Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens
Breast cancer is the most common malignancy among females in the world. Age and familial history are the major risk factors for the development of this disease in Iran. Mutations of BRCA1 and BRCA2 genes are associated with a greatly increased risk for development of familial breast cancer. Frequenc...
Gespeichert in:
| Datum: | 2008 |
|---|---|
| Hauptverfasser: | , , , , , |
| Format: | Artikel |
| Sprache: | English |
| Veröffentlicht: |
Інститут клітинної біології та генетичної інженерії НАН України
2008
|
| Schlagworte: | |
| Online Zugang: | http://dspace.nbuv.gov.ua/handle/123456789/8086 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens / H. Rassi, M. Houshmand, M. Hashemi, K. Majidzadeh, M.H. Hosseini Akbari, M. Shafa Shariat Panahi // Цитология и генетика. — 2008. — Т. 42, № 2. — С. 55-62. — Бібліогр.: 31 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
irk-123456789-8086 |
|---|---|
| record_format |
dspace |
| spelling |
irk-123456789-80862010-04-30T12:01:29Z Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens Rassi, H. Houshmand, M. Hashemi, M. Majidzadeh, K. Hosseini Akbari, M.H. Shafa Shariat Panahi, M. Оригинальные работы Breast cancer is the most common malignancy among females in the world. Age and familial history are the major risk factors for the development of this disease in Iran. Mutations of BRCA1 and BRCA2 genes are associated with a greatly increased risk for development of familial breast cancer. Frequency of BRCA mutations was identified in familial breast cancers (FBC) and non familial breast cancers (NFBC) by molecular genetics, morphological and Immunohistochemical methods. Thirty forth formalin fixed, paraffin embedded breast tissue tumors were analyzed from 16 patients with FBC and 18 patients with NFBC. Three 5382insC mutations detected by multiplex PCR in 16 familial breast cancers. Immunohistochemical method was used to detect estrogen receptor (ER) and progesterona receptor (PR) and TP53. Comparison of ER, PR and TP53 exhibited high difference (P < 0.0001) in familial breast cancers and nonfamilial breast cancers. Our results demonstrated that 5382insC mutation, ER, PR, TP53, mitotic activity, polymorphism, necrosis and tubules can serve as the major risk factors for the development of FBC. Рак молочної залози (РМЗ) є найбільш частим видом злоякісних пухлин у жінок в світі. В Ірані вік та наявність захворювань РМЗ в найближчих родичів є головними факторами ризику розвитку цього захворювання. Мутації гена BRCA1/2 зумовлюють високий ризик розвитку протягом життя РМЗ. Досліджено частоти мутацій ВRCA в осіб з сімейним раком молочної залози (СРМЗ) та несімейним раком молочної залози (НСРМЗ) з Ірану. Для досягнення поставленої цілі використовували молекулярно-генетичні, морфологічні та імуногістохімічні методи. Проаналізовано 34 тканини пухлин, зафіксованих в парафіні, у 16 хворих СРМЖ і 18 хворих НСРМЖ. При дослідженні генів ВRCA1 та ВRCA2 з мультиплексним ПЦР ідентифіковано три мутації (538insC) в 16 хворих СРМЖ. Імуногістохімічним методом визначали рецептор естрогена (ЕР), рецептор прогестерона (РП) і ТР53. Порівняння ЕР, РП і ТР53 в тканинах СРМЖ та НРМЖ показало високі достовірні відмінності (Р < 0.0001). В результаті досліджень виявлено, що мутація 5382insC, ЭР, РП, TP53, мітотична особливість, поліморфізми, некроз і тубули можуть бути використані як головні фактори ризику розвитку СРМЖ. Отмечено, что рак молочной железы (РМЖ) является наиболее частым видом злокачественных опухолей у женщин в мире. В Иране возраст и наличие заболеваний РМЖ у ближайших родственников являются главными факторами риска развития этого заболевания. Мутации гена BRCA1/2 обусловливают высокий риск развития в течение жизни РМЖ. Исследованы частоты мутаций BRCA у лиц с семейным РМЖ (СРМЖ) и несемейным РМЖ (НСРМЖ) из Ирана. Для достижения поставленной цели использованы молекулярно-генетические, морфологические и иммуногистохимические методы. Проанализированы 34 ткани опухолей, зафиксированных в парафине, у 16 больных СРМЖ и 18 больных НСРМЖ. При исследовании генов BRCA1 и BRCA2 с мультиплексным ПЦР идентифицированы три мутации (5382insC) у 16 больных СРМЖ. Иммуногистохимическим методом определены рецепторы эстрогена (ЭР), прогестерона (РП) и ТР53. Сравнение ЭР, РП и ТР53 в тканях СРМЖ и НРМЖ показало высокие достоверные различия. В результате исследований выявлено, что мутация 5382insC, ЭР, РП, ТР53, митотическая особенность, полиморфизмы, некроз и тубулы можно использовать как главные факторы риска развития СРМЖ. 2008 Article Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens / H. Rassi, M. Houshmand, M. Hashemi, K. Majidzadeh, M.H. Hosseini Akbari, M. Shafa Shariat Panahi // Цитология и генетика. — 2008. — Т. 42, № 2. — С. 55-62. — Бібліогр.: 31 назв. — англ. 0564-3783 http://dspace.nbuv.gov.ua/handle/123456789/8086 en Інститут клітинної біології та генетичної інженерії НАН України |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| language |
English |
| topic |
Оригинальные работы Оригинальные работы |
| spellingShingle |
Оригинальные работы Оригинальные работы Rassi, H. Houshmand, M. Hashemi, M. Majidzadeh, K. Hosseini Akbari, M.H. Shafa Shariat Panahi, M. Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens |
| description |
