Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells
It is very well documented that retinoic acid (RA) reduces growth rate by induction of cell differentiation in certain conditions and cell lines. On the other hand, hyaluronic acid (HA) is known for its growth induction on cultured cells. A natural source of HA, rabbit vitreous humour (VH), was prev...
Збережено в:
| Дата: | 2010 |
|---|---|
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | English |
| Опубліковано: |
Інститут клітинної біології та генетичної інженерії НАН України
2010
|
| Назва видання: | Цитология и генетика |
| Теми: | |
| Онлайн доступ: | http://dspace.nbuv.gov.ua/handle/123456789/66802 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells / A.J. Bagherpoor, A.R. Bahrami, M.M. Matin, N. Mahdavi-Shahri, M.A. Edalatmanesh // Цитология и генетика. — 2010. — Т. 44, № 5. — С. 15-21. — Бібліогр.: 22 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-66802 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-668022014-07-23T03:01:34Z Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells Bagherpoor, A.J. Bahrami, A.R. Matin, M.M. Mahdavi-Shahri, N. Edalatmanesh, M.A. Оригинальные работы It is very well documented that retinoic acid (RA) reduces growth rate by induction of cell differentiation in certain conditions and cell lines. On the other hand, hyaluronic acid (HA) is known for its growth induction on cultured cells. A natural source of HA, rabbit vitreous humour (VH), was previously shown to promote wound repair in model animals. In search for its possible mechanisms, VH extract was tested on the cultured mesenchymal stem cells and NTERA2 as human embryonal carcinoma cells in the presence of RA. Changes in some cellular and molecular markers (A2B5, Oct4, Sox2) showed that VH and possibly HA interfere with differentiating effects of RA. Therefore, this reagent may affect cell proliferation and tissue regeneration by inhibition of cell differentiation. Хорошо известно, что ретиноевая кислота (RA) снижает темпы роста, индуцируя дифференциацию клеточных линий в определенных условиях. Вместе с тем известно, что гиалуроновая кислота (HA) индуцирует рост культивируемых клеток. Ранее было показано, что естественный источник НА, стекловидное тело (VH) кролика, вызывает заживление ран у модельных животных. В поисках возможного механизма этого процесса экстракт стекловидного тела был исследован на культивируемых мезенхимальных стволовых клетках и клетках NTERA2 эмбриональной карциномы человека в присутствии RA. Изменения некоторых клеточных и молекулярных маркеров (A2B5, Oct4, Sox2) показали, что VH и, возможно, HA влияют на дифференцирующие эффекты RA. Таким образом, это вещество может влиять на пролиферацию клеток и регенерацию тканей, ингибируя дифференциацию клеток. Добре відомо, що ретиноєва кислота (RA) знижує темпи росту, індукуючи диференціацію кліткових ліній в певних умовах. Разом з тим відомо, що гіалуронова кислота (НА) індукує ріст культиво- ваних клітин. Раніше було показано, що природне джерело НА, склоподібне тіло (VH) кроля, викликає загоєння ран у модельних тварин. В пошуках можливого механізму цього процесу екстракт склоподібного тіла був досліджений на культивованих мезенхімальних стовбурових клітинах та клітинах NTERA2 ембріональної карциноми людини в присутності RA. Зміни деяких клітинних та молекулярних маркерів (A2B5, Oct4, Sox2) показали, що VH і, можливо, НА впливають на диференціюючі ефекти RA. Таким чином, ця речовина може впливати на проліферацію і регенерацію тканин, інгібуючи диференціацію клітин. 2010 Article Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells / A.J. Bagherpoor, A.R. Bahrami, M.M. Matin, N. Mahdavi-Shahri, M.A. Edalatmanesh // Цитология и генетика. — 2010. — Т. 44, № 5. — С. 15-21. — Бібліогр.: 22 назв. — англ. 0564-3783 http://dspace.nbuv.gov.ua/handle/123456789/66802 en Цитология и генетика Інститут клітинної біології та генетичної інженерії НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Оригинальные работы Оригинальные работы |
| spellingShingle |
Оригинальные работы Оригинальные работы Bagherpoor, A.J. Bahrami, A.R. Matin, M.M. Mahdavi-Shahri, N. Edalatmanesh, M.A. Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells Цитология и генетика |
| description |
