 75 80 85 90
Fl
uo
re
sc
en
ce
Fl
uo
re
sc
en
ce
Lo
g
Q
ua
nt
ity
Figure. Ku70 real-time PCR: a, melting curve; b, amplification curve; c, linear regression of the results
31 Experimental Oncology 33, 28–32, 2011 (March)
Despite the great interesting of the international
scientific community and the numerous publications
about KRAS gene, testing for KRAS mutations still cur-
rently not standardized [6]. It is known however that
real-time PCR is the test with the greatest sensitivity
(96.5%) to detect KRAS mutations [28]. In agreement
with Cejas et al. [29], we did not observed association
between mutation in codon 12 and the clinical-path-
ological variables studied. Chang et al. [30] analyzed
228 cases of CRC with a multiplex PCR and did not
report association between mutation in codon 12 and
any clinical-pathological feature other than lymph
nodes metastasis (p = 0.048). This finding however
was not confirmed in our study.
TACSTD2, also known as TROP2, codifies a protein
that promotes anchorage-independent growth and
tumorigenesis [31, 32]. TROP2 overexpression occurs
mainly in rectal cancer and is associated with disease
recurrence and increased cancer-related-deaths [9,
16]. Our findings support Ohmachi et al. [9], once both
studies did not identify association between TROP2 ex-
pression in tumor tissue and age, gender, tumor site,
histological grade, vascular invasion and lymph node
metastasis. Unlike this author, we did not observe as-
sociation between TROP2 expression and the occur-
rence of liver metastasis [9]. Our study analyzed tumors
of the colon and rectum together and like Fang et al. [16]
we did not identify association between the TROP2 ex-
pression and the occurrence of liver metastasis.
Preoperative radiotherapy reduces the rate of local
recurrence and improves the chance of survival in pa-
tients with resectable, advanced rectal cancer. Target-
ing the Ku70 and/or Ku80 could inhibit repair of the
radiation-induced DNA double strand break damage,
enhancing the radiation response of tumor cells [20,
21]. Our study was the first to describe the association
between higher Ku70 expression and low-differentiated
(tumor grade G3) colorectal cancer (p = 0.03). An im-
munohistochemistry study of CRC patients, performed
by Komuro et al. [20, 21], did not demonstrate associa-
tion between the Ku70 expression and clinical-patho-
logical features, except the depth of tumor invasion. The
explanation for this difference may be: (1) limitations
of the real-time PCR and immunohistochemistry assay;
(2) discrepancy between gene and protein expressions;
or (3) compensatory gene expression in the homolo-
gous recombination pathway [21, 33].
The first citation in literature about SERIN1 derives
from the publication of Eschrich et al. [22]. Using the
technique of cDNA microarray, this author estab-
lished a panel of 43 genes, including SERIN1, asso-
ciated with an unfavorable prognosis of patients with
CRC [22]. We did not observe association between
SERIN1 expression and clinical-pathological charac-
teristics of CRC. Until the current date our report is the
unique study concerning this topic.