Breast cancer is the most common malignancy among females in the world. Age and familial history are the major risk factors for the development of this disease in Iran. Mutations of BRCA1 and BRCA2 genes are associated with a greatly increased risk for development of familial breast cancer. Frequency of BRCA mutations was identified in familial breast cancers (FBC) and non familial breast cancers (NFBC) by molecular genetics, morphological and Immunohistochemical methods. Thirty forth formalin fixed, paraffin embedded breast tissue tumors were analyzed from 16 patients with FBC and 18 patients with NFBC. Three 5382insC mutations detected by multiplex PCR in 16 familial breast cancers. Immunohistochemical method was used to detect estrogen receptor (ER) and progesterona receptor (PR) and TP53. Comparison of ER, PR and TP53 exhibited high difference (P < 0.0001) in familial breast cancers and nonfamilial breast cancers. Our results demonstrated that 5382insC mutation, ER, PR, TP53, mitotic activity, polymorphism, necrosis and tubules can serve as the major risk factors for the development of FBC. |
| format |
Article |
| author |
Rassi, H. Houshmand, M. Hashemi, M. Majidzadeh, K. Hosseini Akbari, M.H. Shafa Shariat Panahi, M. |
| author_facet |
Rassi, H. Houshmand, M. Hashemi, M. Majidzadeh, K. Hosseini Akbari, M.H. Shafa Shariat Panahi, M. |
| author_sort |
Rassi, H. |
| title |
Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens |
| title_short |
Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens |
| title_full |
Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens |
| title_fullStr |
Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens |
| title_full_unstemmed |
Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens |
| title_sort |
application of multiplex pcr with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens |
| publisher |
Інститут клітинної біології та генетичної інженерії НАН України |
| publishDate |
2008 |
| topic_facet |
Оригинальные работы |
| url |
http://dspace.nbuv.gov.ua/handle/123456789/8086 |
| citation_txt |
Application of multiplex PCR with histopathologic features for detection of familial breast cancer in formalin-fixed, paraffin-embedded histologic specimens / H. Rassi, M. Houshmand, M. Hashemi, K. Majidzadeh, M.H. Hosseini Akbari, M. Shafa Shariat Panahi // Цитология и генетика. — 2008. — Т. 42, № 2. — С. 55-62. — Бібліогр.: 31 назв. — англ. |
| work_keys_str_mv |
AT rassih applicationofmultiplexpcrwithhistopathologicfeaturesfordetectionoffamilialbreastcancerinformalinfixedparaffinembeddedhistologicspecimens AT houshmandm applicationofmultiplexpcrwithhistopathologicfeaturesfordetectionoffamilialbreastcancerinformalinfixedparaffinembeddedhistologicspecimens AT hashemim applicationofmultiplexpcrwithhistopathologicfeaturesfordetectionoffamilialbreastcancerinformalinfixedparaffinembeddedhistologicspecimens AT majidzadehk applicationofmultiplexpcrwithhistopathologicfeaturesfordetectionoffamilialbreastcancerinformalinfixedparaffinembeddedhistologicspecimens AT hosseiniakbarimh applicationofmultiplexpcrwithhistopathologicfeaturesfordetectionoffamilialbreastcancerinformalinfixedparaffinembeddedhistologicspecimens AT shafashariatpanahim applicationofmultiplexpcrwithhistopathologicfeaturesfordetectionoffamilialbreastcancerinformalinfixedparaffinembeddedhistologicspecimens |
| first_indexed |
2025-07-02T10:48:40Z |
| last_indexed |
2025-07-02T10:48:40Z |
| _version_ |
1836531917634142208 |
| fulltext |
55ІSSN 0564–3783. Цитология и генетика. 2008. № 2
Breast cancer is the most common malignancy among
females in the world. Age and familial history are the major
risk factors for the development of this disease in Iran.
Mutations of BRCA1 and BRCA2 genes are associated with a
greatly increased risk for development of familial breast can�
cer. Frequency of BRCA mutations was identified in familial
breast cancers (FBC) and non�familial breast cancers
(NFBC) by molecular genetics, morphological and Immu�
nohistochemical methods. Thirty forth formalin�fixed, paraf�
fin�embedded breast tissue tumors were analyzed from 16
patients with FBC and 18 patients with NFBC. Three
5382insC mutations detected by multiplex PCR in 16 familial
breast cancers. Immunohistochemical method was used to
detect estrogen receptor (ER) and progesterona receptor (PR)
and TP53. Comparison of ER, PR and TP53 exhibited high
difference (P < 0.0001) in familial breast cancers and non�
familial breast cancers. Our results demonstrated that
5382insC mutation, ER, PR, TP53, mitotic activity, polymor�
phism, necrosis and tubules can serve as the major risk factors
for the development of FBC.
Introduction. Breast cancer with age�adjusted
incidence rate of 13.5 per 100 000 people per year
and age�adjusted mortality rates of 5.5 per
100,000 people per year is the first most common
cancer in Iranians women. Incidence rates are
higher in the most of the developed areas (in
Europe and America) than in Asia [1]. A family
history of breast cancer is one of the major risk fac�
tors for the development of this disease in Iran [2].
Familial breast cancer is characterized by early age
at onset, bilaterality, vertical transmission through
both maternal and paternal lines, and familial
association with tumors of other organs, particu�
larly the ovary and prostate gland. It has been
shown that, even after adjusting for age, Iranian
breast cancer patients relatively younger than their
Western counterparts [3]. Although the majority of
breast cancer cases are to be regarded as sporadic
forms (90–95 %), approximately 5–10 % breast
cancer cases in the general population have been
suggested to be attributed to an inherited cancer
susceptibility gene such as BRCA1 and BRCA2,
p53, PTEN, and STK11/LKB1 [4]. The most
common gene changes in breast cancer are those
of the BRCA1 and BRCA2 genes. BRCA muta�
tions are associated with a greatly increasedrisk for
breast cancer development, with risk estimates
ranging from 59–87 % for BRCA1 and from
38–80 % for BRCA2 mutations [4–8]. Known
BRCA mutations have been collected in the Breast
Cancer Information Core (BIC) database [9].