It is very well documented that retinoic acid (RA) reduces growth rate by induction of cell differentiation in certain conditions and cell lines. On the other hand, hyaluronic acid (HA) is known for its growth induction on cultured cells. A natural source of HA, rabbit vitreous humour (VH), was previously shown to promote wound repair in model animals. In search for its possible mechanisms, VH extract was tested on the cultured mesenchymal stem cells and NTERA2 as human embryonal carcinoma cells in the presence of RA. Changes in some cellular and molecular markers (A2B5, Oct4, Sox2) showed that VH and possibly HA interfere with differentiating effects of RA. Therefore, this reagent may affect cell proliferation and tissue regeneration by inhibition of cell differentiation. |
| format |
Article |
| author |
Bagherpoor, A.J. Bahrami, A.R. Matin, M.M. Mahdavi-Shahri, N. Edalatmanesh, M.A. |
| author_facet |
Bagherpoor, A.J. Bahrami, A.R. Matin, M.M. Mahdavi-Shahri, N. Edalatmanesh, M.A. |
| author_sort |
Bagherpoor, A.J. |
| title |
Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells |
| title_short |
Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells |
| title_full |
Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells |
| title_fullStr |
Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells |
| title_full_unstemmed |
Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells |
| title_sort |
investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rmscs) and human ntera2 cells |
| publisher |
Інститут клітинної біології та генетичної інженерії НАН України |
| publishDate |
2010 |
| topic_facet |
Оригинальные работы |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/66802 |
| citation_txt |
Investigating the effects of vitreous humour (crude extract) on growth and differentiation of rat mesenchymal stem cells (rMSCs) and human NTERA2 cells / A.J. Bagherpoor, A.R. Bahrami, M.M. Matin, N. Mahdavi-Shahri, M.A. Edalatmanesh // Цитология и генетика. — 2010. — Т. 44, № 5. — С. 15-21. — Бібліогр.: 22 назв. — англ. |
| series |
Цитология и генетика |
| work_keys_str_mv |
AT bagherpooraj investigatingtheeffectsofvitreoushumourcrudeextractongrowthanddifferentiationofratmesenchymalstemcellsrmscsandhumanntera2cells AT bahramiar investigatingtheeffectsofvitreoushumourcrudeextractongrowthanddifferentiationofratmesenchymalstemcellsrmscsandhumanntera2cells AT matinmm investigatingtheeffectsofvitreoushumourcrudeextractongrowthanddifferentiationofratmesenchymalstemcellsrmscsandhumanntera2cells AT mahdavishahrin investigatingtheeffectsofvitreoushumourcrudeextractongrowthanddifferentiationofratmesenchymalstemcellsrmscsandhumanntera2cells AT edalatmaneshma investigatingtheeffectsofvitreoushumourcrudeextractongrowthanddifferentiationofratmesenchymalstemcellsrmscsandhumanntera2cells |
| first_indexed |
2025-07-05T16:59:06Z |
| last_indexed |
2025-07-05T16:59:06Z |
| _version_ |
1836827013859508224 |
| fulltext |
A.J. BAGHERPOOR 1, A.R. BAHRAMI 1, 2, M.M. MATIN 1, 2,
N. MAHDAVI�SHAHRI 1, M.A. EDALATMANESH 1
1
Cellular and Molecular Biology Research Group, Institute of Biotechnology,
Ferdowsi University of Mashhad, Iran
2
Department of Biology, Faculty of Sciences, Ferdowsi University
of Mashhad, Iran
E�mail: ajbagherpoor@yahoo.com, Matin@um.ac.ir, ar�bahrami@um.ac.ir,
amin.edalatmanesh@gmail.com
INVESTIGATING THE EFFECTS
OF VITREOUS HUMOUR
(CRUDE EXTRACT) ON GROWTH
AND DIFFERENTIATION
OF RAT MESENCHYMAL STEM CELLS
(rMSCs) AND HUMAN NTERA2 CELLS
Two main characteristics of all types of stem cells are their
potency for differentiation and self renewal capacity. There is
a lot of interest to find the conditions and factors, which gov�
ern these behaviours of stem cells. It is very well documented
that retinoic acid (RA) reduces growth rate by induction of cell
differentiation in certain conditions and cell lines. On the
other hand, hyaluronic acid (HA) is known for its growth
induction on cultured cells. A natural source of HA, rabbit vit�
reous humour (VH), was previously shown to promote wound
repair in model animals. In search for its possible mecha�
nisms, VH extract was tested on the cultured mesenchymal
stem cells and NTERA2 as human embryonal carcinoma cells
in the presence of RA. Changes in some cellular and molecu�
lar markers (A2B5, Oct4, Sox2) showed that VH and possibly
HA interfere with differentiating effects of RA. Therefore, this
reagent may affect cell proliferation and tissue regeneration by
inhibition of cell differentiation.