Some potential limitations of our study require
further discussion. First, the small number of patients
Table 3. Relation between categorical variables and TACSTD2, Ku70, SERIN1 and KRAS codon12 mutation expressions
TACSTD2 KU70 SERIN1 KRAS codon 12
Gender
• Male
• Female
2.04 (0.37–8.99)
0.56 (0.17–4.71)
1.02 (0.70–1.55)
1.18 (1.03–26.47)
1.79 (0.68–6.87)
1.59 (0.40–3.70)
0.42 (0.04–1.82)
0.48 (0.02–2.98)
Tumor site b
• Right colon
• Left colon
• Rectum
0.57 (0.08–0.71)
1.67 (0.07–13.46)
4.99 (4.21–5.77)
1.85 (0.72–2.26)
1.13 (0.74–1.25)
0.78 (0.23–1.71)
1.88 (0.74–2.12)
2.78 (1.08–8.81)
2.00 (0.62–4.24)
0.48 (0.22–1.92)
0.22 (0.02–2.40)
0.69 (0.02–8.17)
Vascular invasion a
• Presence
• Absence
0.04 (0.03–10.0)
0.95 (0.41–5.77)
0.72 (0.22–2.99)
1.18 (0.82–1.75)
4.90 (0.26–8.27)
1.37 (0.51–5.87)
0.48 (0.04–1.95)
0.42 (0.01–2.98)
Tumor grade a
• G1 or G2
• G3
1.31 (0.25–6.59)
0.59 (0.59–0.59)
1.13 (0.71–1.59)
2.76 (1.19–4.33)(c)
1.45 (0.49–5.87)
1.17 (0.46–1.88)
0.38 (0.02–1.82)
10.0 (1.90–18.12)
Mucus production
• Presence
• Absence
0.33 (0.04–0.63)
0.95 (0.29–6.31)
0.90 (0.33–1.64)
1.17 (0.49–2.66)
1.29 (0.57–7.54)
1.92 (0.91–4.44)
0.33 (0.06–0.61)
0.45 (0.02–1.94)
Category T (TNM) d
• T1
• T2
• T3
0.48 (0.24–1.11)
1.16 (1.10–2.42)
2.47 (0.31–10.92)
1.17 (0.93–1.51)
1.71 (1.21–2.21)
1.11 (0.72–1.85)
1.93 (1.09–4.23)
15.38 (0.73–30.0)
1.45 (0.47–5.26)
1.94 (0.09–2.84)
0.20 (0.02–0.38)
0.45 (0.05–2.17)
Category N (TNM) b
• N0
• N1
• N2
0.79 (0.43–3.60)
4.21 (0.19–14.89)
0.22 (0.22 – 0.22)
1.18 (0.91–2.12)
0.86 (0.34–1.53)
1.36 (0.66–2.62)
2.03 (0.54–5.46)
1.45 (0.58–6.71)
0.46 (0.32–3.94)
0.45 (0.09–1.96)
1.32 (0.03–2.44)
0.01 (0.01–18.13)
Category M (TNM) a
• M0
• M1
2.05 (0.49–6.59)
0.34 (0.13–8.46)
1.18 (0.77–1.94)
0.92 (0.59–2.26)
1.69 (0.56–4.96)
1.88 (0.46–6.71)
0.43 (0.04–1.95)
1.68 (0.01–2.98)
Liver metastasis
• Yes
• No
8.45 (0.58–16.32)
0.63 (0.08–4.99)
1.89 (0.72–3.99)
1.13 (0.40–1.85)
1.88 (1.00–3.93)
1.69 (0.67–4.33)
0.06 (0.01–1.89)
0.54 (0.12–1.96)
AJCC stage b
• I
• II
• III
• IV
0.48 (0.10–1.68)
3.99 (0.79–8.47)
9.62 (4.60–2.94)
0.34 (0.13–8.46)
1.20 (1.17–1.98)
1.15 (0.75–2.31)
0.98 (0.15–1.89)
0.92 (0.59–2.26)
1.93 (0.91–7.04)
2.13 (0.37–5.87)
1.37 (0.56–6.74)
1.88 (0.46–6.71)
1.16 (0.06–2.40)
0.42 (0.09–0.61)
0.05 (0.01–3.08)
1.68 (0.01–2.98)
Note: Gene expression presented through median and inter–quartile range (IQR1; IQR3); aMann — Whitney test; bKruskal–Wallis test; cp < 0.05; done pa-
tient excluded.
32 Experimental Oncology 33, 28–32, 2011 (March)
studied difficults the identification of any eventually
statistically significant difference. Another limitation
is that we investigate only one type of KRAS mutation,
precluding us from generalizing our conclusions about
other mutations of this gene. Finally, we analyzed colon
and rectal tumors together, making difficult to compare
our findings with those reported by some other authors.