Nearly 2,000 distinct mutations have been identi�
fied in both BRCA1 and BRCA2, and several
founder mutations have been identified in each of
these two genes in various populations. There is
not a perfect method to screen for unknown muta�
tions; combinations of several methods may be
necessary for accurate genetic diagnosis. Although
genetic testing for BRCA mutations within high�
risk families is available but it is expensive and time
consuming procedures because of the large size of
both genes, the absence of hot spots for mutations
throughout their entire coding region, and the low
percentage of mutated cases. Most reported
germline mutations are located in the coding
sequence of BRCA and represent single nucleotide
substitutions and small sequence deletions or
insertions causing truncations of the BRCA proteins.
Three founder mutations, 185delAG, 5382insC and
6174delT are relatively common in Ashkenazi
Jewish individuals with a combined prevalence of
2.3 % in this population, compared with a general
H. RASSI 1, M. HOUSHMAND 2,M. HASHEMI 3,
K. MAJIDZADEH 5, M.H. HOSSEINI AKBARI 4,
M. SHAFA SHARIAT PANAHI 2
APPLICATION OF MULTIPLEX PCR
WITH HISTOPATHOLOGIC FEATURES
FOR DETECTION OF FAMILIAL BREAST
CANCER IN FORMALIN.FIXED,
PARAFFIN.EMBEDDED HISTOLOGIC
SPECIMENS
© H. RASSI, M. HOUSHMAND, M. HASHEMI, K. MAJIDZADEH,
M.H. HOSSEINI AKBARI,M. SHAFA SHARIAT PANAHI, 2008
1 National Medical Academy, Kiev, Ukraine
2 National Institute for Genetic Engineering and Biotechnology,
Tehran, Iran
3 Khatam Hospital, Tehran;
4 Baghiatollah Hospital, Tehran,
5Iranian breast cancer center, Tehran
56
H. Rassi, M. Houshmand, M. Hashemi, K. Majidzadeh, M.H. Hosseini Akbari
ISSN 0564–3783. Цитология и генетика. 2008. № 2
population prevalence of approximately 0.1 % for
BRCA mutations [10]. Women who know that are
the carrier of BRCA mutation, may use this infor�
mation to make more informed decisions about
their health care, including whether to use tamox�
ifen and/or prophylactic surgery to delay or pre�
vent the onset of cancer. The morphologic and
immunohistochemical profiles of breast cancers
may help identify patients who are likely to carry
germline mutations in BRCA1 and BRCA2.
Breast cancers arising in carriers of mutations in
the breast cancer susceptibility genes, BRCA1/2,
differ histologically from each other and from
breast cancers unselected for a family history
[11–14]. Archival materials are a valuable source
for the study of molecular diagnosis methods in
breast cancer and they are the most widely avail�
able material for retrospective clinical studies.
Comparison mutation detection from archival tis�
sues and blood for BRCA genes was shown that
mutation detection was the most accurate for
newer archival breast cancer tissues, high fidelity
Taq with shorter PCR amplicon length yielded the
highest mutation detection success rate and lowest
artifact rate; and base substitutions were more
often correctly identified than frameshift muta�
tions or wild�type sequences [15]. Although the
yield of DNA from archival tissues is less (four
times less than that from fresh tissue and 30 % of
the amount that can be extracted from frozen tis�
sue) or can be fragmented, many of these problems
can be circumvented by amplification [16]. Breast
cancers in patients with familial history are more
often negative for Estrogen receptor (ER), Pro�
gesterone receptor (PR), and Human Epidermal
Receptor 2 (HER�2), and are more likely to be
positive for p53 protein compared with controls.
The use of morphologic and immunohistochemi�
cal features provides a helpful and cost�effective
tool for those making decisions about genetic
screening for carrier of BRCA mutation. In this
article, we will analyse the three founder muta�
tions, 185delAG and 5382insC (in BRCA1) and
6174delT (in BRCA2) by multiplex PCR in forma�
lin�fixed, paraffin�embedded tissue blocks. This
study evaluates the pathological and molecular
diagnostic profiles of familial and non�familial
breast cancers.
Materials and Methods. Case Selection. We
reviewed archival formalin�fixed, paraffin�embed�
ded tissue blocks from women with breast cancer
diagnosed the age of 25–80 years, selected from
the histopathology archives of the Department of
Pathology, Khatam and Baghiatollah Hospital in
Iran for the years 2004 and 2005. Verification of
every cancer reported in a relative was sought
through pathology reports, hospital records. All
cases were reviewed using a special questionnaire,
which allowed taking into account the presence or
absence family history of breast cancer and also
other pathology information. Family history char�
acteristics associated with an increased likelihood
of carrying a BRCA1 or BRCA2 mutation include
multiple cases of breast cancer in the family. We
analyzed 34 formalin�fixed, paraffin�embedded
tissue blocks from 16 familial breast cancer patients
and 18 non�familial breast cancer patients.
DNA Extraction. In the case of paraffin�embed�
ded samples, tumor pathology was reviewed and
tumor tissues were selected for dissection from
paraffin blocks. Paraffin was removed from the 20�
mm sections by being agitated first in 200µl solu�
tion Tris�HCL + 0.5 % Tween�20 and then heat�
ing in a 650 W microwave oven for up to 45 s. The
tubes were spun whilst warm at 12,000 rims for
15 min and placed on ice. Using a sterile pipette
tip the solid wax disc was removed prior to diges�
tion. So 5 µl of 10 mg/ml Proteinase K was added
to each tube and digested for 3–5 h at 65 °С, with
gentle agitation every hour. 200 µl Tris�HCL was
added to each digest solution, heated to 99 °С for
10 min, spun at 12,000 rims for 15 min and placed
on ice. Any hardened wax was removed, the sam�
ple re�spun at 12,000 rims for 15 min, and top
layer removed for later analysis.