Introduction. Extracellular matrix is very well
known for its effects on cellular behaviours includ�
ing proliferation, migration and differentiation.
Vitreous humour (VH) is a gelatinous, colorless
and shapeless mix of different substances contain�
ing a mass of extracellular matrix, especially
hyaluronic acid and collagen fibrils [1].
Recent progresses in isolation and culture of
stem cells is a step forward to study cell behaviours
in vitro.These cells can be divided into two major
groups of embryonic stem (ES) cells and adult
stem cells [2]. ES cells are able to differentiate and
produce almost all cell types in proper conditions
[3], but due to many technical limitations in using
these cells and also because of many similar prop�
erties, human embryonal carcinoma cells (EC) are
used in some experiments instead [4]. EC cells are
very similar to the ES cells [5] while their growth
and maintenance are easier and less expensive. For
example a human EC cell, NTERA2/D1 or
NT2 for short, is easily differentiated upon
retinoic acid (RA) treatment [6]. Mesenchymal
stem cells (MSCs) derived from bone marrow are
another group of stem cells which are also widely
used because of their easy culture and therapeutic
significance. MSCs are clonogenic, non�haema�
topoietic stem cells present in the bone marrow
and are able to differentiate into multiple meso�
derm�type cell lineages, e.g. osteoblasts, chondro�
cytes, endothelial�cells, and also non�mesoderm�
type lineages, e.g. neuronal�like cells [7].
The capacity of each reagent to induce differen�
tiation in these cells, are examined using certain cel�
lular or molecular markers. Oct4 and Sox2 are
among the molecular markers that rapidly respond
to differentiation. The transcription factor Oct4(also
referred to as Pou5f1), has significant expression in
ovulated oocytes, mousepre�implantation embryos,
ectoderm of the gastrula (but not in other germ lay�
ers) and primordial germ cells. This protein has also
been reported from embryonic stem cells [8]. SOX2,
an SRY�related HMG box transcription factor
(TF), is also expressed in the ICM and ES cells, and
has a co�activator role in OCT4 activity [9].
Based on the data from in vivo experiments, VH
is considered as a suitable candidate to be tested
for its possible effect on cell proliferation and dif�
ferentiation. This could be due to its high content
of glycosaminoglycans [10], which seem to play an
important role in early embryogenesis, can
increase the cell growth in vitro [11], and in bovine
blastocysts [12].
ІSSN 0564–3783. Цитология и генетика. 2010. № 6 15
© A.J. BAGHERPOOR, A.R. BAHRAMI, M.M. MATIN,
N. MAHDAVI�SHAHRI, M.A. EDALATMANESH, 2010
Materials and methods. All experiments were
performed in strict compliance with the Ferdowsi
University of Mashhad Animal Ethics Guidelines
in accordance with Iran Animal Welfare Act.
Culture of NTERA2 Cells. NTERA2_clone D1
(NT2/D1) is a hEC cell linederived from a testicu�
lar teratocarcinoma [13], which closely resembles
hES cells and the inner cell mass of human blasto�
cyst stage embryos. The NT2 cells were successfully
defrosted from a liquid nitrogen stocked batch and
grown in a standard T25 flask with Dulbecco’s
Modified Eagles Medium (DMEM, Gibco) supple�
mented by 10 % fetal bovine serum (FBS, Gibco),
100 U/ml penicillin (Gibco), and 100 μg/mL strep�
tomycin (Gibco) and left for growth to 80 % con�
fluency at 37 °С and 10 % CO2 in the air. For pas�
sage, the NT2 cells were scraped by glass beads
and reseeded 1:3, continuously until they were
needed for experiments.
Isolation and expansion of MSCs. Male Wistar
rats, 4–6 weeks old, were sacrificed by cervical
dislocation and their femurs and tibia were care�
fully cleaned from adherent soft tissues. The tip of
each bone was removed with a rongeur, and the
marrow was harvested by inserting a syringe needle
(27�gauge) into one end of the bone and flushing
with DMEM. Cells were plated at a density of 102
per T25 flask in 5 ml DMEM containing 15 %
FBS, 2 mM L�glutamine (Gibco), 100 U/ml peni�
cillin (Gibco), and 100 μg/mL streptomycin
(Gibco). Cultures were kept at 37 °С in a humidi�
fied atmosphere containing 95 % air and 5 % CO2.