ACKNOWLEDGMENTS
The authors are grateful to Erico Fillmann and
Henrique Fillmann, from the Colorectal Division of HSL-
PUCRS, for performing the surgical procedures. The
authors appreciate the helpful contribution of Silvana
Lunardini Alves, Vinicius Schenk Michaelsen and Pris-
cila Salvato, from the Institute of Biomedical Research
of HSL-PUCRS, for the collecting and storing the tissue
samples. This study was partially supported by the
Fund of Incentive for Research and Events, Hospital
de Clinicas, Porto Alegre.
REFERENCES
1. Lozynska M. The prognostic value of cytogenetic markers for
early diagnosis of colorectal cancer. Exp Oncol 2009; 31: 237–41.
2. Bazan V, Migliavacca M, Zanna I, et al. Specific codon 13
K-ras mutations are predictive of clinical outcome in colorectal
cancer patients, whereas codon 12 K-ras mutations are associ-
ated with mucinous histotype. Ann Oncol 2002; 13:1438–46.
3. Andreyev HJ, Norman AR, Cunningham D, et al. Kirsten
ras mutations in patients with colorectal cancer: the ‘RASCAL
II’ study. Br J Cancer 2001; 85: 692–6.
4. Krtolica K, Krajnovic M, Usaj-Knezevic S, et al. Co-
methylation of p16 and MGMT genes in colorectal carcinoma:
correlation with clinicopathological features and prognostic
value. World J Gastroenterol 2007; 13: 1187–94.
5. De Roock W, Claes B, Bernasconi D, et al. Effects of
KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy
of cetuximab plus chemotherapy in chemotherapy-refractory
metastatic colorectal cancer: a retrospective consortium analy-
sis. Lancet Oncol 2010; 11: 753–62.
6. Krens LL, Baas JM, Gelderblom H, et al. Therapeutic
modulation of k-ras signaling in colorectal cancer. Drug Dis-
cov Today. 2010; 15: 502–16.
7. Brink M, de Goeij AF, Weijenberg MP, et al. K-ras
oncogene mutations in sporadic colorectal cancer in The
Netherlands Cohort Study. Carcinogenesis 2003; 24: 703–10.
8. Wang J, Day R, Dong Y, et al. Identification of Trop-2
as an oncogene and an attractive therapeutic target in colon
cancers. Mol Cancer Ther 2008; 7: 280–5.
9. Ohmachi T, Tanaka F, Mimori K, et al. Clinical signifi-
cance of TROP2 expression in colorectal cancer. Clin Cancer
Res. 2006; 12: 3057–63.
10. Fong D, Moser P, Krammel C, et al. High expression
of TROP2 correlates with poor prognosis in pancreatic cancer.
Br J Cancer 2008; 99: 1290–5.
11. Nakashima K, Shimada H, Ochiai T, et al. Serological
identification of TROP2 by recombinant cDNA expression
cloning using sera of patients with esophageal squamous cell
carcinoma. Int J Cancer 2004; 112: 1029–35.
12. Fong D, Spizzo G, Gostner JM, et al. TROP2: a novel
prognostic marker in squamous cell carcinoma of the oral
cavity. Mod Pathol 2008; 21: 186–91.
13. Alberti S, Miotti S, Stella M, et al. Biochemical charac-
terization of Trop-2, a cell surface molecule expressed by human
carcinomas: formal proof that the monoclonal antibodies T16
and MOv-16 recognize Trop-2. Hybridoma 1992; 11: 539–45.
14. Fradet Y, Cordon-Cardo C, Thomson T, et al. Cell surface
antigens of human bladder cancer defined by mouse monoclonal
antibodies. Proc Natl Acad Sci U S A. 1984; 81: 224–8.
15. Ky X, Gu J. Expression of TROP2 mRNA in left-sided
and right-sided colon cancer and its clinical significance.
Zhonghua Wei Chang Wai Ke Za Zhi 2009; 12: 285–9.