Multiplex PCR. Multiplex PCR was used to
detect the simultaneous detection of three com�
mon mutations: 185delAG and 5382insC in
BRCA1, and 6174delT in BRCA2. PCR amplifi�
cation was performed using 100 ng of DNA
derived from formalin�fixed and paraffin�embed�
ded with primers and PCR amplification condi�
tions as published by Pak Cheung R and et al. [17].
The reaction mixture underwent initial denatura�
tion process at 94 °С for 5 min, followed by 35
cycles at 94 °С for 60 sec, 55 °С for 60 sec, and
72 °С for 35 sec. The final extension was performed
at 72 °С for 10 min in Techne Thermocycler. The
PCR fragments were run in 2 % agarose gel and
visualized by ethidium bromide staining.
57
Application of multiplex PCR with histopathologic features for detection of familial breast cancer
ІSSN 0564–3783. Цитология и генетика. 2008. № 2
Immunohistochemistry. Morphological and
immunohistochemical diagnoses of 16 familial
breast cancer and 18 non familial breast cancer
were retrieved from their hospital records. The
Nottingham histological grading system was used
to assess the grade of breast cancer samples.
Immunohistochemical staining of sections from
paraffin wax embedded tissues from these cases for
the expression of ER, PR and p53 was carried out
using a standard method, the avidin biotin com�
plex (ABC) procedure. Sections from the tissue
were immersed in boiling 10 mM sodium citrate at
pH 6.5 for 2 min in a pressure cooker. The per�
centage of stained nuclei, independent of the
intensity, was scored for ER, PR and p53. For cat�
egorical analysis, a case was considered positive
when >10, 10, and 25 % of the cells were stained
with ER, PR, and p53, respectively.
Statistical Methods. Chi�square test for Trend or
others were used to make comparisons. Statistical
analyses were performed using the 3.3.2 version of
the Epi Info (TM) 2005 software.
Results. Results of DNA extraction and multiplex
PCR from formalin�fixed and paraffin�embedded
samples. Eighty�two blocks were used for multiplex
PCR. For each mutation, three primers (one com�
mon, one specific for the mutant, and one specific
for the wild�type allele) were used. The PCR�
primers are described in Table 1. Successful DNA
extraction was assessed by PCR amplification of
three fragment of the BRCA gene. DNA was suc�
cessfully extracted from every block but success of
DNA amplification after microwave treatment and
purification using simple boiling was 34 of 84 sam�
ples (40 %) and 60 % of DNA samples were degrad�
ed DNA (Figure). Three 5382insC mutations were
detected by multiplex PCR in BRCA1 gene.
Distributions of morphological and immunohisto�
chemical features in familial and non�familial breast
cancers. Among the 34 cases with breast cancer
selected in our study (20–85 age), 16 (47 %) were
positive for family history and 18 (53 %) without
any family history of breast cancer. 2 out of
16 familial patients were positive for ovarian can�
cer. Table 2 lists the distributions of morphological
features in familial and non�familial tumors.
Tumors associated with family history exhibited
higher mitotic activity (OR = 5,34, P < 0,0001),
higher polymorphism (OR = 1,39, P < 0,004),
lower necrosis (OR = 0,19, P < 0,0003) and lower
tubules (OR = 0,49, P < 0,04), than non�family his�
tory cancers. The immunohistochemical diagnoses
of 16 familial breast cancers and 18 non familial
breast cancers were retrieved from their hospital
records. Immunohistochemical staining of sections
from paraffin wax embedded tissues from these cases
for the expression of ER, PR and TP53 was carried
out using the avidin biotin complex (ABC) proce�
dure. Overall, Estrogen Receptor ER (OR = 4,69,
P < 0.0001), Progesterone Receptor PR (OR = 4,52,
P < 0.0001), expression was observed less frequently
in familial tumors cases than non�familial cases.
Breast cancers occurring in familial tumors cases
had significantly higher levels of TP53 (OR = 0,23,
P < 0,0001) expression compared with cancers
occurring in non�familial cases.
Comparison of results of Multiplex PCR with
pathological and immunohistochemical features in
familial and non familial breast cancer. Comparison
Electrophoregram of PCR products Lane 1, 100�bp lad�
der; 2, 5, 7, 10,11 and 13 – samples without amplification;
12 – sample with mutation; 3, 4, 14 – wild type samples; 8,
9 – samples with degraded DNA
Ta b l e 1
Nucleotide sequences of the primer sets
Mutation
Size of
amplicon
Primer sequence
BRCA1
185delAG
BRCA1
5382insC
BRCA2
6174delT
335 bp
354 bp
271 bp
295 bp
151 bp
171 bp
Common 5'�ggttggcagcaatatgtgaa
Wild�type 5'�gctgacttaccagatgggactctc
Mutant 5'�cccaaattaatacactcttgtcgtga�
cttaccagatgggacagta
Common 5'�gacgggaatccaaattacacag
Wild�type 5'�aaagcgagcaagagaatcgca
Mutant 5'�aatcgaagaaaccaccaaagtcc�
ttagcgagcaagagaatcacc
Common 5'�agctggtctgaatgttcgttact
Wild�type 5'�gtgggatttttagcacagctagt
Mutant 5'�cagtctcatctgcaaatacttcagg�
gatttttagcacagcatgg
58
H. Rassi, M. Houshmand, M. Hashemi, K. Majidzadeh, M.H. Hosseini Akbari
ISSN 0564–3783. Цитология и генетика. 2008. № 2
Ta b l e 2
Distribution of molecular and immunohistochemical features in Familial Breast Cancer (FBC)
and Non)Familial Breast Cancers (NFBC)
Characteristics Groups