After 24 hrs, the non�adherent cells were discard�
ed and adherent cells were washed gently with the
fresh medium. The medium were replaced twice a
week. When primary cultures became nearly con�
fluent, the culture was treated with 0.5 ml of
0.025 % trypsin containing 0.02 % EDTA for
5 minutes at room temperature, and the detached
cells were harvested and cultured in a T25 flask.
Once the culture reached to 70–80 % confluency,
the cells were harvested for further experiments.
Vitreous humour extraction. Seven skeletally
mature male, New Zealand white rabbits (age,
6 months, weight 2.5–3 kg) were purchased from
Razi Institute, Mashhad, Iran. They were kept in
soft bedding cages with free access to food and
water. General anaesthetize was performed by
chloroform, and followed by sodium thiopental for
euthanized. Their eye lips were cut open and the
eye balls were taken out very smoothly. The balls
were rinsed thoroughly in physiological serum and
transferred to laminar flow hood. The vitreous
humour was sucked out from the dorsal part of the
ball using a fine syringe, with special care to avoid
any contamination from the eye lens and retina.
Each extract, about 0.5 ml in volume, was filter�
sterilized using the standard micro filters (0.22
μm), and stored in a sterile microtube at –20 °С
for further use.
RNA extraction and RT�PCR. About 102cells/ml
were subjected to RNA extraction using Tri�reagent
(Sigma) following manufacturer’s protocol. To
remove any DNA contamination, the RNA was
treated with DNase (Ambion) and analysed on
1 % agarose gel. The first strand of cDNA was
extended using 5 μg of total RNA and 100 pmol of
oligo(dT)primer, 200 units of M�MLV reverse
transcriptase (Promega) plus its reaction buffer,
and 1.25 mM dNTPs in final volume of 40 μl, fol�
lowed by 2 hrs incubation at 37 °С and 5 min inac�
tivation at 80 °С. 1 μl of this reaction mixture was
used as template for polymerase chain reaction
(PCR) following standard protocols. PCR was
performed using 1 μl of the cDNA in final volume
of 25 μl containing 15 pmol of each primer,
0.1 mM dNTPs, and 0.3 units Taq polymerase
(Promega).
The primer sequences and conditions of these
reactions were as follows: human Oct4 forward
(hOct4�F) (5'�GAGAATTTGTTCCTGCAGTGC�
3'); human Oct4 reverse (hOct4�R) (5'�GTTCC�
CAATTCCTTCCTTAGTG�3'); human Sox2 for�
ward (hSox2�F) (5'�CCCCCGGCGGCAATAG�
CA�3'); human Sox2 reverse (hSox2�R) (5'�TCG�
GCGCCGGGGAGATACAT�3'); rat Oct4 forward
(rOct4�F) (5'�AAGCTGCTGAAACAGAAGAGG�
3'); rat Oct4 reverse (rOct4�R) (5'�ACACGGTTCT�
CAATGCTAGTC�3'); internal control forward (β�
actin�F) (5'�ATCTGGCACCACACCTTCTACA�
ATGAGTGCG�3'); and internal control reverse
(β�actin�R) (5'�CGTCATACTCCTGCTTGCTG�
ATCCACATCTGC�3'). The number of cycles were
31 for hOct4, 30 for hSox2, 33 for rOct4 and 28
for β�actin.
The cycling conditions were as follows: 94 °С
for 45 sec, 58 °С (hOct4), 56 °С (hSox2), 57 °С
(rOct4) and 62 °С (β�actin) for 1 min, 72 °С for
1.5 min, with a final extension at 72 °С for
10 min.
ISSN 0564–3783. Цитология и генетика. 2010. № 616
A.J. Bagherpoor, A.R. Bahrami, M.M. Matin, N. Mahdavi�Shahri, M.A. Edalatmanesh
PCR products were separated on 1 % agarose gel,
stained with ethidium bromide, and visualized under
the UV light. The graphs from the gels were sub�
jected to intensity measurement using LabWorks
program. In this method, the intensity of the RT�
PCR products for the control sample is assumed
100 and the treatments are compared relative to
the control one. The semi�quantitative RT�PCR
experiments were repeated at least two or three
times for expression assay of each gene.
VH and retinoic acid treatment of NTERA2 cells.
NTERA2 cells were seeded at a density of 106 cells
per T25 flask and treated with either VH (150 μl)
or RA (10–5 M) for 7 days and the effects of both
compounds on the gene expression were deter�
mined by semi�quantitative RT�PCR at different
time points. Medium was changed with fresh RA,
VH and DMEM supplemented with 10 % fetal
bovine serum, every 2 days. Cells were harvested at
different time points with Tri�reagent and total
RNA was extracted from each sample.