16. Fang YJ, Lu ZH, Wang GQ, et al. Elevated expression
of MMP7, TROP2, and surviving are associated with survival,
disease recurrence, and liver metastasis of colon cancer. Int J
Colorectal Dis 2009; 24: 875–84.
17. Gullo C, Au M, Feng G, et al. The biology of Ku and its
potential oncogenic role in cancer – Review. Biochim Biophys
Acta 2006; 1765: 223–34.
18. Velerie K, Povirk LF. Regulation and mechanisms of mam-
malian double-strand break repair. Oncogene 2003; 22: 5792–812.
19. Walker JR, Corpina RA, Goldberg J. Structure of the
Ku heterodimer bound to DNA and its implications for double-
strand break repair. Nature 2001; 412: 607–14.
20. Komuro Y, Watanabe T, Hosoi Y, et al. Prognostic sig-
nificance of Ku70 protein expression in patients with advanced
colorectal cancer. Hepatogastroenterology 2005; 52: 995–8.
21. Komuro Y, Watanabe T, Hosoi Y, et al. The expression pat-
tern of Ku correlates with tumor radiosensitivity and disease free sur-
vival in patients with rectal carcinoma. Cancer 2002; 95: 1199–205.
22. Eschrich S, Yang I, Bloom G, et al. Molecular staging
for survival prediction of colorectal cancer patients. J Clin
Oncol 2005; 23: 3526–35.
23. Watanabe T, Kobunai T, Sakamoto E, et al. Gene ex-
pression signature for recurrence in stage III colorectal cancers.
Cancer 2009; 115: 283–92.
24. Bustin SA, Nolan T. Pitfalls of quantitative real-time
reverse-transcription polymerase chain reaction. J Biomol
Tech 2004; 15: 155–66.
25. Bustin SA, Benes V, Nolan T, et al. Quantitative real-time
RT-PCR—a perspective. J Mol Endocrinol 2005; 34: 597–601.
26. American Joint Committee on Cancer. Collaborative
staging task force of the American Joint Committee on Cancer.
Collaborative staging manual and coding instructions, version
1.0. and U.S. NIH Publication Number 04–5496. [2010 Jan 7].
At: http://www.cancerstaging.org/cstage/csmanualpart1.pdf.
27. Greer CE, Peterson SL, Kiviat NB, et al. PCR amplifi-
cation from paraffin-embedded tissues. Effects of fixative and
fixation time. Am J Clin Pathol 1991; 95: 117–24.
28. Tol J, Dijkstra JR, Vink-Börger ME, et al. High sensitivity
of both sequencing and real-time PCR analysis of KRAS muta-
tions in colorectal cancer tissue. J Cell Mol Med 2010; 14: 2122–31.
29. Cejas P, López-Gómez M, Aguayo C, et al. KRAS
mutations in primary colorectal cancer tumors and related
metastases: a potential role in prediction of lung metastasis.
PLoS One 2009; 4: e8199.
30. Chang YS, Y KT, Chang TY, et al. Fast simultaneous
of K-RAS mutations in colorectal cancer. BMC 2009; 9: 179,
DOI: 10.1186/1471–2407–9-179.
31. Cubas R, Li M, Chen C, et al. Trop2: a possible
therapeutic target for late stage epithelial carcinomas. Biochim
Biophys Acta 2009; 1796: 309–14.
32. Urano M, Fuqiu H, Minami A, et al. Response to multiple
radiation doses of human colorectal carcinoma cells infected with
recombinant adenovirus containing dominant-negative Ku70
fragment. Int J Radiation Oncology Biol. Phys 2010; 77: 877–85.
33. Grabsch H, Dattani M, Barker L, et al. Expression of DNA
double-strand break repair proteins ATM and BRCA1 predicts
survival in colorectal cancer. Clin Cancer Res 2006; 12: 1494–500.
Copyright © Experimental Oncology, 2011
|