FBC (n = 16) NFBC (n = 18)
Number (%)
Odds Ratio (OR)
Cancer type
Other cancers
DCIS
Necrosis
Tumor size
Age groups (years)
Grade
Tubules
Mitotic activity
Polymorphisms
ER
PR
13 (81 %)
3 (19 %)
2 (13 %)
14 (87 %)
11 (69 %)
5 (31 %)
4 (25 %)
12 (75 %)
4 (25 %)
11 (69 %)
1 (6 %)
2 (13 %)
2 (13 %)
7 (44 %)
1 (6 %)
3 (18 %)
1 (6 %)
3 (19 %)
7 (44 %)
6 (37 %)
13 (78 %)
3 (19 %)
0 (0 %)
6 (38 %)
5 (31 %)
5 (31 %)
12 (75 %)
1 (6 %)
3 (19 %)
4 (25 %)
12 (75 %)
5 (31 %)
11 (69 %)
16 (89 %)
2 (11 %)
3 (17 %)
15 (83 %)
11 (61 %)
7 (39 %)
1 (6 %)
17 (94 %)
4 (22 %)
12 (67 %)
2 (11 %)
1 (6 %)
3 (17 %)
7 (39 %)
4 (22 %)
0 (1 %)
3 (17 %)
3 (17 %)
11 (61 %)
4 (22 %)
12 (67 %)
6 (33 %)
0 (0 %)
13 (72 %)
3 (17 %)
2 (11 %)
6 (33 %)
11 (61 %)
1 (6 %)
11 (61 %)
7 (39 %)
12 (67 %)
6 (33 %)
1,00
1,91
χ2 = 2,50(P<0,2)
1,00
1,37
χ2 = 0,62(P<0, 5)
1,00
0,70
χ2 = 1,40(P<0,3)
1,00
0,19
χ2 = 13,7(P<0,0003)
1,00
0,91
0,48
χ2 = 1,07(P<0,3)
1,00
0,35
0,52
0,13
8,31
0,16
χ2 = 1,49(P<0,3)
1,00
0,65
1,50
χ2 = 1,82(P<0,2)
1,00
0,49
0,0
χ2 = 4,54(P<0,04)
1,00
3,46
5,34
χ2 = 22,5(P<0,0001)
1,00
0,04
1,39
χ2 = 8,49(P<0,004)
1,00
4,69
χ2 = 26,3(P<0,0001)
1,00
4,52
χ2= 25,8(P<0,0001)
Ductal carcinoma
Lobular carcinoma
Yes
No
Present
Absent
Present
Absent
< 2 cm
2–5 cm
� 5 cm
<30
31–40
41–50
51–60
61–70
>71
I
II
III
3 (< 10 %)
2 (10–75)
1(>75 %)
Low
Moderate
High
1
2
3
+
–
+
–
59
Application of multiplex PCR with histopathologic features for detection of familial breast cancer
of incidence of 5382insC mutation in 16 familial
and 18 non�familial breast cancer patients has
shown that incidence of 5382insC mutation is high
and effective in familial patients (P < 0.0001) rela�
tively non�familial patients. Significantly higher,
than in non�familial breast cancer, incidence of
5382insC indicates that this may be founder
BRCA1 mutation characteristic for familial breast
cancers. In combination with this mutation, use of
morphological and immunohistochemical staining
provides a more accurate predictor of familial
breast cancer (Tabl. 2).
Discussion. In our study, we used multiplex
PCR and pathology methods to analyze 34 rou�
tinely submitted formalin�fixed, paraffin�embed�
ded tissue blocks from breast cancer patients. The
analysis of archival formalin�fixed, paraffin�
embedded tissue samples becomes increasingly
important for molecular genetic studies. A molec�
ular genetic analysis of human tissue often entails
the use of PCR with previously extracted DNA as
the template. The results of the current study indi�
cate that the pathology familial breast cancers
clearly differ on the basis of several measured
indices from the pathology of breast cancers did
not any family history of breast cancer. Breast can�
cer results from genetic and environmental factors
leading to accumulation of mutations in essential
genes. These mutations can be either germline or
sporadic events. Environmental risk factors for
breast cancer may vary in different geography of
the world and they are of greater importance than
genetic factors. The BRCA1 and BRCA2 genes
are most common gene changes in familial breast
cancers. The morphologic and molecular pheno�
type of breast cancers may help to identify patients
who are likely to carry germline mutations in
BRCA1 and BRCA2. Breast cancers in patients
with BRCA1 germline mutations exhibited higher
mitotic counts, higher grade and are more often
negative for ER, PR, and HER�2, and are more
likely to be positive for p53 protein compared with
controls. In contrast, c�MYC amplification was
present in 18.2; 62.5 and 12.5 % of BRCA1,
BRCA2, and non�BRCA1/2 carrier, respectively,
and 31 % in the control group. In combination
with ER and morphology, use of cytokeratin stain�
ing provides a more accurate predictor of
BRCA1 mutation status.
Numerous founder mutations have been report�
ed in BRCA1 and BRCA2 in different population.
The BIC database indicates that three founder
mutations have been observed in different popula�
tion especially in Ashkenazi Jewish patients. These
mutations with the highest number of registrations
associated with breast cancer are 5382insC,
185delAG (in BRCA1) and 6174delT (in BRCA2).
The BRCA2 6174delT mutation has been seen only
in Ashkenazi Jews [18], with a frequency of
0.9–1.5 % [19, 20]. The founder BRCA1 185delAG
mutation, with a frequency of 0.8–1.1 % in
Ashkenazi Jews [19, 21], is also observed in
Sephardic Jews, indicating an older origin. The
185delAG mutation has also been observed in indi�
viduals of English origin but on a different haplo�
type, which suggests a different origin. It is conclud�
ed that the 185delAG BRCA1 mutation occurs in
some non�Ashkenazi populations at rates compara�
ble with that of Ashkenazim especially in Iranian
Jews. The 185delAG BRCA1 mutation originated
before the dispersion of Jews in the diaspora and is
not limited to Ashkenazim [22]. The third founder
ІSSN 0564–3783. Цитология и генетика. 2008. № 2
Characteristics Groups
FBC (n = 16) NFBC (n = 18)
Number (%)
Odds Ratio (OR)
TP53
5382insC
10 (63 %)
6 (37 %)
3 (19 %)
13 (81 %)
5 (28 %)
13 (72 %)
0 (<1 %)
18 (>99 %)
1,00
0,23
χ2 = 24,6(P<0,0001)
1,00
0,04
χ2 = 17,9(P<0,0001)
+
–
+
–
N o t e . χ2 = Chi�square test for Trend.