Flow cytometry analysis. The cells were detached
from culture dish with trypsin/EDTA. Cell surface
antigen expression was assayed by flow cytometry
as previously described [6]. Briefly, the cells were
incubated in primary antibody (A2B5 anti�gan�
glioside GT3) [14] for 1 h at 4 °С. After three
ІSSN 0564–3783. Цитология и генетика. 2010. № 6 17
Investigating the effects of vitreous humour (crude extract) on growth and differentiation
Fig. 1. Morphology of rat bone marrow mesenchymal stem cells (rMSCs) and NT2 cells. The picture shows a time course mor�
phological changes of MSCs from round�shape on day one (a) to spindle�shape on days 8–15 (b–c) after isolation, and a
perfect spindle�shape at first passage (d). The morphology of NT2 cells after 4 (e) and 7 (f) days in culture are also shown.
The original magnification is 400�
Fig. 2. Growth induction on NTERA2 and rMSCs upon 7
days of VH treatment: a – Growth of NT2 cells was signifi�
cantly (P < 0.05) increased in all VH concentrations reaching
to its highest in 50 μl per well; b – Growth of MSCs was
almost doubled (P < 0.004) in wells treated with 50 μl of VH
extract
washes in wash buffer (5 % FBS and 0.02 % sodi�
um aside in magnesium and calcium free phos�
phate�buffered saline (PBS)), they were incubated
in a FITC�conjugated secondary IgM antibody for
1 hr. They were then resuspended in the wash
buffer, and analysed using a flow cytofluorimeter.
The antibody produced from the myeloma
P3X63Ag8 [15] was used as a negative control.
Statistics. The SPSS V. 13 statistical program
was used to analyse the data. Significance of the
data was examined in the level of (p � 0.05) using
one way ANOVA and tukey test.
Results. Growth rate of NTERA2 and rMSCs is
increased upon VH treatment. Rat MSCs (Fig. 1,
a–d) and NT2 cells (Fig.1, e, f), at approximately
80 % confluency, were trypsinized and seeded into
six well plates. Next day, NT2 cells were treated
with different volumes, 50, 100 and 200 μl of the
VH extract to evaluate the optimum concentration
for the highest cell growth rate. The medium was
replaced with fresh one, containing VH every
48 hrs, and finally the cells were counted after one
week. This experiment was repeated three times
independently. After seven days, statistical analysis
revealed that there was a significant (p � 0.05)
growth difference between NT2 control cells in
comparison with the cells treated with VH (50,
100 and 200 μl). The maximum proliferation was
observed at 50 μl of the VH extract (Fig. 2, a). As
seen in Fig. 2, b, treatment of rMSCs with 50 μl
VH extract increased cell proliferation almost 2
folds (P < 0/004) in comparison with the untreat�
ed ones.
Expression of Oct4 and Sox2 genes are affected by
retinoic acid and vitreous homour treatments. As
previously described, NT2 cells are among the cells
expressing a high level of OCT4 and SOX2 tran�
scription factors. As expected, the semi�quantita�
tive RT�PCR analysis following RA treatment of
these cells showed a decline in the expression lev�
els of OCT4 and SOX2 genes. Interestingly, this
pattern was reversed upon treatment of the cells
with VH extract. Both OCT4 and SOX2 showed a
significant increase in their expression when
NT2 cells were treated with VH alone. In a sepa�
rate experiment, results showed that VH could
somehow inhibit the suppressing effects of RA on
the expression of these genes when applied in
combination with RA (Fig. 3, a–c). In other
words, mRNA levels of SOX2 and OCT4 were
higher in combinational treatment of RA and VH
(RA�VH) compared to that of the RA alone.
OCT4 gene is expressed in rat mesenchymal stem
cells. mRNAs were extracted from rMSCs with or
without RA treatment and subjected to semi�
quantitative RT�PCR. Oct4 mRNA was detectable
in rMSCs. However, it disappeared upon treat�
ment with RA (Fig. 4).
ISSN 0564–3783. Цитология и генетика. 2010. № 618
A.J. Bagherpoor, A.R. Bahrami, M.M. Matin, N. Mahdavi�Shahri, M.A. Edalatmanesh
Fig. 3. Semi�quantitative RT�PCR analysis of OCT4 and
SOX2 mRNA expression in human NT2 cells 7 days after
treatment: a – pictures of the observed PCR products on
the agarose gel; b, c – the relative intensities of the PCR
products for OCT4 and SOX2 mRNAs respectively. These
treatments included NT2 control cells (NT/C) and those
treated with VH (NT2/VH) or a combination of RA and
VH (NT2/RAVH). OCT4 and SOX2 mRNAs increased in
both treatments. RT�PCR of β�actin mRNA indicates equal
loading of the samples
Differentiation of rMSCs upon treatment with RA
and VH. As expected, rMSCs and NT2 cells, treat�
ed with a combination of RA and VH, did not dis�
play a significant decrease in their proliferation,
despite presence of retinoic acid. RA alone signals
a decline in growth of rMSCs and NT2 cells with�
in 2 days, prior to the appearance of neuronal dif�
ferentiation markers. rMSCs treated with RA
(10–5 M) were first examined microscopically for
any morphological changes. After 4 days of treat�
ment the rMSCs showed a transition to the cells
with asymmetric morphology, while the cells treat�
ed with RA and VH had a symmetric morphology.
This change progressed to day 10, when the RA�
treated rMSCs showed neuron�like structures. By
day 26, the treated cells demonstrated structures
very similar to neurons (data not shown) which
remains to be confirmed more precisely. Treatment
of the cells with combination of RA and vitreous
humour extract however, reduced the progressive
effect of RA to differentiate the MSCs to neuron�
like cell types.
RA treatment induces neural differentiation in
NT2 and rMSCs. To confirm the morphological data
ІSSN 0564–3783. Цитология и генетика. 2010. № 6 19
Investigating the effects of vitreous humour (crude extract) on growth and differentiation
Fig. 4. Detection of Oct4 mRNA in rMSCs (MSC/C) by
semi�quantitative RT�PCR analysis. The level of Oct4
mRNA decreases upon RA treatment (MSC/RA). The lower
panel represents the band for 28s rRNAs
Fig. 5. Cell surface antigen (A2B5) expression (analyzed by flow cytometry) following retinoic acid and vitreous homour
treatment in NT2 for 4 days and rMSC for 7 days: a – rMSCs express high level of A2B5 after RA treatment (MSC/RA),
but not as high after RA plus VH treatment (MSC/RAVH) compared to the control (MSC/C); b – RA treatment of the
NT2 cells (NT2/RA) and its combination with VH (NT2/RAVH) induces A2B5 expression to the same level in NT2 cells
with no RA treatment (NT2/C)
of transdifferentiation, the RA�induced neuronal
differentiation of MSCs and NT2 cells was also
evaluated by flow cytometry based on the presence
of specific cell surface antigens [4].
A prominent induction of the neuroectodermal
marker, A2B5, appeared by day 7 in the RA treat�
ed MSC cells (Fig. 5). Terminal morphological
differentiation, such as neuronal outgrowth, did
not typically appear until approximately 3 weeks
after RA treatment.
Discussion. As a natural source of intact HA, we
were interested to test the differentiative and pro�
liferative effects of VH on stem cells as an accepted
model for in vitro studies. Previous experiments on
mouse ears demonstrated that wounds treated with
VH had an increase in fat cell production, angio�
genesis and fibroblast proliferation [16]. This caused
a significant increase in tissue regeneration and
wound repair.
Our data indicate that treatment of stem cells
with VH increased cell growth considerably, but
the mechanism of such effect is open to speculation.
In other line of experiments, our results showed
that VH also interfered with cell differentiation.
The octamer�binding transcription factor�4
(Oct4) and Sox2 are expressed in human pluripo�
tent stem cells, but not in theirdifferentiated deriv�
atives. Therefore, their expression is rapidly down�
regulated in response to retinoic acid�induced dif�
ferentiation [17] and markers associated with neu
ral cells are co�ordinately up regulated during the
differentiation [18]. We used expression level of these
transcription factors as indicator of VH effects on
the cells. These markers were considerably increased
in mRNA level upon the VH treatment. As they
are key genes in determination of cell fate during
embryogenesis, it is possible that VH can make a
suitable cell nitch for certain cells with activation
of primitive and upstream signalling pathways [19].
The undifferentiated cells become committed to
differentiation with RA, unleashing a genetic pro�
gram that involves the differential expression of
more than 3000 genes [17]. Therefore, compo�
nents of the VH may take an antagonistic approach
to prevent cell differentiation. As we show here,
VH reverses differentiative effects of RA, with a
consequence of increased cell proliferation.
As reported before, during cell differentiation
the level of peroxides also increases. Alternatively,
reduction of peroxides could be a possible mecha�
nism of VH action in differentiating cells. This
again could be due to the high content of HA,
which is believed to have antioxidative effects in
various systems [20]. VH is known for its high con�
tent of glycosaminoglycans specially hyaluronan.