Finish of Table 2
60
H. Rassi, M. Houshmand, M. Hashemi, K. Majidzadeh, M.H. Hosseini Akbari
mutation, BRCA1 5382insC, has a frequency of
0.13–0.3 % in Ashkenazi Jews. The 5382insC
mutation is observed in many populations, and the
vast majority of carriers share the same core haplo�
type. The analysis of the BIC data base files indi�
cates that the 5382insC mutation is the second
most frequent (200 records) of the total of the
mutations associated with breast cancer. Based on
the frequency and geographical distribution in
Europe, it has been suggested that the 5382insC
mutation originated in the Baltic area during the
medieval period approximately 38 generations ago
with a decreasing prevalence from the eastern to
the western regions in Europe [23]. No molecular
genetic study has yet been carried out on the
5382insC mutation in Iran. We have screened can�
cer patients from 16 familial patients and 18 non�
familial patients from Iran for 5382insC,
185delAG (in BRCA1) and 6174delT (in BRCA2)
mutations. One of three mutations (5382insC) was
found in 3 of the 16 familial patients after amplifi�
cation (19 %). Significantly higher, than in non
familial breast cancer, incidence of 5382insC indi�
cates that this may be founder effect for familial
breast cancer. In Russian familial breast/ovarian
cancer patients it accounts for 12 % of 25 the
mutations identified [24]. It is also present in 10 %
of 60 breast and ovarian cancer families in north�
eastern Poland [25]. A high frequency of this
mutation (13.3 %) has been described in
30 Canadian breast/ovarian cancer families [26].
It also constitutes a frequent mutation in 4 % of
248 Germans high�risk breast cancer population
[27]. In contrast, Scandinavian studies show a sur�
prisingly low frequency (1 %) in 100 finnishes
breast/ovarian cancer families [28]. Likewise, the
5382insC mutation was not identified in any of the
47 families with familial breast/ovarian cancer
studied in Southern Sweden, in 106 families in
Sweden, or in 25 families in Norway [29–31]. The
results suggest that cancers from non�familial his�
tory patients are of lower mitotic activity, lower
polymorphism, higher tubules and higher necrosis
and more positive for ER, PR, and are more likely
to be negative for p53 protein than breast cancers
with family history. Our analysis shows that testing
of 5382insC BRCA1 mutation in combination
with morphological and immunohistochemical
staining should be extremely effective and inex�
pensive tool in testing familial breast cancer aimed
to identify individuals with high risk of breast.
Currently, population screening is limited to cystic
fibrosis mutation analysis for adults of reproduc�
tive age, but several diseases such as breast cancer
meet minimum criteria for mutation�based
screening in adult.
This project has been supported by Project
13545 of Ministry of Science and Research technolo�
gy, Islamic Republic of Iran.
РЕЗЮМЕ. Рак молочной железы (РМЖ) является
наиболее частым видом злокачественных опухолей у
женщин в мире. В Иране возраст и наличие заболева�
ний РМЖ у ближайших родственников являются
главными факторами риска развития этого заболева�
ния. Мутации гена BRCA1/2 обусловливают высокий
риск развития в течение жизни РМЖ. Исследованы
частоты мутаций ВRCA у лиц с семейным раком молоч�
ной железы (СРМЖ) и несемейным раком молочной
железы (НСРМЖ) из Ирана. Для достижения постав�
ленной цели использовали молекулярно�генетические,
морфологические и иммуногистохимические методы.
Проанализированы 34 ткани опухолей, зафиксирован�
ных в парафине, у 16 больных СРМЖ и 18 больных
НСРМЖ. При исследовании генов ВRCA1 и ВRCA2
с мультиплексным ПЦР идентифицированы три му�
тации (5382insC) у 16 больных СРМЖ. Иммуногисто�
химическим методом определяли рецептор эстрогена
(ЭР), рецептор прогестерона (РП) и TP53. Сравнение
ЭР, РП и TP53 в тканях СРМЖ и НРМЖ показало вы�
сокие достоверные различия (P < 0.0001). В результате
исследований выявлено, что мутация 5382insC, ЭР,
РП, TP53, митотическая особенность, полиморфизмы,
некроз и тубулы могут быть использованы как глав�
ные факторы риска развития СРМЖ.
РЕЗЮМЕ. Рак молочної залози (РМЗ) є найбільш
частим видом злоякісних пухлин у жінок в світі. В
Ірані вік та наявність захворювань РМЗ в найближчих
родичів є головними факторами ризику розвитку
цього захворювання. Мутації гена BRCA1/2 зумов�
люють високий ризик розвитку протягом життя РМЗ.
Досліджено частоти мутацій ВRCA в осіб з сімейним
раком молочної залози (СРМЗ) та несімейним раком
молочної залози (НСРМЗ) з Ірану. Для досягнення
поставленої цілі використовували молекулярно�гене�
тичні, морфологічні та імуногістохімічні методи.
Проаналізовано 34 тканини пухлин, зафіксованих в
парафіні, у 16 хворих СРМЖ і 18 хворих НСРМЖ.
При дослідженні генів ВRCA1 та ВRCA2 з мульти�
плексним ПЦР ідентифіковано три мутації (538insC) в
16 хворих СРМЖ. Імуногістохімічним методом
визначали рецептор естрогена (ЕР), рецептор про�
гестерона (РП) і ТР53. Порівняння ЕР, РП і ТР53 в
ISSN 0564–3783. Цитология и генетика. 2008. № 2
61
Application of multiplex PCR with histopathologic features for detection of familial breast cancer
тканинах СРМЖ та НРМЖ показало високі досто�
вірні відмінності (Р < 0.0001). В результаті досліджень
виявлено, що мутація 5382insC, ЭР, РП, TP53,
мітотична особливість, поліморфізми, некроз і тубули
можуть бути використані як головні фактори ризику
розвитку СРМЖ.
REFERENCE
1. Parkin D.M., Bray F., Ferlay J., Pisani P. Global Cancer
Statistics 2002 // Cancer J. Clin. – 2005. – 55, № 2. –
P. 74–108.
2. Montazeri A., Ebrahimi M., Mehrdad N., Ansari M.,
Sajadian A. Delayed presentation in breast cancer: a
study in Iranian women // BMC Womens Health. –
2003. – 3, № 1. – P. 4.
3. Harirchi I., Ebrahimi M., Zamani N., Jarvandi S.,
Montazeri A. Breast cancer in Iran: a review of 903 case
records // Publ. Health. – 2000. – 114. – P. 143–145.
4. Collaborative Group on Hormonal Factors in Breast
Cancer. Familial breast cancer: collaborative reanalysis
of individual data from 52 epidemiological studies
including 58,209 women with breast cancer and
101,986 women without the disease // Lancet. – 2001. –
358. – P. 1389–1399.
5. Ford D., Easton D.F., Bishop D.T., Narod S.A., Goldgar
D.E. Risks of cancer in BRCA1�mutation carriers.
Breast Cancer Linkage Consortium // Lancet. – 1994. –
343. – P. 692–695.
6. Easton D.F., Steele L., Fields P., Ormiston W., Averill D.,
Daly P.A., McManus R., Neuhausen S.L., Ford D.,
Wooster R., Cannon�Albright L.A., Stratton M.R.,
Goldgar D.E. Cancer risks in two large breast cancer
families linked to BRCA2 on chromosome 13q12–13 //
Amer. J. Hum. Genet. – 1997. – 61. – P. 120–128.
7. Satagopan J.M., Offit K., Foulkes W., Robson M.E.,
Wacholder S., Eng C.M., Karp S.E., Begg C.B. The life�
time risks of breast cancer in Ashkenazi Jewish carriers
of BRCA1 and BRCA2 mutations // Cancer Epidem.
Biomark. Prev. – 2001. – 10. – P. 467–473.
8. Struewing J.P., Hartge P., Wacholder S., Baker S.M.,
Berlin M., McAdams M., Timmerman M.M., Brody
L.C., Tucker M.A. The risk of cancer associated with
specific mutations of BRCA1 and BRCA2 among
Ashkenazi Jews // N. Engl. J. Med. – 1997. – 336. –
P. 1401–1408.
9. An Open Access On�Line Breast Cancer Mutation Data
Base. Bethesda, Md: National Human Genome
Research Institute, 2002. Available online. Last accessed
September 27, 2004.
10. Fodor F.H., Weston A., Bleiweiss I.J., McCurdy L.D.,
Walsh M.M., Tartter P.I., Brower S.T., Eng C.M.
Frequency and carrier risk associated with common
BRCA1 and BRCA2 mutations in Ashkenazi Jewish
breast cancer patients // Amer. J. Hum. Genet. – 1998. –
63, № 1. – P. 45–51.
11. Lakhani S.R., Easton D.F., Stratton M.R. The Breast
Cancer Linkage Consortium. Pathology of familial
breast cancer: differences between breast cancers in
carriers of BRCA1 or BRCA2 mutations and sporadic
cases // Lancet. – 1997. – 349. – P. 1505–1510.
12. Lakhani S.R., Jacquemier J., Sloane J.P., Gusterson B.A.,
Anderson T.J., van de Vijver M.J., Farid L.M., Venter D.,
Antoniou A., Storfer�Isser A., Smyth E., Steel C.M., Haites
N., Scott R.J., Goldgar D., Neuhausen S., Daly P.A.,
Ormiston W., McManus R., Scherneck S., Ponder B.A.,
Ford D., Peto J., Stoppa�Lyonnet D., Bignon Y.J.,
Struewing J.P., Spurr N.K., Bishop D.T., Klijn J.G.,
Devilee P., Cornelisse C.J., Lasset C., Lenoir G.,
Barkardottir R.B., Egilsson V., Hamann U., Chang�
Claude J., Sobol H., Weber B., Stratton M.R., Easton D.F.
Multifactorial analysis of differences between sporadic
breast cancers and cancers involving BRCA1 and
BRCA2 mutations // J. Nat. Cancer Inst. – 1998. –
90. – P. 1138–1145.
13. Lakhani S.R., Gusterson B.A., Jacquemier J., Sloane
J.P., Anderson T.J., van de Vijver M.J., Venter D.,
Freeman A., Antoniou A., McGuffog L., Smyth E., Steel
C.M., Haites N., Scott R.J., Goldgar D., Neuhausen S.,
Daly P.A., Ormiston W., McManus R., Scherneck S.,
Ponder B.A., Futreal P.A., Peto J., Stoppa�Lyonnet D.,
Bignon Y.J., Stratton M.R. The pathology of familial
breast cancer: histological features of cancers in families
not attributable to mutations in BRCA1 or BRCA2 //
Clin. Cancer Res. – 2000. – 6. – P. 782–789.
14. Lakhani S.R., Van De Vijver M.J., Jacquemier J.,
Anderson T.J., Osin P.P., McGuffog L., Easton D.F. The
pathology of familial breast cancer: predictive value of
immunohistochemical markers estrogen receptor,
progesterone receptor, HER�2, and p53 in patients
with mutations in BRCA1 and BRCA2 // J. Clin.
Oncol. – 2002. – 20. – P. 2310–2318.
15. Bernstein J.L., Thompson W.D., Casey G., DiCioccio
R.A., Whittemore A.S., Diep A.T., Thakore S.S., Vaziri
S., Xue S., Haile R.W. Comparison of techniques for
the successful detection of BRCA1 mutations in fixed
paraffin�embedded tissue // Cancer Epidemiol.