As the effect of hyaluronan on proliferation of cord
blood progenitor cells is well known [21, 22], it
seems reasonable to investigate the effect of differ�
ent chemical fractions of VH extract on cell prolif�
eration and differentiation.
Alireza Jian Bagherpoor, Ahmad Reza Bahrami,
Maryam M. Matin, Naser Mahdavi�Shahri,
Mohammad Amin Edalatmanesh
ИЗУЧЕНИЕ ВЛИЯНИЯ ГРУБОГО ЭКСТРАКТА
СТЕКЛОВИДНОГО ТЕЛА НА РОСТ И
ДИФФЕРЕНЦИАЦИЮ МЕЗЕНХИМАЛЬНЫХ
СТВОЛОВЫХ КЛЕТОК КРЫСЫ (rMSCs)
И КЛЕТОК NTERA2 ЧЕЛОВЕКА
Двумя основными характеристиками всех типов
стволовых клеток является их способность к диффе�
ренциации и самообновлению. Значительный интерес
вызывает раскрытие условий и факторов, которые
управляют таким поведением стволовых клеток. Хо�
рошо известно, что ретиноевая кислота (RA) снижает
темпы роста, индуцируя дифференциацию клеточных
линий в определенных условиях. Вместе с тем извест�
но, что гиалуроновая кислота (HA) индуцирует рост
культивируемых клеток. Ранее было показано, что ес�
тественный источник НА, стекловидное тело (VH)
кролика, вызывает заживление ран у модельных жи�
вотных. В поисках возможного механизма этого про�
цесса экстракт стекловидного тела был исследован
на культивируемых мезенхимальных стволовых клет�
ках и клетках NTERA2 эмбриональной карциномы че�
ловека в присутствии RA. Изменения некоторых кле�
точных и молекулярных маркеров (A2B5, Oct4, Sox2)
показали, что VH и, возможно, HA влияют на диффе�
ренцирующие эффекты RA. Таким образом, это вещес�
тво может влиять на пролиферацию клеток и регене�
рацию тканей, ингибируя дифференциацию клеток.
Alireza Jian Bagherpoor, Ahmad Reza Bahrami,
Maryam M. Matin, Naser Mahdavi�Shahri,
Mohammad Amin Edalatmanesh
ВИВЧЕННЯ ВПЛИВУ ГРУБОГО ЕКСТРАКТУ
СКЛОПОДІБНОГО ТІЛА НА РІСТ ТА
ДИФЕРЕНЦІАЦІЮ МЕЗЕНХІМАЛЬНИХ
СТОВБУРОВИХ КЛІТИН ЩУРА (rMSCs)
І КЛІТИН NTERA2 ЛЮДИНИ
Двома основними характеристиками всіх типів
стовбурових клітин є їхня здатність до диференціації
та самооновлення. Значний інтерес викликає роз�
ISSN 0564–3783. Цитология и генетика. 2010. № 620
A.J. Bagherpoor, A.R. Bahrami, M.M. Matin, N. Mahdavi�Shahri, M.A. Edalatmanesh
криття умов та факторів, котрі управляють такою по�
ведінкою стовбурових клітин. Добре відомо, що рети�
ноєва кислота (RA) знижує темпи росту, індукуючи ди�
ференціацію кліткових ліній в певних умовах. Разом з
тим відомо, що гіалуронова кислота (НА) індукує ріст
культиво� ваних клітин. Раніше було показано,
що природне джерело НА, склоподібне тіло (VH) кро�
ля, викликає загоєння ран у модельних тварин. В по�
шуках можливого механізму цього процесу екстракт
склоподібного тіла був досліджений на культивованих
мезенхімальних стовбурових клітинах та клітинах
NTERA2 ембріональної карциноми людини в присут�
ності RA. Зміни деяких клітинних та молекулярних
маркерів (A2B5, Oct4, Sox2) показали, що VH і, мож�
ливо, НА впливають на диференціюючі ефекти RA.
Таким чином, ця речовина може впливати на пролі�
ферацію і регенерацію тканин, інгібуючи диференціа�
цію клітин.
REFERENCES
1. Colthurst J.M., Williams R.L., Hiscott P.S., Grierson I.
Biomaterials used in the posterior segment of the eye //
Biomaterials, 2000, 21, p. 649–665.
2. Yoder M.C., Howell J.C. General concepts about stem
cells as potential therapeutic agents // Neo Reviews,
2003, 4, p. 175–180.