Biomarkers Prev. – 2002. – 11, № 9. – P. 809–814.
16. Cooper M., Li S.Q., Bhardwaj T., Rohan T., Kandel R.A.
Evaluation of oligonucleotide arrays for sequencing of
the p53 gene in DNA from formalin�fixed, paraffin�
embedded breast cancer specimens // Clin. Chem. –
2004. – 50, № 3. – P. 500–508.
17. Chan P.C., Wong B.Y., Ozcelik H., Cole D.E. Simple and
Rapid Detection of BRCA1 and BRCA2 Mutations by
Multiplex Mutagenically Separated PCR // Clin.
Chem. – 1999. – 45, № 8. – P. 1285–1287.
18. Neuhausen S., Gilewski T., Norton L., Tran T., McGuire P.,
Swensen J., Hampel H., Borgen P., Brown K., Skolnick M.,
Shattuck�Eidens D., Jhanwar S., Goldgar D., Offit K.
Recurrent BRCA2 6174delT mutations in Ashkenazi
ІSSN 0564–3783. Цитология и генетика. 2008. № 2
62
H. Rassi, M. Houshmand, M. Hashemi, K. Majidzadeh, M.H. Hosseini Akbari
Jewish women affected by breast cancer // Nature
Genet. – 1996. – 13. – P. 126–128.
19. Roa B.B., Boyd A.A., Volcik K., Richards C.S. Ashkenazi
Jewish population frequencies for common mutations
in BRCA1 and BRCA2 // Nature Genet. – 1996. – 14. –
P. 185–187.
20. Oddoux C., Struewing J.P., Clayton C.M., Neuhausen S.,
Brody L.C., Kaback M., Haas B., Norton L., Borgen P.,
Jhanwar S., Goldgar D., Ostrer H., Offit K. The carrier
frequency of the BRCA2 6174delT mutation among
Ashkenazi Jewish individuals is approximately 1 % //
Nature Genet. – 1996. – 14. – P. 188–190.
21. Struewing J.P., Abeliovich D., Peretz T., Avishai N.,
Kaback M.M., Collins F.S., Brody L.C. The carrier fre�
quency of the BRCA1 185delAG mutation is approxi�
mately 1 percent in Ashkenazi Jewish individuals //
Nature Genet. – 1995. – 11. – P. 198–200.
22. Bar�Sade R.B., Kruglikova A., Modan B., Gak E., Hirsh�
Yechezkel G., Theodor L., Novikov I., Gershoni�Baruch
R., Risel S., Papa M.Z., Ben�Baruch G., Friedman E.
The 185delAG BRCA1 mutation originated before the
dispersion of Jews in the diaspora and is not limited to
Ashkenazim // Hum. Mol. Genet. – 1998. – 7, № 5. –
P. 801–805.
23. Szabo C.I., King M.C. Population genetics of BRCA1
and BRCA2 // Amer. J. Hum. Genet. – 1997. – 60. –
P. 1013–1020.
24. Tereschenko I.V., Basham V.M., Ponder B.A., Pharoah P.D.
BRCA1 and BRCA2 Mutations in Russian Familial
Breast Cancer // Hum. Mutat. – 2002. – 19, № 2. –
P. 184.
25. Perkowska M., BroZek I., Wysocka B., Haraldsson K.,
Sandberg T., Johansson U., Sellberg G., Borg A., Limon J.
BRCA1 and BRCA2 mutation analysis in breast�ovari�
an cancer families from northeastern Poland // Hum.
Mutat. – 2003. – 21, № 5. – P. 553–554.
26. Simard J., Tonin P., Durocher F., Morgan K., Rommens
J., Gingras S., Samson C., Leblanc J.F., Belanger C.,
Dion F. et al. Common origins of BRCA1 mutations in
Canadian breast and ovarian cancer families // Nat.
Genet. – 1994. – 8, № 4. – P. 392–398.
27. Backe J., Hofferbert S., Skawran B., Dork T., Stuhrmann
M., Karstens J.H., Untch M., Meindl A., Burgemeister R.,
Chang�Claude J., Weber B.H. Frequency of BRCA1
mutation 5382insC in German breast cancer patients //
Gynecol Oncol. – 1999. – 72, № 3. – P. 402–406.
28. Vehmanen P., Friedman L.S., Eerola H., McClure M.,
Ward B., Sarantaus L., Kainu T., Syrjakoski K.,
Pyrhonen S., Kallioniemi O.P., Muhonen T., Luce M.,
Frank T.S., Nevanlinna H. Low proportion of BRCA1
and BRCA2 mutations in Finnish breast cancer families:
evidence for additional susceptibility genes // Hum.
Genet. – 1997. – 6, № 13. – P. 2309–2315.
29. Johannsson O., Ostermeyer E.A., Hakansson S., Friedman
L.S., Johansson U., Sellberg G., Brondum�Nielsen K.,
Sele V., Olsson H., King M.C., Borg A. Founding
BRCA1 mutations in hereditary breast and ovarian
cancer in southern Sweden // Amer. J. Hum. Genet. –
1996. – 58, № 3. – P. 441–450.
30. Hakansson S., Johannsson O., Johansson U., Sellberg G.,
Loman N., Gerdes A.M., Holmberg E., Dahl N., Pandis N.,
Kristoffersson U., Olsson H., Borg A. Moderate frequency
of BRCA1 and BRCA2 germ�line mutations in
Scandinavian familial breast cancer // Amer. J. Hum.
Genet. – 1997. – 60, № 5. – P. 1068–1078.
31. Andersen T.I., Borresen A.L., Moller P. A common
BRCA1 mutation in Norwegian breast and ovarian
cancer families? // Amer. J. Hum. Genet. – 1996. –
59, № 2. – P. 486–487.
Поступила 05.09.07
ISSN 0564–3783. Цитология и генетика. 2008. № 2
|