3. Puente G.L., Borris J.D., Kelly F.J. Identification of can�
didate regulators of embryonic stem cell differentiation
by comparative phosphoprotein�affinity profiling //
Mol. & Cell. Proteomics, 2006, 5, p. 57–67.
4. Bahrami R.A., Matin M.M., Andrews W.P. The CDK
inhibitor p27 enhances neural differentiation in
pluripotent NTERA2 human EC cells, but does not
permit differentiation of 2102Ep nullipotent human EC
cells // Mech. Dev, 2005, 122, p. 1034–1042.
5. Draper S.J., Pigott C., Thomson A.J., Andrews W.P.
Surface antigens of human embryonic stem cells
changes upon differentiation in culture // J. Anat,
2002, 200, p. 249–258.
6. Andrews P.W. Retinoic acid induces neuronal differen�
tiation of a cloned human embryonal carcinoma cell
line in vitro // Dev. Biol, 1984, 103, p. 285–293.
7. Kassem M., Kristiansen M., Abdallah M.B. Mesenchymal
stem cells: cell biology and potential use in therapy //
Clin. Pharmacol. Toxicol, 2004, 95, p. 209–214.
8. Mei�Hui T. Oct4 expression in adult human stem cells:
evidence in support of the stem cell theory of carcino�
genesis // J. Life Sci, 2005, 26, p. 495–502.
9. Remenyi A., Lins K., Nissen J.L., Reinbold R., Wil�
manns M. Crystal structure of a POU/HMG/DNA ter�
nary complex suggests differential assembly of Oct4 and
Sox2 on two enhancers // Genes Dev, 2003, 17, p. 2048–
2059.
10. Meyer K., Palmer J.W. The polysaccharide of the vitre�
ous humour // J. Biol. Chem., 1934, 107, p. 629–634.
11. Gardner D. Fetal development after transfer is increased
by replacing protein with the glycosaminoglycan
hyaluronan for mouse embryo culture and transfer //
Hum. Reprod, 1999, 14, p. 2575–2580.
12. Stojkovic M., Lako M. Derivation, growth and applica�
tions of human embryonic stem cells // Reprod, 2004,
128, p. 259–267.
13. Andrews P.W. From teratocarcinomas to embryonic
stem cells // Philos. Trans. R. Soc. Lond B Biol. Sci,
2002, 357, p. 405–417.
14. Eisenbarth S.G., Walsh S.F., Nirenberg M. Monoclonal
antibody to a plasma membrane antigen of neurons //
Proc. Nat. Acad. Sci. USA, 1979, 76, p. 4913–4917.
15. Kohler G., Milstein C. Continuous cultures of fused cells
secreting antibody of predefined specificity // Nature,
1975, 256, p. 495–497.
16. Clark L.D., Clark R.K., Heber�Katz E. A new murine
model for mammalian wound repair and regeneration //
Clin. Immunol. Immunopathol, 1998, 88, p. 35–45.
17. Deb�Rinker P., Ly D., Jezierski A., Sikorska M., Wal�
ker R.P. Sequential DNA methylation of the Nanog
and Oct�4 upstream regions in human NT2 cells dur�
ing neuronal differentiation // J. Biol. Chem, 2005,
280, p. 6257–6260.
18. Przyborski A.S., Smith S., Wood A. Transcriptional pro�
filing of neuronal differentiation by human embryonal
carcinoma stem cells In Vitro // Stem Cells, 2003, 21,
p. 459–471.
19. Hart H.A., Hartley L., Ibrahim M., Robb L. Identifica�
tion, cloning and expression analysis of the pluripoten�
cy promoting Nanog genes in mouse and human //
Dev. Dyn, 2004, 230, p. 187–198.
20. Moreland W. Intra�articular hyaluronan (hyaluronic
acid) and hylans for the treatment of osteoarthritis //
Arthritis. Res. Ther, 2003, 5, p. 54–67.
21. Heldin P. Importance of hyaluronan biosynthesis and
degradation in cell differentiation and tumor formation //
Braz. J. Med. Biol. Res, 2003, 36, p. 967–973.
22. Hamann K.J. Hyaluronic acid enhances cell prolifera�
tion during eosinopoiesis through the CD44 surface
antigen // J. Immunol, 1995, 154, p. 4073–4080.
Received 09.06.09
ІSSN 0564–3783. Цитология и генетика. 2010. № 6 21
Investigating the effects of vitreous humour (crude extract) on growth and differentiation
|